Methods and compositions for cancer treatment
The nanoparticle-based immunotherapy platform addresses the lack of specificity in cancer treatments by using a combination of surface molecule and miRNA targets to ensure the Payload mRNA is translated only in cancer cells, reducing off-target toxicity and enhancing immune response.
Patent Information
- Application Number
- PCT/US2025/040212
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-23
- Filing Date
- 2025-07-31
- Publication Date
- 2026-02-05
AI Technical Summary
Current cancer immunotherapies lack specificity, leading to off-target toxicity due to shared antigens on healthy cells, necessitating a more targeted approach that distinguishes cancer cells effectively while minimizing adverse effects.
A nanoparticle-based immunotherapy platform using a combination of surface molecule targets and miRNA targets, delivering a Payload mRNA that recruits endogenous miRNAs for tissue-specific expression, allowing for the degradation or repression of the mRNA in healthy tissues and translation of a custom protein sequence in cancer cells.
Enhances cancer cell specificity by ensuring the Payload mRNA is translated only in cancer cells, reducing off-target toxicity and enhancing immune response through precise targeting mechanisms.
Smart Images

Figure US2025040212_05022026_PF_FP_ABST
Abstract
Description
METHODS AND COMPOSITIONS FOR CANCER TREATMENTPRIORITY CLAIM
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 677,440, filed July 31, 2024, and U.S. Provisional Patent Application No. 63 / 710,979, filed October 23, 2024, each of which is incorporated by reference in its entirety.FIELD OF THE INVENTION
[0002] The invention relates to a novel immunotherapy platform for treating cancer.REFERENCE TO THE SEQUENCE LISTING
[0003] This application contains a Sequence Listing which has been submitted electronically in XML format and which is hereby incorporated by reference in its entirety. The XML copy, created on July 31, 2025, is named “272386_570515_Sequence_Listing.xml” and is 724 kilobytes in size."BACKGROUND
[0004] Cancer treatment immunotherapies generally attempt to mount an attack against cancer cells in the body by involving the immune system. Some cancer immunotherapies are made up of cancer cells, parts of cells, or pure antigens (certain proteins on the cancer cells). Sometimes a patient’s own immune cells are removed and exposed to these substances in the lab to create the immunotherapy. The immunotherapy is injected into the body to increase or improve the immune response against cancer cells. While there is a wide range of cancer therapies, there is a need for a cancer treatment that is specific, simple to administer and effective. Antibodies are unique in their ability to both directly kill tumor cells while simultaneously engage the host immune system to develop long-lasting effector responses against the tumor. The combination of a multifaceted mechanism of action with target specificity distinguishes mAb therapy from treatments such as chemotherapy and underlies the capability of antibodies to elicit strong anti-tumor responses while minimizing toxicity and adverse events. However, cancer immunotherapies based on antibody targeting alone is not enough specificity since the target antigens, or other surface molecules, also appear on healthy cells, leading to off-target toxicity. Identifying appropriate markers can help design targeted therapies that separate cancer cells from healthy cells. The invention herein discloses an approach that uses multiple targeting mechanisms to provide high cancer cell specificity by using a combination of: (1) a surface molecule target (“Marker 1”) and (2) miRNA target(s) (“Marker 2”).SUMMARY OF THE INVENTION
[0005] In general, a method for marking cancer cells comprises applying a nanoparticle containing a Payload mRNA associated with a specific cancer, allowing the nanoparticle to enter a targeted cell through endosomal escape and release the Payload mRNA, wherein the Payload mRNA contains a Complementary miRNA Sequence(s), allowing the Payload mRNA to recruit endogenous Target miRNA(s) for tissue specific expression, and once binding of the Target miRNA occurs, degrading and / or repressing the Payload mRNA, and if no binding occurs, allowing the Payload mRNA to be translated to express a custom protein sequence (CPS). In certain embodiments, the nanoparticle can be delivered as or be conjugated to a cell-targeting moiety that allows it to target specific cells.
[0006] In certain embodiments, the nanoparticle is a lipid nanoparticle. In certain embodiments, the nanoparticle is a liposome. In certain embodiments, the nanoparticle is a polymer. In certain embodiments, the nanoparticle is a viral particle. In certain embodiments, the nanoparticle is a virus-like replicon particle.
[0007] In certain embodiments, the CPS is a universal cancer antigen (UCA). In certain embodiments, the UCA is a non-naturally occurring protein.
[0008] In certain embodiments, the CPS is a known disease antigen or a combination of known disease antigens.
[0009] In certain embodiments, the known disease antigen is coronavirus antigen, tetanus antigen, measles antigen, flu antigen, polio antigen, pertussis antigen, flu antigen, hepatitis antigen, mumps antigen, herpesvirus antigen, a bacterial antigen, or a combination of known disease antigens.
[0010] In some embodiments, a cell targeting moiety is a cell-targeting ligand.
[0011] In certain embodiments, the cell-targeting moiety is a DNA.
[0012] In certain embodiments, the cell-targeting moiety is a RNA.
[0013] In certain embodiments, the cell -targeting moiety is a peptide.
[0014] In certain embodiments, the cell-targeting moiety is a small molecule.
[0015] In certain embodiments, the cell-targeting moiety is an antibody.
[0016] In certain embodiments, the cell-targeting moiety targets a protein.
[0017] In certain embodiments, the cell-targeting moiety targets a carbohydrate.
[0018] In certain embodiments, the cell-targeting moiety targets a lipid.
[0019] In certain embodiments, the cell-targeting moiety targets a molecule on the cell surface.
[0020] In certain embodiments, the cell-targeting moiety is attached to the surface of a nanoparticle using click chemistry.
[0021] In certain embodiments, the cell-targeting moiety is attached to the surface of a nanoparticle using amine chemistry.
[0022] In certain embodiments, the cell-targeting moiety is attached to the surface of a nanoparticle using EDC / NHS coupling chemistry.
[0023] In certain embodiments, the cell-targeting moiety is a functionalized aptamer. In certain embodiments, the cell -targeting moiety is attached to the surface of the nanoparticle using thiol conjugation chemistry, for example, thiol-maleimide chemistry. In certain embodiments, the celltargeting moiety is the lipid nanoparticle’s preferential accumulation in a specific tissue.
[0024] In certain embodiments, the following construct can be applied to attach a cell-targeting moiety to the nanoparticle:5'{L} -X-{.3'-3'T} 3', wherein L is a linker, wherein X is an aptamer and wherein 3'-3'T - 3’ is an inverted dT base.
[0025] In certain embodiments, the following construct can be applied to attach a cell-targeting moiety to the nanoparticle:5'{L} -{Spacer}-X-{.3'-3'T} 3', wherein L is a linker, wherein Spacer is a second or additional linker wherein X is an aptamer and wherein 3'-3'T - 3’ is an inverted dT base.
[0026] In certain embodiments, the construct can be5' { SH-L } { Spacer} -X- { .3 '-3 'T } 3 ', wherein SH-L is a thiol with a first linker,wherein Spacer is a second linker, wherein X is an aptamer and wherein 3'-3'T - 3’ is an inverted dT base.
[0027] In certain embodiments, the construct can be 5'{SHC6}{Spl8}-X-{.3'-3'T) 3', wherein SHC6 is a thiol with C6 carbon spacer or other linker, wherein Spl8 is a PEG18 spacer or other linker, wherein X is an aptamer and wherein 3'-3'T - 3’ is an inverted dT base.
[0028] In certain embodiments, each of the first linker and the second linker can be a bivalent linker, for example, each linker may represent a bond or a bivalent substituent group, and wherein X represents an optionally substituted hydrocarbon group, for example a monoacid or diacid lipid, or a salt thereof. In some embodiments, the bivalent substituent group comprises: an alkylene group, optionally interrupted by a double bond, a triple bond, a carbonyl group, an oxycarbonyl group, an imino group, an alkylimino group, a sulfonyl group, an oxy group, a sulfide group, an ester bond, an amide bond, a carbonate bond or combinations thereof. For example, an alkylene linker can be a C2-C18, C2-C8, or C6 straight chain, branched, or cyclic bivalent group.
[0029] In certain embodiments, the Payload mRNA contains sequences that are complementary to miRNA expressed in off target healthy tissues. In certain embodiments, Target miRNA levels in the targeted cell reduces Payload mRNA expression. In certain embodiments, more than one miRNA complementary sequence is used to increase selectivity of the targeted cancer cells.
[0030] In certain embodiments, the miRNA binds to an Argonaute protein to form an RNA- induced silencing complex (RISC).
[0031] In certain embodiments, the miRNA contains a seed sequence that guides the RISC to a complementary sequence on an mRNA strand in the cell.
[0032] In certain embodiments, an Argonaute protein binds the miRNA and positions it in a conformation that facilitates target recognition by binding to a complementary sequence.
[0033] In certain embodiments, the binding results in a full match.
[0034] In certain embodiments, the binding is partial binding.
[0035] In certain embodiments, the binding contains a mismatch.
[0036] In certain embodiments, the partial binding causes repression of the Payload mRNA .
[0037] In certain embodiments, at least 6 consecutive nucleotides match the Complementary miRNA Sequence.
[0038] In certain embodiments, the binding occurs in a non-canonical miRNA binding site.
[0039] In certain embodiments, the binding occurs in a canonical miRNA binding site.
[0040] In certain embodiments, the method further includes selecting an miRNA to ensure that the Target miRNA will bind to a 3’ UTR region of the Payload mRNA.
[0041] In certain embodiments, the method further includes selecting an miRNA to ensure that the Target miRNA will bind to a 5’ UTR region of the Payload mRNA.
[0042] In certain embodiments, the method further includes selecting an miRNA to ensure that the Target miRNA will bind to a centered region, e.g., a coding sequence region of the Payload mRNA.
[0043] In certain embodiments, the method further includes selecting an miRNA to ensure that the Target miRNA will bind to a seed region of the Payload mRNA. In some embodiments, self-amplifying mRNA (sa-mRNA) can be applied. In such embodiments, the sa-mRNA can self-replicate, acting as its own printing press in making copies of a protein of interest.
[0044] In certain embodiments, the expressed or translated Payload mRNA reduces tumorigenesis.
[0045] In certain embodiments, the expressed or translated Payload mRNA reduces angiogenesis.
[0046] In certain embodiments, the expressed or translated Payload mRNA activates an immune response.
[0047] In certain embodiments, expressed or translated Payload mRNA activates an effector cell response.
[0048] In certain embodiments, the expressed or translated Payload mRNA activates a memory cell response.
[0049] In certain embodiments, the expressed or translated Payload mRNA modulates a cytokine response.
[0050] In certain embodiments, the expressed or translated Payload mRNA modulates an interferon response.
[0051] In certain embodiments, the expressed or translated Payload mRNA modulates an interleukin response.
[0052] In certain embodiments, the expressed or translated Payload mRNA binds to a bispecific antibody that binds T-cells to ensure a more precise immune response.
[0053] In some embodiments the Payload mRNA comprises of conventional mRNA. In some embodiments, the Payload mRNA comprises a saRNA. In some embodiments the Payload mRNA comprises a trans-amplifying mRNA (taRNA). In some embodiments the Payload mRNA comprises of circular mRNA (circRNA). In some embodiments, the miRNA binding results in degradation of the Payload mRNA. In some embodiments, the binding results in allowance of the Payload mRNA.
[0054] In some embodiments, the binding results in degradation of the saRNA. In some embodiments, the binding results in the allowance of the saRNA. In some embodiments, the binding results in the degradation of the taRNA. In some embodiments, the binding results in the allowance of the taRNA. In some embodiments, the binding results in the degradation of the circular mRNA. In some embodiments, the binding results in the allowance of the circular mRNA. In some embodiments, the binding results in the degradation of the conventional mRNA. In some embodiments, the binding results in the allowance of the conventional mRNA.
[0055] In some embodiments, the nanoparticle having cell-targeting moiety containing a Payload mRNA associated with a specific cancer can be applied in a multivalent immunotherapy.
[0056] In some embodiments, the Payload mRNA comprises a replicase mRNA and transreplicon mRNA. In some embodiments, the replicase mRNA and transreplicon mRNA are delivered in separate nanoparticles.
[0057] In some embodiments, there can be two LNPs with one comprising a replicase mRNA and the other comprising a transreplicon mRNA. In certain embodiments, the replicase mRNA and transreplicon mRNA appear together in the cell and activate custom protein selfamplification.
[0058] In general, a composition for treating cancer comprising a nanoparticle having celltargeting moiety containing a Payload mRNA associated with a specific cancer, the Payload mRNA contains a Complementary miRNA Sequence(s) to recruit Target miRNA in healthy off target tissues. Binding of the Target miRNA to the Payload mRNA Complementary miRNA Sequence results in either degradation or repression of the Payload mRNA, preventing translation of a Custom Protein Sequence. In certain embodiments, the composition isadministered intraperitoneally. In certain embodiments, the composition is administered intravenously.
[0059] In certain embodiments, the composition is administered intratumorally. In certain embodiments, the composition is administered subcutaneously. In certain embodiments, the composition is administered intramuscularly. In certain embodiments, the composition is administered intradermally.
[0060] In some embodiments, a method for marking cancer-cells including applying a viral particle having a cell-targeting moiety expressing a Payload mRNA associated with a specific cancer, allowing the viral particle to enter a targeted cell and express the Payload mRNA, wherein the Payload mRNA contains a Complementary miRNA Sequence(s), allowing the Payload mRNA to recruit Target miRNA(s) for tissue specific expression, and once binding occurs, degrading and / or repressing the Payload mRNA, and if no binding occurs, allowing the Payload mRNA to be translated to express a custom protein sequence (CPS). In some embodiments, a Payload mRNA can be encoded as DNA, for example, when a viral delivery mechanism is applied.BRIEF DESCRIPTION OF THE DRAWINGS
[0061] FIG. 1 A depicts one embodiment of a nanoparticle used in the novel cancer immunotherapy platform.
[0062] FIG. IB depicts an exemplary targeting moiety linker used in the novel cancer immunotherapy platform.
[0063] FIG. 1C depicts an exemplary targeting moiety linker used in the novel cancer immunotherapy platform.
[0064] FIG. ID shows successful preparation of homogenous aptamer functionalized particles.
[0065] FIG. IE shows successful aptamer conjugation to particles by agarose gel electrophoresis separation of the final purified particles loaded with generic luciferase mRNA.
[0066] FIG. IF depicts a schematic of conventional RNA, self-amplifying RNA (sa-mRNA or saRNA), trans-amplifying RNA (ta-mRNA or taRNA) and circular RNA.
[0067] FIG. 1G shows a schematic of how saRNA and taRNA function in a cell.
[0068] FIG. 1H depicts a flow chart of taRNA conditional logic such that the replicase and CPS transreplicon will be present in the same cell allowing RNA self-amplification to occur, if and only if both conditions are true.
[0069] FIG. 2 depicts an exemplary Payload mRNA of a novel cancer immunotherapy platform (“Payload mRNA”), where a Complementary miRNA Sequence is inserted into the 3’UTR region to bind with the naturally occurring miRNAs (“Target miRNA”) in the cells’ cytoplasm. In this embodiment, it is expected that healthy cells will have the Target miRNA and cancer cells will have low or absence Target miRNA.
[0070] FIG. 3A depicts the first step of an embodiment of the claimed RNA therapy platform where, lipid nanoparticles (LNPs) enter those cells selected as having surface molecules (Marker 1) that bind to the LNP conjugated ligand.
[0071] FIG. 3B shows the second step of an embodiment of the claimed RNA therapy platform wherein, Payload mRNA contained in the LNPs are released.
[0072] FIG. 3C shows that in cancer cells, which do not contain the Target miRNA, the Payload mRNA is not suppressed, and the Custom Protein Sequence (CPS) is translated and expressed as a resulting antigen, uniquely marking the cancer cell or inducing an immune response.
[0073] FIG. 4A depicts an embodiment of the cancer immunotherapy platform in which the naturally occurring miRNA binds to Argonaut and other protein to form an RNA-induced silencing complex (RISC). The seed sequence (e g., nucleotides 2-8) of the native miRNA guides the RISC to the Complementary miRNA Sequence on the Payload mRNA, causing degradation and or repression of the Payload mRNA.
[0074] FIG. 4B depicts an embodiment in which complete miRNA binding leads to mRNA degradation.
[0075] FIG. 4C depicts an embodiment wherein a miRNA mismatch or partial binding can cause mRNA repression.
[0076] FIG. 5A depicts canonical miRNA binding sites, showing a full or partial match of the seed sequence.
[0077] FIG. 5B and 5C show that addition of select Complementary miRNA Sequences to the Payload mRNA will unlikely cause canonical degradation / repression of the Payload mRNA in PAAD by endogenous miRNAs expressed in PAAD.
[0078] FIG. 6 depicts non-canonical miRNA binding sites where only the 3' and / or centered regions can bind to the complementary mRNA region and cause repression.
[0079] FIG. 7A depicts RNA-Seq samples obtained from the UCSC Xena Browser for Marker 1 Identification.
[0080] FIG. 7B shows the TCGA dataset containing RNA-seq data for 33 different cancer Types.
[0081] FIG. 7C shows the GTEX & TCGA dataset containing RNA-seq data for 37 different healthy tissues.
[0082] FIG. 7D shows an example applying the Marker 1 ranking algorithm, in which CEACAM6 was identified as a top ranked Marker 1 for pancreatic adenocarcinoma (PAAD).
[0083] FIG. 7E shows an example in which using the Marker 1 ranking algorithm TM4SF4 was ranked 2ndin PAAD.
[0084] FIG. 7F shows an example in which using the Marker 1 ranking algorithm, MSLN was ranked 4th in PAAD.
[0085] FIG. 7G shows TPM expression for HCC 122 Low EpCAM in various tissue types.
[0086] FIG. 7H shows TPM expression for HCC 122 Low TM4SF4 in various tissue types.
[0087] FIG. 71 shows TPM expression for HCC 122 Low MUC1 in various tissue types.
[0088] FIG. 7J shows TPM expression for ICC 122 Low TM4SF4 in various tissue types.
[0089] FIG. 7K shows TPM expression for ICC 122 Low EpCAM in various tissue types.
[0090] FIG. 7L shows TPM expression for ICC 122 Low MUC1 in various tissue types.
[0091] FIG. 7M shows EpCAM is highly expressed in PAAD compared to healthy tissues.
[0092] FIG. 7N shows MUC1 is highly expressed in PAAD compared to healthy tissues.
[0093] FIG. 70 shows a PDAC reference single cell RNA-seq clusters.
[0094] FIG. 7P shows that EpCAM and MUC 1 are the top-ranked surface proteins that are most consistently expressed in PDAC cells.
[0095] FIG. 7Q shows that EpCAM is often expressed in pancreatic ductal cells.
[0096] FIG. 7R shows that EpCAM is similarly expressed in cancer and ductal cells.
[0097] FIG. 8A shows the top ranked miRNA, hsa-mir-130a-3p, which is expressed across healthy tissues but not in PAAD.
[0098] FIG. 8B depicts a schematic in which only a small number of healthy tissues express the potential PAAD Marker 1 CEACAM6. This suggests that Target miRNA(s) (Marker 2) only need to be identified for a subset of Marker 1 off target healthy tissues.
[0099] FIG. 8C shows hsa-miR-451a is highly expressed in the CEACAM6 off-target healthy salivary gland and lung tissues relative to PAAD. However, has-miR-451a has low expression in the CEACAM6 off target head and neck healthy tissue.
[0100] FIG. 8D and 8E shows that addition of multiple unique Complementary miRNA Sequences to the Payload mRNA will decrease off target translation of the CPS in multiple select healthy tissues simultaneously.
[0101] FIG. 8F shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-122-5p.
[0102] FIG. 8G shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-45 la.
[0103] FIG. 8H shows a box plot of EpCAM off-target tissues for PDAC for hsa-miR-142-5p.
[0104] FIG. 81 shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-126-5p.
[0105] FIG. 8J shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-378a-3p.
[0106] FIG. 8K shows a box plot of MUC1 off-target tissues for PDAC hsa-miR-122-5p.
[0107] FIG. 8L shows a box plot of MUC1 off-target tissues for PDAC hsa-miR-45 la.
[0108] FIG. 8M shows a box plot of MUC 1 off-target tissues for PDAC for hsa-miR-142-5p.
[0109] FIG. 8N shows a box plot of MUC 1 off-target tissues for PDAC hsa-miR-126-5p.
[0110] FIG. 80 shows a box plot of MUC1 off-target tissues for PDAC hsa-miR-378a-3p. FIG. 8P shows an miRNA profile applied to determine if loss of miRNA expressionis associated with tumor progression in PDAC.
[0112] Fig. 8Q shows a box plot of EpCAM off-target tissues for ICC hsa-miR-45 la.
[0113] Fig. 8R shows a box plot of EpCAM off-target tissues for ICC hsa-miR-142-5p.
[0114] Fig. 8S shows a box plot of EpCAM off-target tissues for ICC hsa-miR-126-5p.
[0115] Fig. 8T shows a box plot of EpCAM off-target tissues for ICC hsa-miR-378-3p.
[0116] Fig. 8U shows survival plots indicating that lower expression of miR-451a was associated with a worse survival in CHOL.
[0117] FIG. 9 depicts an embodiment of the claimed cancer immunotherapy platform in which the expressed marker to is a universal cancer antigen (UCA) for all detected tumors.
[0118] FIG. 10 depicts another embodiment of the claimed cancer immunotherapy platform in which the expressed marker is an existing disease antigen (e.g., coronavirus, tetanus, etc.)
[0119] FIG. 11 depicts an embodiment of the claimed cancer immunotherapy platform in which the immunotherapy is a cocktail of LNPs with different Marker 1 and Marker 2 combinations to more fully address tumor heterogeneity.
[0120] FIG. 12A shows synthetic miRNA mediated Payload GFP mRNA degradation in the pancreatic cancer cell line.
[0121] FIG. 12B shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the lung cancer cell line.
[0122] FIG. 12C shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the Ewing sarcoma cell line.
[0123] FIG. 12D shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the breast cancer cell line.
[0124] FIG. 12E shows synthetic Target miRNA degradation of Payload GFP mRNA in PANC-1 cells at a cellular level.
[0125] FIG. 12F shows endogenous Target miRNA degradation of Payload mRNA in HEK293 cells.
[0126] FIG. 13 A shows hsa-miR-10a-5p expression in PANC-1.
[0127] FIG. 13B shows Target miRNA hsa-miR-10a-5p can degrade Payload GFP mRNA in PANC-1 cells.
[0128] FIG. 14A shows an IEDB coverage calculation showing Sars-CoV-2 N protein binds to an MHC class I HLA-allele in approximately 99% of the human population.
[0129] FIG. 14B shows the Sars-CoV-2 N protein domains and suggests that removal of the N-arm or C-tail can reduce protein functionality and increase safety. FIG. 14C shows that a custom script was used to determine that removal of Sars-CoV-2 C-tail had little impact on population coverage and potential immunogenicity. FIG. 14D shows that mRNA encoding a measles N protein or a Sars-CoV-2 protein delivered to cancer cells elicited an immune response in human derived T-cells.
[0130] FIG. 15A shows that select miRNAs had lower expression in HepG2 cells relative to primary hepatocyte cells.
[0131] FIG. 15B shows different miRNA spacer sequences with little to zero variation in the translation of FLuc mRNA.
[0132] FIG. 15C shows unstable Complementary miRNA spacer sequences reduced FLuc translation vs. alpha-globin spacers in miR-378a-3p and miR-451a tests.
[0133] FIG. 15D shows unstable Complementary miRNA spacer sequences yielding the highest Delta FLuc response.DETAILED DESCRIPTION OF THE INVENTION
[0134] Cancer immunotherapies cause the immune system to attack cells with one or more specific antigens. Targeted cancer treatment relies on an effective platform for cancer cell detection. The presence of a cancerous genetic sequence can be detected using positive logic (the presence of certain sequences indicate cancer) or negative logic (the absence of certain sequences indicate cancer). A Target miRNA is the naturally occurring miRNA strand floating in the cytoplasm, it is determined by its absence or downregulation in a specific cancer type vs potential off target healthy tissues. The absence or downregulation of this miRNA can be indicative of cancer. In certain embodiments, conventional mRNA, circular mRNA, selfamplifying RNA (sa-mRNA or saRNA) or trans-amplifying mRNA (ta-mRNA or taRNA) features can be applied with a cancer immunotherapy. These mRNA strategies can include a Complementary miRNA Sequence(s) to facilitate the conditional degradation or allowance of the linear or conventional mRNA, circular mRNA, sa-mRNA, the ta-mRNA replicase or ta-RNA transreplicon. mRNA Immunotherapy
[0135] The concept of mRNA immunotherapies is premised using the body’s own immune system to fight cancer and is premised on the delivery of mRNA to cells for protein expression. Some mRNA immunotherapies are known as mRNA vaccines or as cancer vaccines because they stimulate the immune system to recognize and fight cancer cells. Referring to Fig. 1A, in one novel embodiment, an antibody conjugated lipid nanoparticle (LNP) includes a cell targeting moiety (e.g., an antibody) 101, an LNP 102, and a conditional payload 103 as described in detail herein. In other embodiments, other nanoparticles can be applied. A nanoparticle is a nanoscale particle with at least one dimension measuring, for example, between 1 and 1000 nanometers (nm), 1-500 nm, 1-250 nm, or 1-100 nm. It behaves as a whole unit with regard to its propertiesand transport, and it is unique in the sense that it forms the link between bulk material and materials at the atomic or molecular scale. Nanoparticles can be engineered to carry and deliver therapeutic compositions directly to targeted cells or tissues, improving efficacy and reducing side effects.
[0136] As shown in Fig. IF, mRNA can be divided into four major categories: (i) conventional mRNA, (ii) self-amplifying mRNA (SAM), (iii) trans-amplifying mRNA and (iv) circular mRNA (crrcRNA). Ghattas M, Dwivedi G, Lavertu M, Alameh MG. Vaccine Technologies and Platforms for Infectious Diseases: Current Progress, Challenges, and Opportunities. Vaccines (Basel). 2021 Dec 16;9(12): 1490. doi: 10.3390 / vaccines9121490. PMID: 34960236; PMCID: PMC8708925. Conventional in vitro transcribed (IVT) mRNAs are relatively simple in their architecture and manufactured at high yield using a cell-free template- directed enzymatic synthesis. Linearized plasmid DNAs are typically used as templates for mRNA synthesis, and contain a promoter sequence, 5' and 3' untranslated regions (UTRs), and the gene of interest. The polyadenine tail (Poly A), an important element in mRNA stability and expression can be engineered into the plasmid or enzymatically added after synthesis. The 5' cap structure is either co-transcriptionally (e.g., CleanCap™) or enzymatically (e.g., Vaccinia Capping system) added to improve mRNA stability and protein expression, and reduce immunogenicity (e.g., intracellular RIG-I sensing).Self-Amplifying RNA Immunotherapy
[0137] As shown in Fig. 1C, self-amplifying mRNA (sa-mRNA) represents an advancement of mRNA technology. In essence, it is a special mRNA that can self-replicate, acting as its own printing press in making many copies of the protein of interest. This differs from conventional mRNA, such as the COVID-19 vaccine, in which one mRNA makes only a handful of SARS- CoV-2 spike proteins before its degradation. Self-amplifying mRNAs, also known as replicons, form an improved immunotherapy platform. Replicons induce potent humoral and cellular responses with few adverse effects upon a minimal, single-dose immunization. Comes, lerome D.G. et al., Rise of the RNA machines - self-amplification in mRNA vaccine design, Trends in Biotechnology, Volume 41, Issue 11, 1417 - 1429. Whereas mRNA vaccines encode a protein of interest, replicons have been engineered as a molecular chassis encoding the gene of interest and all essential elements allowing self-amplification of the replicon RNA. The rapid amplification of replicon RNA in target cells increases the expression of the protein of interest and induces aprotective immune response at a markedly lower initial RNA dose than conventional mRNA vaccines.
[0138] Self-amplifying RNA can include hybrids such as VEE-SINV alphavirus chimera based on the VEE and SINV replicons. Self-amplifying RNA can also include replicationdeficient and replication-proficient systems (including, where applicable, alphavirus). Selfamplifying RNA can also include DNA and RNA based expression systems (including, where applicable, alphavirus). In certain embodiments, self-amplifying RNA can also include chemically modified (e.g. N1 -methylpseudouridine) nanoparticle delivery. The entry receptor can function as Marker 1 for self-amplifying RNA particles. The following are exemplary selfamplifying RNA systems:] ] |
[0139] The structure of in vitro transcribed mRNA closely resembles cellular mRNA, and in general consists of a 5'-terminal 7-methylguanosine cap analog; a 5' and 3' untranslated region (UTR); the gene of interest (GO I); and a polyadenosine (poly -A) tail. To optimize the mRNA for vaccination purposes, modifications have been applied to increase the vector stability, translation efficacy, or immunogenicity. Since these nucleic acid vaccines encode solely the GOI, they are unable to replicate in, or spread to, neighboring cells.
[0140] Replicon RNA resembles in vitro transcribed mRNA, but additionally encodes viral replicase genes. These genes allow the rapid amplification of the mRNA and thereby increase the production of the GOI in comparison to non-amplifying mRNAs. The self-amplifying viral genes originated from viruses, for example, alphaviruses and flaviviruses. Alphavirus-based replicons contain a separated open-reading frame (ORF) upstream of the GOI that encodes all the replicase proteins. In contrast, in flavivirus-based replicons these replicase proteins are encoded in a single ORF downstream of the GOI. Since replicon RNA does not encode all alphavirus or flavivirus structural proteins, the RNA is propagation defective. As a result, replicon RNA vaccines are, similar to the non-amplifying mRNA vaccines, categorized as synthetic nucleic acid vaccines. Due to the self-amplifying character of the replicon vaccine, both humoral and cellular immune responses are triggered, which promises induction of protective immunity with a single low-dose immunization.
[0141] Delivery of replicons can be achieved with virus-like replicon particles (VRPs), or in nonviral vehicles such as liposomes or lipid nanoparticles. Multivalent, mucosal, and therapeutic replicon vaccines are all novel applications in replicon design. Besides the VRP system, several alternative nucleic acid delivery methods based on chemical formulations have been developedand optimized over the years; namely, liposomes, liquid lipid nanoparticles (LNPs), and solid lipid nanoparticles (SNPs). These synthetic formulations improve vaccine stability, allow efficient replicon delivery, and rely on manufacturing processes without (mammalian) cell substrates.
[0142] Multivalent vaccines are useful tools to control and prevent the spread of cocirculating or seasonal pathogens as a greater number of protective antigens are presented to the immune system. In the case of multivalent replicon vaccines, a single replicon can encode multiple antigens, or multiple replicons each expressing a different antigen are mixed in one vaccine formulation.Trans-Amplifying mRNA Immunotherapy
[0143] While saRNA-based immunotherapies present numerous advantages, the replicase and antigens are encoded on the same mRNA molecule, which can result in very long RNA sequences, posing significant challenges in production, delivery, and stability. Thus, researchers have introduced trans-amplifying RNA (taRNA) to the immunotherapy field.
[0144] As shown in Fig. 1G, taRNA is a derivative of saRNA that is composed of two RNAs: a non-replicating mRNA (nrRNA) encoding the replicase and a so called transreplicon (TR) encoding the therapeutic transgene that is multiplied by the replicase. By splitting the replication system into two parts: one that encodes replicase and the other that encodes a short antigen-encoding RNA called transreplicon, the platform avoids very long RNA sequences, which would otherwise pose significant challenges in production, delivery, and stability. Yildiz, A.; Raileanu, C.; Beissert, T. Trans-Amplifying RNA: A Journey from Alphavirus Research to Future Vaccines. Viruses 2024, 16, 503. https: / / doi.org / 10.3390 / vl6040503.
[0145] Cancer cell detection starts with finding a “Marker 1” on the cell surface. Marker 1 is a conceptual reference to a naturally occurring surface protein, neoantigen, or other surface molecules that the mRNA delivery vehicle can identify and bind. Once a Marker 1 is detected, the mRNA delivery vehicle can bind and deliver its contained nucleic acid sequence e.g., a Payload mRNA is delivered. The Payload mRNA herein is a custom mRNA inserted into an mRNA delivery vehicle such as an LNP that, once delivered, allows a Custom Protein Sequence (CPS) to be expressed. The Payload mRNA is an engineered mRNA with Complementary miRNA Sequence(s). In some embodiments, the CPS can be a Universal Cancer Antigen (UCA), which is a proprietary antigen, usually non-naturally occurring, that is translated from thePayload mRNA. The Payload mRNA contains a nucleic acid sequence (Complementary miRNA Sequence) coded into the 3’ untranslated region (UTR) that binds to the naturally occurring Target miRNA. This Target miRNA is referred to as Marker 2. The CPS can be an engineered to be translated into a Universal Cancer Antigen (UCA), or a protein that enhances anti-tumor response, or a protein that exerts a cell to undergo apoptosis, (e.g., a spike protein, cytokine, or self-destruct facilitator), a known disease antigen, immune signaling protein, a protein that restores loss functionality to cancer cells (e.g. TP53, SMAD4) or other protein that functions in cell destruction, immune response or activating other immune or cancer fighting mechanisms. The cancer cell is thus detected and marked with enhanced precision, allowing it to be attacked with a modality that corresponds to the CPS.Mutations and Cancer
[0146] Mutations are changes in the genetic sequence, and they are a main cause of diversity among organisms. These changes occur at many different levels, and they can have widely differing consequences. Although various types of molecular changes exist, the word "mutation" typically refers to a change that affects the nucleic acids. In cellular organisms, these nucleic acids are the building blocks of DNA, and in viruses they are the building blocks of either DNA or RNA. The smallest mutations are point mutations, in which only a single base pair is changed into another base pair. Yet another type of mutation is the nonsynonymous mutation, in which an amino acid sequence is changed. Such mutations lead to either the production of a different protein or the premature termination of a protein. As opposed to nonsynonymous mutations, synonymous mutations do not change an amino acid sequence, although they occur, by definition, only in sequences that code for amino acids. Synonymous mutations exist because many amino acids are encoded by multiple codons. Base pairs can also have diverse regulating properties if they are located in introns, intergenic regions, or even within the coding sequence of genes. For some historic reasons, all of these groups are often subsumed with synonymous mutations under the label "silent" mutations. Depending on their function, such silent mutations can be anything from truly silent to extraordinarily important, the latter implying that working sequences are kept constant by purifying selection. Loewe, L. (2008) Genetic mutation. Nature Education 1(1): 113.
[0147] Some genes control cell division. When mutations occur in these genes, a cell may begin to divide without control. Cells that divide when they are not supposed to eventually leadto cancer. All cancer is the result of gene mutations. Mutations may be caused by aging, exposure to chemicals, radiation, hormones or other factors in the body and the environment. Over time, a number of mutations may occur in a single cell, allowing it to divide and grow in a way that becomes a cancer. This usually takes many years and explains why most cancers occur at a later age in life. Sometimes mutations in important genes cause a cell to no longer understand instructions. In such cases, the cell can start to multiply out of control, does not repair itself properly, and does not die when it should. This can lead to cancer.
[0148] Mutations may also take the form of insertions or deletions, which are together known as indels. Indels can have a wide variety of lengths. At the short end of the spectrum, indels of one or two base pairs within coding sequences have the greatest effect, because they will inevitably cause a frameshift (only the addition of one or more three-base-pair codons will keep a protein approximately intact). At the intermediate level, indels can affect parts of a gene or whole groups of genes. At the largest level, whole chromosomes or even whole copies of the genome can be affected by insertions or deletions, although such mutations are usually no longer subsumed under the label indel. At this high level, it is also possible to invert or translocate entire sections of a chromosome, and chromosomes can even fuse or break apart. If a large number of genes are lost as a result of one of these processes, then the consequences are usually very harmful. However, different genetic systems react differently to such events. Finally, still other sources of mutations are the many different types of transposable elements, which are small entities of DNA that possess a mechanism that permits them to move around within the genome. Some of these elements copy and paste themselves into new locations, while others use a cut-and-paste method. Such movements can disrupt existing gene functions (by insertion in the middle of another gene), activate dormant gene functions (by perfect excision from a gene that was switched off by an earlier insertion), or occasionally lead to the production of new genes (by pasting material from different genes together).
[0149] Cancers can be categorized into two groups: those whose frequency increases with age, and those resulting from errors during mammalian development. The first group is linked to DNA replication through the accumulation of genetic mutations that occur during proliferation of developmentally acquired stem cells that give rise to and maintain tissues and organs. These mutations, which result from DNA replication errors as well as environmental insults, fall into two categories; cancer driver mutations that initiate carcinogenesis and genome destabilizingmutations that promote aneuploidy through excess genome duplication and chromatid missegregation. Increased genome instability results in accelerated clonal evolution leading to the appearance of more aggressive clones with increased drug resistance. The second group of cancers, termed germ cell neoplasia, results from the mislocation of pluripotent stem cells during early development. During normal development, pluripotent stem cells that originate in early embryos give rise to all of the cell lineages in the embryo and adult, but when they mislocate to ectopic sites, they produce tumors. Remarkably, pluripotent stem cells, like many cancer cells, depend on the Geminin protein to prevent excess DNA replication from triggering DNA damage-dependent apoptosis. This link between the control of DNA replication during early development and germ cell neoplasia reveals Geminin as a potential chemotherapeutic target in the eradication of cancer progenitor cells.
[0150] There are 4 main types of genes involved in cell division: oncogenes, tumor suppressor genes, DNA repair genes, and self-destruction genes. See, e.g., cancerresearchuk.org / about-cancer / what-is-cancer / genes-dna-and-cancer. Most tumors have faulty copies of more than 1 of these types. If we can reliably detect these faulty genes, then we can then target the tumor with an immunotherapy treatment.
[0151] Because cancer, in essence, escapes the body’s normal immune surveillance process, a novel method of cancer treatment can be premised on allowing the cancer to look or act more suspicious to the immune system, and helping the immune system to “learn” how to identify the cancer. Certain cancer cells have specific antigens or neoantigens on the cell surface. These can be antigens that the immune system recognizes for targeting or killing these cells. Antigens are substances, usually proteins or polysaccharides found on the outside of cells or viruses, that induce an immune response. Neoantigens are antigens that are coded by tumor-specific mutated genes. While tumor-associated antigens may be found at low levels in healthy cells, neoantigens are unique to the cancer cells, so targeting neoantigens for immunotherapy comes with a lower risk of inadvertently harming healthy cells. For certain cancer patients both have an overproduction of cytokines, which makes the immune system more vulnerable. There are other relationships between antigens (e.g., with coronavirus and Ewing sarcoma specifically) that can be used to customize a novel immunotherapy. Specifically, one can isolate certain cells from a sarcoma patient, expose those cells to different protein conjugates for future treatment. Similarly, knowing that Ewing tumors are usually driven by a well-known hallmark of gene fusioninvolving the Ewing Sarcoma Breakpoint Region 1 (EWSR1) gene, one can control fusion gene expression to result in the production of a specific protein as a Universal Cancer Antigen, and use this as a hallmark that can be targeted by antibodies designed to attack this protein.
[0152] Vaccines generally fall into four different types: whole-pathogen vaccines, subunit vaccines, and nucleic acid vaccines. Nucleic acid vaccines are the most recent innovation; they include plasmid DNA vaccines and mRNA vaccines. Each approach uses genetic material that encodes one or more antigenic proteins. Upon vaccination, the genetic payload enters the cytosol, or liquid matrix, of human cells, where the cellular machinery uses the genetic material to produce antigens that elicit an immune response. A payload refers to an amount of antigen (e.g. genetic material, protein or lipid) that elicits an immune response. See, e.g. Lowe, D., RNA Vaccines And Their Lipids, www.science.org / content / blo -post / rna-vaccines-and-their-lipids (Jan. 2021). As immunotherapy platforms, nucleic acid technologies have a number of distinct advantages over older approaches. First, they are fast and easy to manufacture. Second, the encoded immunogenic proteins do not remain in the human body for very long. Third, the immune system amplifies the genetic material in response even to small amounts of the expressed antigenic protein. A payload that contains an information-coding molecule, such as RNA, is revolutionary because what the immune system responds to is not the information coding molecule (e.g., RNA), but something the information coding molecule teaches the subject cells to make.
[0153] The amount of target gene modulation may be measured by any suitable method known in the art. In some embodiments, the “effective amount” or “therapeutically effective amount” is the amount of a composition that is required to ameliorate the symptoms of a disease relative to an untreated patient. In some embodiments, an effective amount is the amount of a composition sufficient to introduce an alteration in a gene of interest in a cell (e.g., a cell in vitro , ex vivo or in vivo).Targeting Problem
[0154] Faulty genes result in in various kinds of cancer related cellular abnormalities. The abnormalities can be DNA inside the nucleus, or RNA in the nucleus or cytoplasm. These abnormalities, if detected, can be used to target cancer cells and deliver immunotherapeutic strategies. Many cancer therapies today, such as monoclonal antibodies, bispecific antibodies, CAR-T cells, etc., only target surface molecules that are found on cancer cells. The problem withtargeting these surface molecules is that they also appear in healthy cells, resulting in toxicity and off target killing of healthy cells. When referring to RNA sequences herein, it is understood that U is equivalent to T.Novel Solution: Precision mRNA Delivery with Enhanced Specificity
[0155] A novel solution is a form of precision mRNA delivery that enhances cancer cell specificity. It targets the surface molecules first (Marker 1), then a conditional payload is delivered inside the cell, which is condition on the presence or absence of endogenous Target miRNAs (Marker 2). In short, it is a two step, precision cancer cell targeting solution:
[0156] Step 1 : If surface molecules is found (Marker 1) then LNP or other mRNA delivery vehicle containing a therapeutic payload enters the cell. The payload can be a custom payload that is designed for specific target cells.
[0157] Step 2: If the Target miRNA (Marker 2) is absent within the cell then the Payload mRNA will be translated into the desired protein. Since this payload may or may not result in an expressed protein, this payload is also referred to as a “conditional payload.”
[0158] The specific RNA abnormality that this novel approach exploits is the absence of certain cytoplasmic microRNA (miRNA) in cancer cells. The inventors have validated through computational bioinformatics that individual miRNAs are specific to select tissues and are often downregulated within cancer types relative to neighboring healthy cells. Generally, miRNAs are endogenous nucleic acids that are involved in post-transcriptional regulation. When expressed in the cell, Target miRNAs bind to complementary sequences on mRNAs, leading to the mRNA’s repression and / or degradation. However, when Target miRNAs are not expressed in cells, mRNAs with Complementary miRNA Sequences will be allowed to be transcribed and expressed. This conditional mRNA expression, based on the absence of Target miRNAs, allows the expression of a custom protein that enables targeting with various cancer cell-killing strategies. For example, a unique surface protein, translated from the delivered Payload mRNA, can be expressed so that a highly targeted antibody can bind to it, and not any other cells, for targeted immunotherapy. In certain embodiments, the Payload mRNA can be engineered to express a known disease antigen such as a coronavirus spike protein. In some embodiments, the Payload mRNA can also be engineered to express immune signaling proteins or other proteins that activate cell destruction or immune response, or a combination of these. In another embodiment, the Payload mRNA can be a protein that forces the cell to undergo cell death. Or itcan be a protein that restores a function the cancer cell has lost, such as restoration of normal TP53 expression or fixing the function of the MHC I protein so that antigens can be presented on the cell.Active Targeting
[0159] With active targeting, as shown in Fig. 1A, a nanoparticle (e.g., LNP) 102 conjugated with a cell targeting moiety 101 (e.g., a ligand) (Markerl ) will actively target cells with a matching surface protein and deliver the therapeutic Payload mRNA 103. The Custom Protein Sequence, in the Payload mRNA is express if and only if the cell is cancerous, defined as having low or absence of the Target miRNAs (Marker2) encoded in the 3’UTR region of Payload mRNA.
[0160] In certain embodiments, the cell targeting moiety 101 (Marker 1) conjugated to the nanoparticle 102 is a native viral entry receptor or retargeted viral vector - used to target the tumor via tumor surface proteins. Marker 2 is encoded in the viral expression payload 103, miRNA sites as per a standard mRNA or self-amplifying RNA or RNA replicon. Examples of Viral delivery vectors for marker 1 targeting of tumors can include adenoviruses (Ad) replication-competent or replication-defective, adeno-associated viral (AAV) vectors multiple AAV serotypes and capsid variants, vesicular stomatitis virus - VSV, lentiviral vectors - including IDLV, poxviruses including vaccinia virus (VV) and variola virus modified vaccinia ankara (MV A), New York Vaccina Virus (NYVAC) etc, fowl pox, newcastle disease virus, heterologous viral vectors and herpes virus. In certain embodiments, a cell-targeting moiety can be an aptamer, and linkers can be designed for aptamer conjugation as shown in Fig. IB. In certain embodiments, as shown in Fig. 1C, capped oligo aptamers as well as free thiol can be applied as well.
[0161] The following are examples of peptide and small molecules that may be used for Marker 1 :Table 1: Peptide and Small Molecules as Marker 1The following are examples of viral entry receptors that may be used as Marker 1. Table 2: Native Viral Entry Receptors
[0162] While these cell targeting moieties are exemplary, any appropriate cell targeting moieties may also be applied.Antibodies and Aptamers
[0163] Antibodies and aptamers are selective affinity reagents that can be used in a wide range of research, diagnostic, and therapeutic applications.
[0164] Antibodies, also known as immunoglobulins, are Y-shaped proteins naturally produced by the immune system to identify and neutralize foreign objects like bacteria and viruses. They are Y-shaped proteins produced by the immune system of living organisms. Therapeutic antibodies are designed to mimic the body's natural antibody response but are engineered to target specific molecules associated with diseases. They can work by neutralization or blocking the activity of a disease-causing molecule, by immune activation (triggering the immune system to attack cells expressing a targeted antigen, e.g., cancer cells), delivery of therapeutics, and modulating signaling pathways.
[0165] Aptamers are small molecules composed of DNA or RNA that are engineered in the laboratory to bind highly specifically to a given target, whether proteins, viruses, bacteria, eukaryotic cells, drugs or other chemical compounds. Aptamers are short, single-stranded nucleic acids (DNA or RNA) synthesized in vitro that bind to specific target molecules with high affinity and specificity, similar to antibodies. They are designed to modulate the function of these target molecules, making them valuable for targeted therapies in various diseases.
[0166] Aptamers are single-stranded nucleic acid molecules that bind to and inhibit proteins and are commonly produced by systematic evolution of ligands by exponential enrichment (SELEX). Aptamers undergo extensive pharmacological revision, which alters affinity, specificity, and therapeutic half-life, tailoring each drug for a specific clinical need.
[0167] Aptamers are approximately one tenth the size of an antibody. A typical IgG antibody is -150 - 170 kDa. A typical aptamer is -12 - 30 kDa for a 30 to 80 nucleotide aptamer.
[0168] Aptamers are intrinsically non-immunogenic and are effective to access tissues and cells. Aptamers and aptamer-drug complexes have successfully crossed the blood-brain barrier to deliver effective treatment. Because they are synthesized in vitro, they allows for precise control over sequence and modifications. They are also generally more stable than antibodies, with longer shelf lives and resistance to denaturation. They can be produced in large quantities relatively quickly and inexpensively. Aptamers can be easily modified with various labels or functional groups.Linkers
[0169] In nanoparticle conjugation, linkers are molecules that connect nanoparticles to other molecules, such as biomolecules or drugs. They serve as a bridge, enabling the attachment of the desired molecule to the nanoparticle's surface, facilitating targeted delivery and controlled release. Linkers can be cleavable or non-cleavable, and their properties are carefully chosen to optimize the function of the conjugated molecule. An exemplary linker is SHC6, a thiol with C6 carbon spacer or other linker.
[0170] In certain embodiments, each of the first linker and the second linker can be a bivalent linker, for example, each linker may represent a bond or a bivalent substituent group, and wherein X represents an optionally substituted hydrocarbon group, for example a monoacid or diacid lipid, or a salt thereof. In some embodiments, the bivalent substituent group comprises: an alkylene group, optionally interrupted by a double bond, a triple bond, a carbonyl group, an oxycarbonyl group, an imino group, an alkylimino group, a sulfonyl group, an oxy group, a sulfide group, an ester bond, an amide bond, a carbonate bond or combinations thereof. For example, an alkylene linker can be a C2-C18, C2-C8, or C6 straight chain, branched, or cyclic bivalent group.Spacers
[0171] In nanoparticle conjugation, spacers are molecules or sequences that create physical separation between the nanoparticle and a conjugated biomolecule or drug. They can also function as an additional linker, connecting an aptamer to a linker. Spacers optimize the interaction between the nanoparticle and the target by preventing steric hindrance and controlling the distance between the nanoparticle surface and the conjugated molecule. This can enhance the stability, activity, and binding affinity of the conjugate.
[0172] A PEG 18 spacer, also known as Spacer 18 or ETEG linker, is a polyethylene glycol (PEG) based spacer with 18 atoms in length (12 carbons and 6 oxygens). It is commonly used in oligonucleotide modifications and other applications to add a defined length of spacing between molecules. PEG 18 is frequently used to modify oligonucleotides (short DNA or RNA sequences) at the 5' end, 3' end, or internally. This can be done to optimize coupling reactions, block polymerase activity, or conjugate the oligonucleotide to other molecules like enzymes or antibodies.
[0173] Inverted dT Base
[0174] An inverted dT base, also known as a 3'-3' inverted dT, is a modified thymine base that is incorporated at the 3' end of an oligonucleotide. This modification creates a 3 '-3' linkage instead of the standard 3'-5' linkage, which has several important effects.
[0175] In a typical DNA or RNA oligonucleotide, the nucleotides are linked together in a 3'- 5' direction, meaning the 3' carbon of one nucleotide is connected to the 5' carbon of the next nucleotide. When an inverted dT is added, it is attached in a 3'-3' orientation, effectively reversing the direction of the linkage at the very end of the oligonucleotide. The consequences of these changes are exonuclease resistance and polymerase inhibition. With respect to exonuclease resistance, the 3' exonucleases are enzymes that degrade DNA or RNA from the 3' end. The 3'-3 ' linkage created by inverted dT blocks these enzymes from attaching and breaking down the oligonucleotide. With respect to polymerase inhibition, DNA polymerases, which synthesize new DNA strands, typically add nucleotides to the 3' end of an existing strand. The 3'-3' linkage prevents the polymerase from attaching and extending the oligonucleotide sequence. Inverted dT is a useful modification for protecting the oligonucleotide from degradation, making it more stable in biological assays or experiments. In PCR or other primer extension-based assays, inverted dT can be used to prevent unwanted extension of the oligonucleotide. Inverted dT can be incorporated into probes used in hybridization as a sequence from the 3' endPassive Targeting
[0176] In certain embodiments, LNPs are known to accumulate primarily in certain tissues when injected intravenously, for example, the liver, spleen, lung, and kidney. Certain LNP formations can be used to target these tissues through natural accumulation. Therefore, as shown in Fig. 1A, one embodiment of this invention is simply the Payload mRNA 103 encapsulated in a nanoparticle (e.g., LNP) 102 in which the surface of the nanoparticle (e g., LNP) 102 acts as acell targeting moiety 101. Once the LNP accumulates in the target tissue, such as the liver, the Payload mRNA 103 is released into the cell. If the cell is cancerous, it will have low expression or absence of the Target miRNAs, which will allow the expression of the Custom Protein Sequence, such as a viral (e.g., measles) antigen, polyepitope or other UCAs. The encoded Complementary miRNA Sequences will distinguish between cancer and healthy cells in the different passively targeted tissues.Positive and Negative Logic
[0177] Cancer immunotherapies cause the immune system to attack cells with one or more specific antigens. Because the immune system has special cells for memory, the immunotherapy platform is designed and expected to work long after it is given. The inventors have discovered a platform that detects and marks cancer cells using miRNA as a key detection mechanism with enhanced precision. The use of positive logic (confirming the presence) or negative logic (confirming the absence) of certain nucleic acid sequences, e.g. miRNA, can signify a cancer cell. While there are several ways in which cancer cell detection can be accomplished, there are two critical steps in this process, namely Marker 1 (step 1) and Marker 2 (step 2). In these methods, a detector with a specific nucleic acid payload can lead to the expression of a Custom Protein Sequence (CPS). This CPS can be a Universal Cancer Antigen (UCA), a known disease antigen (e.g. coronavirus related protein), an immune signaling protein, or other proteins that play a role in cell destruction, immune response, or activating other steps in synthetic or natural mechanisms. This platform can then proceed with the appropriate detection, marking, and killing of cancer cells.Conditional Payload
[0178] In this novel platform, a Payload mRNA contains sequences that are complementary to a miRNA. These Complementary miRNA Sequences correspond to miRNAs found in potential off-target tissues and are used to regulate expression of the resulting protein with enhanced precision. The Payload mRNA can be delivered via lipid nanoparticles (LNPs) or other mRNA delivery vehicle. For each cancer or group of cancers, the novel platform designs and delivers a full strand Payload mRNA with Complementary miRNA Sequence(s), to allow translation in cancer cells but to limit / prevent translation in potential off-target tissues. In cells without the Target miRNA (e.g., cancer cells), no binding occurs and the Custom Protein Sequence (“CPS”) of the Payload mRNA will be transcribed and expressed.
[0179] This can be achieved by incorporating a Complementary miRNA Sequences in the 3’ UTR, , 5’ UTR or coding sequence of the Payload mRNA. When an mRNA delivery vehicle (such as a lipid nanoparticle or LNP) binds to the corresponding Marker 1 surface molecule expressed on any cell, the payload will be released, and naturally occurring Target miRNA found in the healthy cell will degrade the Payload mRNA. However, when a LNP binds to the corresponding surface molecule on a cancer cell, the lack of expression of the Target miRNA will allow translation of the Payload mRNA, and expression of a Custom Protein Sequence (CPS). This protein marks the cancer cell and allows it to be detected with enhanced specificity.
[0180] Referring to Fig. 2, this depicts an exemplary Payload mRNA of a novel cancer immunotherapy platform (“Payload mRNA”). A Complementary miRNA Sequence is inserted into the 3 ’UTR to bind with the naturally occurring miRNA(s) (“Target miRNA”) in the cells’ cytoplasm. In this embodiment, it is expected that healthy cells will have the Target miRNA and cancer cells do not. In general, a payload is generally an encapsulated biological molecule such as nucleic acids or proteins for therapeutic treatment, e.g. a therapeutic payload. The CPS and Complementary miRNA Sequences 201 are customized depending on the cancer target and / or Marker 1 surface molecules. Since the customized payload is suppressed in cells with matching Target miRNA (Marker 2), but not in cancer cells without Target miRNA, its expression is conditional, and thus it is also referred to as a “conditional payload.”
[0181] In an exemplary embodiment, a custom payload includes a 5’ cap, a 5’ UTR (untranslated region), a coding sequence flanked by the 5 ’UTR and a 3 ’UTR, a Complementary miRNA Sequence 201 in the 3’ UTR and a polyA tail. The payload can also include therapeutic nucleic acids in the form of RNA or DNA, and an enzyme such as a nuclease and / or related hybrid enzymes including a base editor and prime editor. In certain embodiments, miRNA and or siRNA can be included in the LNP with the Payload mRNA and cancer therapeutics such as chemotherapies or small molecules. The endogenous miRNA guides the RISC complex to a matching complementary sequence within the Payload mRNA in the off-target cells. Generally, complete binding can lead to mRNA degradation, partial binding can lead to mRNA repression, and no binding can lead to expression of the mRNA as a Custom Protein Sequence (CPS).
[0182] In this platform some examples of a CPS include:
[0183] A Universal Cancer Antigen (UCA) - Cancer cells can be targeted to express a non- naturally occurring protein that is only expressed by this invention. A custom antibody can bedeveloped to specifically target this UCA on cancer cells. This way no healthy cells are targeted for cell destruction.
[0184] A Known Disease Antigen - Cancer cells can be targeted to express proteins that look like known diseases so that the body already knows how to produce appropriate antibodies to kill these cells as if they were regular diseases without requiring any further treatment or drugs. For example, the coronavirus spike protein, tetanus antigens, influenza antigens, chickenpox antigens, etc. By making cancer cells express antigens associated with known diseases, the body can be conditioned or tricked into thinking that the cancer cells are known diseases (such as COVID, tetanus) and will kill them as a matter of existing immunity without any further action.
[0185] Immune Signaling Proteins - Cancer cells can be marked to express immune signaling proteins such as cytokines. These will attract a natural immune response to the cancer cells.
[0186] Other proteins - In other embodiments, the CPS translates into proteins that play a role in cell destruction, immune response, or activating other steps in synthetic or natural mechanisms. In addition, the CPS can be a sequence for a protein that lost its functionality due to mutations or selective gene silencing. Some examples are but not limited to restoring TP53 expression in cancer cells that have mutations in the TP53 gene. Or restoring functionality to the MHC I complex, which is critical for the expression of antigens on the cell surface.Two-Step Precision Method
[0187] The two-step, precision cancer cell targeting solution is detailed below.Step 1 / Marker 1
[0188] Referring to Fig. 3A, a lipid nanoparticle (LNP) or other mRNA delivery vehicle 302 can be engineered with an exterior antibody 301 associated with a particular known cell surface molecule (e.g., antigen), referred to as Marker 1, which directs it to certain target cells. This type of antibody-based cell targeting is similar to technology use in antibody-drug conjugates (ADCs). An antibody is a protein containing an immunoglobulin domain with the hypervariable regions defining the specificity to bind the antigen, also called complementarity determining regions (CDRs). Antibody can refer to intact antibodies as well as constructs comprising only the antigen binding portion. These can be called F(ab), F(ab)z, minibodies, or single-chain Fv (scFv). They can be combined to produce bi- and multi-specific reagents. See, e g., U.S. Pat. No.11,326,182, Table 9 or 10; dev.dmigbank.com / guidesAdrugbank / citing
[0189] An ideal Marker 1 is selected based on the ability to strongly separate cancer cells from healthy cells, have a low expression across healthy cells, and is highly expressed in cancer cells. In other embodiments, instead of exterior antibodies 301, other targeting moieties s (e.g., oligonucleotides) can be conjugated to the LNP (or other mRNA delivery vehicle) for cell surface molecule targeting. In certain embodiments, instead of LNPs, viral vectors or other similar drug delivery mechanisms can be employed. Any appropriate chemistry can be used to conjugate the marker 1 binding moiety to the PEG-lipid, including maleimide, amine and click chemistry. See, e.g., Odeh F, Nsairat H, Alshaer W, Ismail MA, Esawi E, Qaqish B, Bawab AA, Ismail SI. In certain embodiments, a cell-targeting moiety can be an aptamer. Aptamers Chemistry: Chemical Modifications and Conjugation Strategies. Molecules. 2020; 25(1):3, doi.org / 10.3390 / molecules25010003. See also Fu Z et al, International Journal of Molecular Sciences. 2020; 21(23):9123, doi.org / 10.3390 / ijms21239123; Menon, Ipshita, et al. Materials Today Advances 16 (2022): 100299; Dilliard, S.A., Siegwart, D.J. Passive, active and endogenous organ-targeted lipid and polymer nanoparticles for delivery of genetic drugs. Art / Rev Mater 8, 282 -300 (2023). For conjugation reactions nanoparticle functionalization reagents can include lipid-PEG-maleimide, lipid-PEG-cysteine, lipid-PEG- N-Hydroxysuccinimide (NHS) ester, lipid-PEG-Carboxylic, Acid lipid-PEG-alkyne, PEG-dibenzocyclooctyne (DBCO), and lipid-PEG-azide. The binding moiety can be functionalized with an appropriate group to participate in the conjugation reaction with the functionalized lipid-PEG species. In some examples a thiol, amine or azide group is incorporated into the binding moiety. Other well established bioconjugation chemistry methods potentially useful are extensively described in Hermanson GT. Bioconjugate Techniques. Academic Press; 2013 Jul 25.
[0190] For example, a conjugate can be formed by thiol conjugation chemistry, such as a reaction between a thiol and one or more of a carboxylic acid, ester, aldehyde, aldehyde hydrate, acetal, hydroxy, protected hydroxy, carbonate, alkenyl, acrylate, methacrylate, acrylamide, substituted or un substituted thiol, halogen, substituted or unsubstituted amine, protected amine, hydrazide, protected hydrazide, succinimidyl, isocyanate, isothiocyanate, dithiopyridine, vinylpyridine, iodoacetamide, epoxide, hydroxysuccinimidyl, azole, maleimide, sulfone, allyl, vinylsulfone, tresyl, sulfo-N-succinimidyl, dione, mesyl, tosyl, or glyoxal. Specific examples can include N-succinimidyl carbonate, amine, hydrazide, succinimidyl propionate, succinimidyl butanoate, succinimidyl succinate, succinimidyl ester, benzotriazole carbonate, glycidyl ether,oxycarbonylimidazole, p-nitrophenyl carbonate, aldehyde, maleimide, orthopyridyl -di sulfide, or vinylsulfone.
[0191] Referring to Fig. 3A, in lipid nanoparticles (LNPs) 302 enter those cells selected as having surface molecule (Marker 1) 303 that match the LNP antibody 301. These surface molecule may be found in both healthy cells 304 and cancer cells 305.
[0192] Once Marker 1 candidates are identified (304, 305), the next step is to optimize the specificity of the Payload mRNA using Complementary miRNA Sequences.Step 2 / Marker 2
[0193] Once the mRNA delivery vehicle enters the cell, the Payload mRNA is released through endosomal escape into the cytoplasm. If the Target miRNA exists (“Marker 2”), as is the case with healthy cells, then the Payload mRNA is degraded or suppressed, hence it is referred to as a “conditional payload.” If the Target miRNA does not exist, as is the case with cancer cells, the cancer cell is considered “detected.” The inventors have discovered optimal combinations of Marker 1 and Marker 2. These combinations can be identified via any suitable method such as computer-based algorithms or using Al or machine learning for various cancer or cancer groups. If the Target miRNA is missing, then the Custom Protein Sequence (CPS) of the Payload mRNA will be translated, and this cancer cell is considered “marked.”
[0194] Referring to Fig. 3B, after the LNPs enter the target cells identified with Marker 1, the mRNA contained in the LNPs are released. In this embodiment, the Payload mRNA can be released in a healthy cell or a cancer cell. The Payload mRNA 307 is degraded / suppressed in cells with the Target miRNA (Marker 2) 306, but not in cancer cells that do not have the Target miRNA. Where there is no Target miRNA, the unbound Payload mRNA 308 undergoes translation and expresses the desired protein. Since this Payload mRNA may be suppressed, this custom payload is referred to as a conditional payload, the custom payload (conditional payload), tissue specificity is optimized using Complementary miRNA Sequences : the transfected cells not expressing the Target miRNA(s) will fail to degrade / repress the conditional payload, allowing expression of a tag used to mark a cancer cell.
[0195] Referring to Fig. 3C, cancer cells, do not contain the Target miRNA (Marker 2). Thus, the conditional payload does not undergo degradation / repression, due to the lack of binding of a Target miRNA to the Complementary miRNA Sequence. As a result, the mRNA is translated and expressed as a custom protein sequence (CPS) and resulting antigen 309, uniquelymarking the cancer cell or inducing an immune response. This two-step targeting system provides enhanced specificity because only transfected cells that do not express the Target miRNA will activate the Payload mRNA to express the tag. In cancer cells, the Payload mRNA is not suppressed and the Custom Protein Sequence is translated into the intended protein, uniquely marking the cancer cell or inducing an immune response.
[0196] Since the payload is degraded / suppressed in cells expressing the Target miRNA (Marker 2), but not in cancer cells that do not have the Target miRNA, tissue specificity is optimized using Complementary miRNA Sequences: the transfected cells not expressing the Target miRNAs will activate the Payload mRNA to express a tag used to mark a cancer cell.
[0197] Using negative logic, the Payload mRNA is selectively translated and expressed in cancer cells but is degraded / suppressed in healthy cells. Thus, if the Target miRNA is found inside the cytoplasm, then the payload is degraded / suppressed. The Payload mRNA will only be degraded in cells that express the miRNA that binds to the Complementary miRNA Sequences within the Payload mRNA.Immunotherapy with saRNA and taRNA
[0198] In some embodiments, given any variation of the novel platform, viral replicase proteins can allow the printing of protein, such as a CPS, to function in a targeted manner. Within the delivered RNA, there is the genetic code to produce proteins that can transcribe RNA within the cytoplasm. However, these viral replicase proteins can only bind to RNA that has a specific promoter region. This mechanism is the same way RNA viruses replicate and spread. In terms of the translation of replicase proteins, the RNA is designed to utilize the ribosomes that already exist in the cell. This is the same for the “printed copies” that are created by the saRNA and how the desired protein is expressed. The regulation of saRNA can be an area of concern because if it enters a cell that it is not intended to enter, then it can over amplify the protein of interest.
[0199] As shown in Fig. 1G, a novel method of regulating saRNA introduces Complementary miRNA Sequences into the 3’ UTR, similar to what was described with linear or conventional mRNA. The same method can be applied with taRNA and with two strands: one strand contains the replicase portion while the other strand contains the replicon portion. Because there are two components in ta-mRNA, both strands are needed to be present for the printing press effect to take place. This provides a further safeguard against overamplification. In thisnovel method, further control of taRNA can be provided by adding distinct Complementary miRNA Sequences within the 3’ UTRs of the replicase and replicon portions. This in essence utilizes endogenous Target miRNA as a conditional activator of the saRNA or taRNAs.
[0200] Any suitable number of Complementary miRNA Sequences can be applied to a Payload mRNA. However, the need to increase the number of nucleotide sequences in the Payload mRNAmust be balanced against the risk of non-specific binding. Due to the promiscuity of miRNA, increasing the Complementary miRNA Sequences can introduce other locations for non-target miRNA to bind. This phenomenon can potentially dilute the signal that is intended in the cells without the Target miRNA (e.g., the cancer cells).Immunotherapy with Circular RNA
[0201] In certain embodiments, an mRNA immunotherapy can use circular RNA (circRNA). Circular RNA (c / rcRNA) is a class of non-coding single-stranded RNAs generated through a non-canonical splicing event known as back-splicing in eukaryotic cells. Ghattas M, Dwivedi G, Lavertu M, Alameh MG. Vaccine Technologies and Platforms for Infectious Diseases: Current Progress, Challenges, and Opportunities. Vaccines (Basel). 2021 Dec 16;9(12): 1490. doi: 10.3390 / vaccines9121490. PMID: 34960236; PMCID: PMC8708925. Circular RNA is more stable and has more efficient translation. However typically, there is no 3’ UTR in circular RNAs. Circular RNA engineered to enable protein expression through the addition of internal ribosomal entry sites (IRES) (e g., encephalomyocarditis virus IRES) and / or the incorporation of specific nucleoside modifications in the 5' UTR. While circRNAs have been engineered to enable protein expression through the addition of internal ribosomal entry sites (IRES) and / or the incorporation of specific nucleoside modifications in the 5' UTR or coding sequence, this novel platform has been shown to generate potent and stable translation in eukaryotic cells because of extended transcript half-life (e.g., decreased nuclease resistance). Recent studies have suggested that circRNA can evade intracellular immune sensors such as RIG-I without nucleoside modifications. Qu et al. showed that circRNA generates potent antigen-specific CD4+and CD8+cellular and humoral immune responses in mice against SARS-CoV-2 and its emerging variants, therefore, providing proof of concept for vaccine applications. Qu S., Yang X., Li X., Wang J., Gao Y., Shang R., Sun W., Dou K., Li H. Circular RNA: A new star of noncoding RNAs. Cancer Lett. 2015;365: 141-148. doi: 10.1016 / j.canlet.2015.06.003.
[0202] In some embodiments, given any variation of the novel platform, viral replicase proteins can allow the printing of protein, such as a CPS, to function in a targeted manner for circular RNA. A novel method of regulating circular RNA introduces Complementary miRNA Sequences into the incorporation of specific nucleoside modifications in the 5' UTR. In some embodiments the Complementary miRNA Sequence can be added to the 5’ UTR and coding sequence for other mRNA types as well. The same logic can be applied in terms of requiring both the replicase mRNA strand and the transreplicon mRNA strand to be present within the cell to express the protein of interest.Binding of miRNA
[0203] Referring to Fig. 4A, Argonaute proteins bind the miRNA sequence and position it in a conformation that facilitates target recognition by binding to a complementary sequence. The binding of miRNA to Argonaut proteins creates the RNA-induced silencing complex or RISC. Referring to Fig. 4B, the Argonaute protein (e.g., AG02) can cleave the target RNA when there is full complementary binding. Referring to Fig. 4C, a partial binding, such as a central mismatch of the miRNA in the RISC complex can cause repression of the complementary mRNA. As shown in Fig. 4A for example, the miRNA can contain a seed region (e.g., 6-8 nucleotides), a central region(e.g., 4-6 nucleotides), and a 3 ’compensatory region (8-12 nucleotides)
[0204] In certain embodiments, a negative logic can be used in which the Target miRNA is transcribed and expressed in healthy cells but not expressed in cancer cells. In such embodiments, the cells that express Marker 1 and do not express the Target miRNA(s) would be targeted for therapy.
[0205] The combination of Marker 1 and Marker 2 leads to an enhanced specificity that improves the cancer therapy while reducing harmful side effects.
[0206] In certain embodiments, the converse can also apply. The Payload mRNA can be expressed in healthy cells and degraded in cancer cells.
[0207] It is critical to evaluate the miRNAs expressed in cancer cells to make sure that there is unlikely to be mRNA degradation / repression of the Payload mRNA in cancer cells so that these cells can be marked and targeted.Previous Evidence of Using miRNAs for Tissue Specific Expression of Payload mRNAsJain et al. (www.ncbi.nlm.nih.gov / pmc / articles / PMC6157376 / ) identified that by adding a Complementary miRNA Sequence to a Luciferase mRNA, they were able to significantly reduce expression of the luciferase protein in cells expressing the Target miRNA. This approach was tested in an in-vivo tumor model and was shown that the conditional Payload mRNA caused cancer cells to self-destruct but healthy liver cells were largely unaffected. In contrast to the proposed invention, this paper did not focus on a Maker 1 and a Marker 2 combination approach. Instead, the authors focused only on a Marker 2 approach of reducing off-target effects in liver and spleen tissues. They also did not propose any algorithms to optimize Target miRNAs (Marker 2) for various healthy tissues and cancer types. In addition, they did not validate if adding Complementary miRNA Sequence(s) would also induce repression from endogenous Target miRNAs in the cancer cells. Also, they did not propose Custom Protein Sequences to express a universal cancer antigen for a single antibody based immunotherapy, or the expression of a viral protein to trick the body into thinking the cancer cell is a viral infected cell, or express cytokines to induce an immune response.Platform Variations
[0208] The novel platform can be applied in several variations.Variation 1: Conditional Expression of UCA
[0209] Referring to Fig. 9, this illustrates one variation of the novel platform. In this variation, the initial administration (Shot #1) 901 is provided to detect and mark various cancer cells. These can be administered various routes (e.g. intravenous and intraperitoneal) as different injections. In certain embodiments, this can also be administered by infusion. Specific cell types are identified to have surface molecule (Marker 1). This shot can contain a LNPs or a variation of a mRNA deliver system 900 conjugated with a Marker 1 antibody or other surface molecule targeting element and containing a conditional Payload mRNA that is suppressed in cells with Target miRNA (Marker 2), but not in cancer cells without the Target miRNA. In this variation, the Payload mRNA is designed to express a universal cancer antigen (UCA) with a complementary sequence for the Target miRNA (Marker 2) 907.
[0210] The initial shot 901 can deliver an RNA therapy that detects and marks cells with a combination of Marker 1 + Marker 2 for a given tumor type, e.g., breast cancer. Alternatively, the initial shot 901 can be a cocktail of LNPs with different combinations of Marker 1 and Marker 2 but containing the same Payload mRNA to address tumor heterogeneity within cancertypes. For example, the first shot can detect a Marker 1 for sarcoma 903, a Marker 1 for breast cancer 904, a Marker 1 for prostate cancer 905, and / or a Marker 1 for another type of cancer 906. In certain embodiments, the cocktail is for a specific cancer type, and there can be a cocktail of different Marker 1 and Marker 2 combinations. This cocktail will overcome the problem that not all of the cancer cells within an individual tumor will express the same Marker 1 and / or Marker 2. Each of these LNPs enter cells with the surface molecule (Marker 1) matching the LNP targeting moiety (e.g., antibody). Inside the target cells, the conditional payload containing the Complementary miRNA Sequence is then delivered 907. If the Target miRNA exists (“Marker 2”), as is the case with healthy cells, then the Payload mRNA will be degraded or suppressed.
[0211] If the Target miRNA is not found, as is the case with cancer cells, the Payload mRNA will be allowed to express a universal cancer antigen (UCA) 908 that triggers the natural or synthetic mechanisms to attack the cancer cell.
[0212] The second shot (single shot #2) 902 is then provided as a UCA antibody vaccine to vaccinate against all detected tumors.Variation 2: Conditional Expression of Existing Disease Antigen
[0213] Referring to Fig. 10, this illustrates another variation of the novel platform. In this variation, the initial immunotherapy (Shot #1) 1001 is provided to detect and mark various cancer cells. It can be administered as several injections. The initial shot 1001 can contain an mRNA delivery vehicle such as an LNP 1000 conjugated with a Marker 1 antibody or other surface molecule targeting element and containing a conditional Payload mRNA that is suppressed in cells with Target miRNA (Marker 2), but not in cancer cells without the Target miRNA. In this variation, the Payload mRNA is designed to result in the expression of an existing disease antigen (e.g., COVID, tetanus, etc.)
[0214] The initial shot 1001 can deliver an RNA therapy that detects and marks cells with a combination of Marker 1 + Marker 2 for a single tumor type, e.g., breast cancer, or it can be a cocktail of LNPs that are directed to various tumor types to address tumor heterogeneity. For example, the first shot can detect a Marker 1 for sarcoma 1003, a Marker 1 for breast cancer 1004, a Marker 1 for prostate cancer 1005, and / or a Marker 1 for another type of cancer 1006. In certain embodiments, the cocktail is for a specific cancer type, and there can be a cocktail of different Marker 1 and Marker 2 combinations. This cocktail will overcome the problem that not all of the cancer cells within an individual tumor will express the same Marker 1 and / or Marker2. Each of these LNPs enter cells with the surface molecules (Marker 1) matching the L\P targeting moiety (e.g., antibody). Inside the target cells, the conditional payload is then delivered with the complementary sequence for the Target miRNA 1007. If the Target miRNA exists (“Marker 2”), as is the case with healthy cells, then the Payload mRNA will be degraded or suppressed. If the Target miRNA is not found, as is the case with cancer cells, the mRNA will be allowed to express the resulting protein - the selected disease related antigen 1008. This effectively tricks the body into recognizing the cancer cell as an existing disease related antigen (e.g. COVID, tetanus, varicella, etc), and triggering the body’s immune system to attack the cancer cells without requiring further drugs.A second shot 1002 can be administered as commercially available vaccine for the expressed disease related antigen 1008. For example, a COVID vaccine, a tetanus vaccine, or booster shots.Variation 3: One Shot Universal Immunotherapy
[0215] Referring to Fig. 11, this illustrates yet another variation of the novel platform. In this variation, the initial immunotherapy (Shot #1) 3001 is provided to detect and mark various cancer cells. The initial shot 3001 can contain an mRNA delivery vehicle such as an LNP 3000 conjugated with a Marker 1 antibody or other surface molecule targeting element and containing a conditional Payload mRNA that is suppressed in cells with Target miRNA (Marker 2), but not in cancer cells without the Target miRNA. In this variation, the Payload mRNA is designed to result in the expression of an existing disease-related antigen (e.g., COVID, tetanus, etc.) and the initial shot contains the Payload mRNA for the antigen, which would activate an existing endogenous immunity from previous vaccinations or infections.
[0216] The initial shot 3001 can deliver an RNA immunotherapy that detect and mark cells with a combination of Marker 1 + Marker 2 for a single tumor type, e.g., breast cancer, or it can be a cocktail of LNPs that are directed to various tumor types to address tumor heterogeneity. For example, the first shot can detect a Marker 1 for sarcoma 3003, a Marker 1 for breast cancer 3004, a Marker 1 for prostate cancer 3005, and / or a Marker 1 for another type of cancer 3006. In certain embodiments, the cocktail is for a specific cancer type, and there can be a cocktail of different Marker 1 and Marker 2 combinations. This cocktail will overcome the problem that not all of the cancer cells within an individual tumor will express the same Marker 1 and / or Marker 2. Each of these LNPs enter cells with the surface molecules (Marker 1) matching the LNP conjugated ligand. Inside the target cells, the conditional payload is then delivered with thecomplementary sequence for the Target miRNA 3007, 3008. If the Target miRNA exists (“Marker 2”) 3007, 3008, as is the case with healthy cells, then the Payload mRNA will be degraded or suppressed. If the Target miRNA is not found, as is the case with cancer cells, the mRNA will be allowed to express the resulting protein - the selected antigen 008. This effectively tricks the body into recognizing the cancer cell as an existing disease antigen (e.g. COVID, tetanus, varicella, etc), and triggering the body’s immune system to attack the cancer cells without requiring further drugs. In this embodiment, the initial shot also contains the immunotherapy against this antigen, thereby triggering the body’s immune system to attack the cancer cells without requiring further drugs. In some embodiments, the initial shot can be used in combination with a variety of treatment options and other therapies.
[0217] In some embodiments the variations of the universal cancer immunotherapy may undergo multiple rounds of administration. The Payload mRNA can be administered through different routes. The route of administration has been shown to have a significant impact on biodistribution. In some embodiments the variations of the universal cancer immunotherapy may be administered as an intravenous infusion. In some embodiments the variations of the universal cancer immunotherapy may be administered intraperitoneally. In some embodiments the variations of the universal cancer immunotherapy may be administered intratumorally. In some embodiments the variations of the universal cancer immunotherapy may be administered subcutaneously. In some embodiments the variations of the universal cancer immunotherapy may be administered intramuscularly. In some embodiments the variations of the universal cancer immunotherapy may be administered intradermally.Constructs of mRNA DeliveryLipid nanoparticles (LNPs)
[0218] Referring to Fig. 1A, in one embodiment, an antibody conjugated lipid nanoparticle (LNP) includes an antibody 101, an LNP 102, and a conditional payload 103. The LNPs typically consist of four different components with a unique role: an ionizable lipid, a phospholipid, and a sterol lipid (e.g. cholesterol). These are combined with a nucleic acid payload via rapid mixing to generate a lipid nanoparticle.
[0219] The ionizable lipid provides nucleic acid complexation and plays a role in membrane fusion. The ionizable lipid determines the potency of the LNP because it has a crucial role in encapsulating mRNA or other different types of nucleic acids. In general, cationic lipids containalkylated quaternary ammonium groups for which the charge of the lipids remains the same in different pH.
[0220] The other components of the LNPs are known as the helper lipids: these include the phospholipids and cholesterol. The phospholipids provide complex support and provides a highly stable structure for saturated lipids and promotes endosome destabilization for unsaturated lipids. In general, these helper lipids not only provide structural stability of the nanoparticle, which improve the biodistribution of LNPs and enhance the delivery efficacy by promoting intracellular uptake and cytosolic entry.
[0221] The sterol lipid provides structural integrity and promotes endosomal release. Cholesterol is also used in LNP development as it enhances particle stability by regulating membrane integrity and rigidity. It plays an important role in enhancing gene transfection and biodistribution of mRNA-LNPs due to the analog with C-24 alkyl phytosterols.
[0222] The PEGylated lipid provides a hydrophilic surface and steric hindrance. The PEGylated lipids have various roles in LNP formulations and mRNA delivery. The structure of the PEGylated lipids contains a hydrophilic head and hydrophobic tail.
[0223] These LNPs can be produced by various methods including thin-film hydration, ethanol injection, T-junction mixing, and microfluidic mixing.Alternatives to LNPs
[0224] Although less clinically advanced than LNPs, polymers offer similar advantages to lipids and effectively deliver mRNA. Spherical nucleic acids are three-dimensional nanostructures composed of a nanoparticle core and a layer of densely arranged oligonucleotide shells. They lead to sensitive biosensing and durable catalytic stability. Cationic polymers condense nucleic acids into complexes called polyplexes that have various shapes and sizes and can be taken up into cells by endocytosis. The mechanisms by which polyplexes escape from endosomes are uncertain; one possible mechanism is that proton buffering by the polymer leads to osmotic swelling and rupture of the endosomes — the proton sponge hypothesis. Polyethylenimine is the most widely studied polymer for nucleic acid delivery. Although its efficacy is excellent, its application is limited by its toxicity owing to its high charge density. Use of a low molecular weight form, incorporation of PEG into the formulation, conjugation to cyclodextrin and disulfide linkage can mitigate the toxicity of polyethylenimine.
[0225] Additionally, several alternative biodegradable polymers have been developed that are less toxic. Poly(P-amino ester)s, for example, excel at mRNA delivery, especially to the lung. Because they are easily synthesized by the Michael reaction, large poly(P-amino ester) libraries have been created that facilitate structure-function studies. Similar to poly(P-amino ester)s, poly(amidoamine)s are biodegradable polymers that are synthesized by the Michael reaction and allow facile modifications to their core and periphery. Poly(amidoamine)s form hyperbranched tree-like spherical dendrimers that efficiently form mRNA complexes owing to the high amine density on their periphery. Although charge density is favourable for mRNA complexation, excessive charge can cause toxicity and serum aggregation. Fortunately, these issues can be mitigated by introducing disulfide linkages or incorporating PEG in the dendrimer core.
[0226] Like the ionizable lipids in LNPs, pH-responsive polymers have also been used for mRNA delivery. Poly(aspartamide)s conjugated to ionizable aminoethylene side chains are protonated at the acidic pH inside endosomes, facilitating RNA delivery. The hydrophobicity and length of the side chain influence poly(aspartamide) protonation and delivery efficacy. For example, PEGylated poly(aspartamide) with an ethylenediamine side chain delivers mRNA to liver, brain, spinal cord, knee joint and olfactory nerves. In addition to poly(aspartamide)s, pH- responsive charge-altering releasable transporters have gained attention owing to their unique mRNA delivery mechanism. Instead of protonating inside endosomes, these charge-altering releasable transporters self-degrade into neutral, non-toxic by-products at cytosolic pH, leading to rapid release of the mRNA into the cytoplasm.MicroRNAs (miRNAs)
[0227] MicroRNAs (miRNAs) are a class of non-coding RNAs that play important roles in regulating gene expression. The majority of miRNAs are transcribed from DNA sequences into primary miRNAs and processed into precursor miRNAs, and finally mature miRNAs. In most cases, miRNAs interact with the 3' untranslated region (3' UTR) of target mRNAs to induce mRNA degradation and translational repression. They are small, single-stranded, non-coding RNA molecules typically containing 21 to 23 nucleotides. They play a critical role in post transcription regulation in the cytoplasm. There are approximately 2,600 miRNAs found in humans, and they can be tissue specific. Under certain conditions, miRNAs can also activate translation or regulate transcription. The interaction of miRNAs with their target genes is dynamic and dependent on many factors, such as subcellular location of miRNAs, the abundanceof miRNAs and target mRNAs, and the affinity of miRNA-mRNA interactions. miRNAs can be secreted into extracellular fluids and transported to target cells via vesicles, such as exosomes, or by binding to proteins, including Argonautes. Extracellular miRNAs function as chemical messengers to mediate cell-cell communication. When expressed in the cell, these miRNAs bind to complementary sequences on mRNAs, leading to the mRNA’s repression and / or degradation. Based on their differential roles in the regulation of mRNA in cancer cells, miRNAs are divided into oncogenic miRNAs, also known as oncomiRs, and tumor suppressor miRNAs.
[0228] By leveraging this naturally occurring post transcriptional regulatory mechanism, the novel approach described herein can enhance the specificity of mRNA therapeutic payload delivery. This can be achieved by incorporating a Complementary miRNA Sequence for miRNAs that are specific to off-target healthy cells in the Payload mRNA. When an mRNA delivery vehicle (such as a lipid nanoparticle (LNP)) binds to the corresponding surface molecule expressed on healthy cells, the naturally occurring miRNA will degrade the Payload mRNA. However, when a LNP binds to the corresponding surface molecule on a cancer cell, the lack of expression of the Target miRNA will allow translation of the Payload mRNA, thereby marking the cancer call by expressing the resulting protein.5’ UTR and 3’ UTR
[0229] The 5' and 3' UTR elements flanking the coding sequence profoundly influence the stability and translation of mRNA, both of which are critical concerns for this immunotherapy. These regulatory sequences can be derived from viral or eukaryotic genes and greatly increase the half-life and expression of therapeutic mRNAs. See Pardi, N., et al. mRNA vaccines — a new era in vaccinology. Nat Rev Drug Discov 17, 261-279 (2018). A 5' cap structure is required for efficient protein production from mRNA Gallie, D. R. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 5, 2108-2116 (1991). Various versions of 5' caps can be added during or after the transcription reaction using a vaccinia virus capping enzyme’ (Martin, S. A., Paoletti, E. & Moss, B. Purification of mRNA guanylyltransferase and mRNA (guanine-7-) methyltransferase from vaccinia virions. J. Biol. Chem. 250, 9322-9329 (1975)) or by incorporating synthetic cap or anti-reverse cap analogues (Stepinski, J., Waddell, C., Stolarski, R., Darzynkiewicz, E. & Rhoads, R. E. Synthesis and properties of mRNAs containing the novel “anti-reverse” cap analogs 7-methyl(3'-O- methyl)GpppG and 7-methyl (3 '-deoxy)GpppG. RNA 7, 1486-1495 (2001); Malone, R. W .,Feigner, P. L. & Verma, T. M. Cationic liposome-mediated RNA transfection. Proc. Natl Acad. Sci. USA 86, 6077-6081 (1989).
[0230] The 5’ untranslated region (UTR) is critical for ribosome recruitment to the mRNA and start codon choice and plays a major role in the control of translation efficiency and shaping the cellular proteome. The 5' cap and a UTR typically serves as the entry point for a ribosome. The ribosomal initiation complex is assembled on the mRNA via a cap-dependent or cap-independent mechanism. Various mechanisms controlling ribosome scanning and initiation codon selection by 5’ upstream open reading frames (ORFs), translation initiation factors, and primary and secondary structures of the 5 ’UTR, including particular sequence motifs are described, e.g., in Hinnebusch AG, Ivanov IP, Sonenberg N. Translational control by 5'- untranslated regions of eukaryotic mRNAs. Science. 2016 Jun 17;352(6292): 1413-6. doi: 10.1126 / science.aad9868. PMID: 27313038; PMCID: PMC7422601.
[0231] The Complementary miRNA Sequence in the 3’ UTR region. The 3' untranslated regions (3' UTRs) of an RNA sequence functions to regulate mRNA-based processes, such as mRNA localization, mRNA stability, and translation. In addition, 3' UTRs can establish 3' UTR- mediated protein-protein interactions (PPIs), and thus can transmit genetic information encoded in 3' UTRs to proteins. This function has been shown to regulate diverse protein features, including protein complex formation or posttranslational modifications, but is also expected to alter protein conformations. Therefore, 3' UTR-mediated information transfer can regulate protein features that are not encoded in the amino acid sequence. Mayr C. What Are 3' UTRs Doing? Cold Spring Harb Perspect Biol. 2019 Oct 1;1 l(10):a034728. doi: 10.1101 / cshperspect.a034728. PMID: 30181377; PMCID: PMC6771366.Coding RNA or mRNA
[0232] Messenger RNA is a type of RNA that is necessary for protein production. mRNA is the intermediate step between the translation of protein-encoding DNA and the production of proteins by ribosomes in the cytoplasm. Two major types of RNA are currently studied as immunotherapies: non-replicating mRNA and virally derived, self-amplifying RNA. Conventional mRNA-based vaccines encode the antigen of interest and contain 5' and 3' untranslated regions (UTRs), whereas self-amplifying RNAs encode not only the antigen but also the viral replication machinery that enables intracellular RNA amplification and abundant protein expression. In cells, mRNA uses the information in genes to create a blueprint formaking proteins. Once cells finish making a protein, the mRNA is broken down. mRNA from vaccines does not enter the nucleus and does not alter DNA. In general mRNA molecules contain the genetic material that provides instructions for our body on how to make a viral protein that triggers an immune response within our bodies.
[0233] The folding of mRNA structures has an impact on miRNA binding in four primary ways: (1) impeded access (secondary structure can block miRNA binding sites, making them less accessible; (2) binding affinity (structures may alter the miRNA-mRNA interaction, weaking or preventing binding); (3) regulation efficiency (structures influence the effectiveness of miRNA- mediated repression or degradation; and (4) structural unfolding (RNA-binding proteins or environmental factors can expose miRNA target sites by unfolding mRNA structures).PolyA Tail
[0234] The poly(A) tail, or polyadenylic acid tail, is a long chain of adenine nucleotides that is added to a messenger RNA (mRNA) molecule during RNA processing. The poly(A) tail has multiple purposes, including stabilizing the mRNA molecule. It also associates with poly(A)- binding protein (PABP), which helps the transcript resist 3' — 5' nuclease attack. The poly(A) tail can work with the 7-methylguanosine (m7G) cap on the 5'-end of the mRNA to stimulate translation. Transcripts without a poly(A) tail have low levels of translation and are more likely to have their 5' cap removed. The poly(A) tail regulates gene expression in the cytoplasm. The poly(A) tail also plays an important regulatory role in mRNA translation and stability; thus, an optimal length of poly(A) must be added to mRNA either directly from the encoding DNA template or by using poly(A) polymerase. Holtkamp, S. et al. Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. Blood 108, 4009-4017 (2006). The codon usage additionally has an impact on protein translation. Replacing rare codons with frequently used synonymous codons that have abundant cognate tRNA in the cytosol is a common practice to increase protein production from mRNA, although the accuracy of this model has been questioned. Gustafsson, C., Govindarajan, S. & Minshull, J. Codon bias and heterologous protein expression. Trends Biotechnol. 22, 346- 353 (2004); Mauro, V. P. & Chappell, S. A. A critical analysis of codon optimization in human therapeutics. Trends Mol. Med. 20, 604-613 (2014). Enrichment of G:C content constitutes another form of sequence optimization that has been shown to increase steady-state mRNA levels in vitro and protein expression in vivo. Kudla, G., Lipinski, L., Caffin, F., Helwak, A. &Zylicz, M. High guanine and cytosine content increases mRNA levels in mammalian cells. PLoS Biol. 4, el 80 (2006); Thess, A. et al. Sequence-engineered mRNA without chemical nucleoside modifications enables an effective protein therapy in large animals. Mol. Ther. 23, 1456-1464 (2015). Although protein expression may be positively modulated by altering the codon composition or by introducing modified nucleosides, it is also possible that these forms of sequence engineering could affect mRNA secondary structure, the kinetics and accuracy of translation and simultaneous protein folding, and the expression of cryptic T cell epitopes present in alternative reading frames. Shortening of the poly(A) tail, or deadenylation, can trigger translation repression and mRNA decay. The poly(A) tail stabilizes intact mRNAs.Payload Delivery
[0235] Payload mRNAs can be delivered via any suitable method. For example, LNPs internalize into cells, via both clathrin-dependent and clathrin-independent endocytosis mechanisms such as macropinocytosis. In certain embodiments, spherical nucleic acids can be used. For efficient delivery, the nucleic acid payloads must be released into the cytosol before the maturation of late endosomes to lysosomes where the majority of the foreign materials are degraded enzymatically. The release of the payload prior to lysosomal maturation is a crucial stage for efficient delivery and is known as endosomal escape.
[0236] In addition to lipid and polymer-based vehicles, peptides can also deliver mRNA into cells, via the cationic or amphipathic amine groups (for example, arginine) in their backbone and side chains that electrostatically bind to mRNA and form nanocomplexes. For example, a fusogenic cell-penetrating peptide containing repetitive arginine-alanine-leucine-alanine (RALA) motifs changes conformation at endosomal pH, facilitating pore formation in the membrane and endosomal escape. RALA delivers mRNA to dendritic cells (professional antigen-presenting cells of the immune system) to elicit T cell-mediated immunity. There is also a commercially available cell-penetrating peptide, PepFectl4, that delivered mRNA to ovarian cancer cells in a mouse xenograft model. Arginine-rich protamine peptides (of about 4 kDa), which are positively charged at neutral pH, can also condense mRNA and facilitate its delivery. Protamine complexed with mRNA activates Toll-like receptor (TLR7, TLR8) pathways that recognize single- stranded mRNA; thus, it can act as an adjuvant for vaccine or immunotherapy applications. Finally, squalene-based cationic nanoemulsions also deliver mRNA. These nanoemulsions consist of anoily squalene core stabilized by a lipid shell that adsorbs mRNA onto its surface. Some squalene formulations act as adjuvants in influenza vaccines.
[0237] Unprotected mRNA delivered by itself is unsuitable for broad therapeutic applications, and was therefore ignored by the pharmaceutical industry for a long time. It was the development of RNA interference and its tremendous therapeutic potential that triggered intense efforts toward stabilization of RNA in vivo. Several strategies have been developed for RNA delivery, including RNA-conjugates, modified RNA, viral vectors and microparticles and nanoparticles. While linking RNA to molecules offers some level of protection against degradation, it can promote binding to serum proteins and subsequent aggregation that can lead to vascular blockage. Viral vectors were the obvious choice for delivery, because viruses have naturally evolved to become highly efficient at nucleic-acid delivery. However, several limitations are generally associated with these vectors, including immunogenicity, carcinogenesis, broad tropism packaging capacity and production difficulties. In contrast to viral analogues, nonviral vectors exhibit significantly reduced transfection efficiency but tend to have lower immunogenicity than viruses and patients do not have pre-existing immunity against the nonviral vector. Furthermore, nonviral vectors, whose sizes are larger than those of viruses, have the potential to carry larger genetic payloads, while at the same time being simple to synthesize. With the development of new materials and preparation techniques, as well as a better understanding of the mechanisms involved, nonviral vectors are becoming the preferred vehicle to deliver mRNA. The most common technologies use lipids, polymers, followed by peptides and inorganic nanoparticle.
[0238] Independent of the materials or technologies used, ‘good’ nonviral vectors should: efficiently bind and condense RNA, protect against degradation in the extracellular space and localize the payload at the membrane of the desired target cell, followed by cellular uptake and endosomal escape into the cytosol. The most important targets for mRNA vaccines are professional antigen presenting cells (APCs), with dendritic cells (DCs) likely being the most relevant cell type. Indeed, DCs play a critical role in antigen processing and presentation to elicit an immune response against specific antigens. The transfected DCs express the mRNA-encoded antigen in the native form. The antigens are subsequently processed by the proteasome, and the generated peptide epitopes enter the endoplasmic reticulum where they are loaded onto major histocompatibility complex (MHC) class I molecules.RNA Therapy and mRNA Vaccines
[0239] The majority of mRNA vaccines are administered as a bolus injection into the skin, muscle or subcutaneous space, where they are taken up by immune or non-immune cells and translated into antigens that are displayed to T and B cells. Both the mRNA and the delivery vehicle enhance the immunogenicity and efficacy of mRNA vaccines.
[0240] Recently, mRNA vaccines have generated significant interest to complement or even replace traditional vaccines due to a number of important attributes that they possess. Although subunit vaccines have been used successfully to elicit humoral immunity against a wide variety of pathogens, they fail to induce cellular immunity which is required to eradicate the intracellular pathogen reservoir of many chronic diseases, including viral infections such as HIV or hepatitis C. Live-attenuated vaccines are the most potent in activating both arms of the adaptive immune system - cellular and humoral immunity. However, these vaccines exhibit considerable safety drawbacks. Indeed, attenuated pathogens have the very rare potential to revert to a pathogenic form and cause disease. This is of special concern in immune deficient individuals, or in immunosuppressed patients, where guidelines generally recommend that no live-attenuated vaccines should be administered. Subunit vaccines have been developed as a safer alternative, while recognizing that they are less efficient and often require adjuvants. Andreas M Reichmuth, Matthias A Oberli, Ana Jaklenec, Robert Langer, Daniel Blankschtein, Ther Deliv. 2016 May; 7(5): 319-334. Published online 2016 Apr 14. doi: 10.4155 / tde-2016-0006.
[0241] DNA and mRNA vaccines share many similarities, where the main difference between the two vaccines is the target location for the delivery of the oligonucleotides. DNA therapeutics have to reach the nucleus, while for mRNA therapeutics, the cytosol is the target. As a result, mRNA therapeutics are easier to deliver because they do not require crossing the nuclear membrane. In addition, even if mRNA reaches the nucleus, it does not integrate itself or alters the genome. Although recombination among single-stranded RNA is rarely possible, cytosolic mRNA has no interaction with the genome. Moreover, mRNA essentially represents the minimal genetic information, and is only transiently expressed until the mRNA has been degraded. mRNA can encode multiple proteins possessing very different chemical and physical properties, while leaving its physiochemical properties largely unaffected. Accordingly, mRNA provides the technological basis to deliver a wide variety of antigens, modulators and cell-signaling factors in a single molecule. Simultaneously, mRNA exhibits self-adjuvating properties in that it binds topattern -recognition receptors like TLR7 that promote cellular immunity. Finally, mRNA synthesis and purification are fast, easy and low cost when compared with other vaccines. Reichmuth (2016).
[0242] mRNA vaccines represent a promising alternative to conventional vaccine approaches because of their high potency, capacity for rapid development and potential for low-cost manufacture and safe administration. However, their application has until recently been restricted by the instability and inefficient in vivo delivery of mRNA. Recent technological advances have now largely overcome these issues, and multiple mRNA vaccine platforms against infectious diseases and several types of cancer have demonstrated encouraging results in both animal models and humans. Pardi, N., et al. mRNA vaccines — a new era in vaccinology. Nat Rev Drug Discov 17, 261-279 (2018). Preclinical studies have created hope that mRNA vaccines will fulfil many aspects of an ideal clinical vaccine: they have shown a favourable safety profile in animals, are versatile and rapid to design for emerging infectious diseases, and are amenable to scalable good manufacturing practice (GMP) production (already under way by several companies).
[0243] Unlike protein immunization, several formats of mRNA vaccines induce strong CD8+ T cell responses, likely owing to the efficient presentation of endogenously produced antigens on MHC class I molecules, in addition to potent CD4+ T cell responses. Additionally, unlike DNA immunization, mRNA vaccines have shown the ability to generate potent neutralizing antibody responses in animals with only one or two low-dose immunizations. As a result, mRNA vaccines have elicited protective immunity against a variety of infectious agents in animal models. Id. Two major types of RNA vaccine have been utilized against infectious pathogens: self-amplifying or replicon RNA vaccines and non-replicating mRNA vaccines. Nonreplicating mRNA vaccines can be further distinguished by their delivery method: ex vivo loading of DCs or direct in vivo injection into a variety of anatomical sites.
[0244] The production of in vitro transcribed (IVT) mRNA can be carried out in cell-free systems, leading to easy standardization of clinical-grade manufacturing, which can be performed under Good Manufacturing Practices (GMPs). Fabrication costs of IVT mRNA under GMPs are substantially low as compared to recombinant proteins produced in eukaryotic cells. It is important to select an efficient purification method of the IVT mRNA in order to eliminate aberrant (e.g., truncated) mRNA molecules, which are highly immunogenic contaminants andmay lower translation efficiency. Manufacturing of IVT mRNA by a cell-free in vitro transcription system requires a linearized DNA template which must contain a prokaryotic phage promoter sequence for the T3, T7, or SP6 RNA polymerases, the open reading frame (ORF) encoding the desired protein, the sequences corresponding to the regulatory untranslated regions (UTRs), and optionally, to a polyadenylated tail (poly(A) tail). When the poly(A) tail is not encoded directly in the DNA template, it can be added post-transcriptionally by enzymatic reactions with recombinant poly(A)polymerase of E. coli (E-PAP). Since the final IVT mRNA must be structurally similar to natural mRNA processed in the cytoplasm of eukaryotic cells, it also needs to be capped in 5’. A synthetic IVT mRNA consists of the following five fundamental structures, which can be chemically modified in order to optimize the translation process and the stability, and to regulate the immunogenicity: (a) Cap in 5’; (b) 5’ UTR; (c) an ORF, which has the starting codon AUG and the stop codon (UAA, UAG, UGA); (d) 3’ UTR; and (e) poly(A) tail. Chemical modifications influence in a specific manner the mRNA translation in different cell types. Therefore, addressing the precise intracellular behavior of mRNA in the cell of interest will lead to further chemical modifications and extend the usefulness of mRNA as a biomedical product.RNA Delivery
[0245] RNA-based therapeutics, which function by either silencing pathological genes through delivery of siRNA or expressing therapeutic proteins through the delivery of exogenous mRNA to cells can be used for the treatment of various diseases including cancer. Lipid nanoparticles (LNPs), currently represent the most advanced platform for RNA delivery. LNPs are spherical and are visible in electron microscopy. Therapeutic LNPs are less than 100 nm in diameter, consisting of lipids and payloads such as nucleic acids. For LNP preparation, lipids and RNA are separately dissolved in ethanol and acidic aqueous solution, respectively. Next, they are mixed with an automated microfluidics apparatus for industrial use or a pipette for research use. Then, ethanol is removed by dialysis. In most industrial applications, several chromatographic purification procedures are required to increase the authenticity of the final LNP product. The final LNP composition is examined based on the percentage of RNA encapsulation, the diameter of the LNP, its zeta potential, and other biophysical parameters. Zeta potential represents the stability of the LNP. To optimize these acquired parameters, the poly dispersity index (PDI) is used, which measures the heterogeneity of macromolecules including LNP; a value of less than0.1 has been generally accepted as well-optimized conditions. When LNPs are formulated, lipids are used excessively over RNA (approximately 10: 1 in terms of weight ratio). RNA is an essential payload for LNP. Its efficacy is proven by the several vaccine products for COVID-19 with tremendous benefits for humans. RNA has long been thought to be an unstable biomolecule. However, an accumulating knowledge of ribonucleotides, nucleases, and the molecular mechanism of inflammation collectively is establishing an improved understanding on the stability of RNA. Mashima R, Takada S. Lipid Nanoparticles: A Novel Gene Delivery Technique for Clinical Application. Curr Issues Mol Biol. 2022 Oct 19;44(10):5013-5027. doi: 10.3390 / cimb44100341. PMID: 36286056; PMCID: PMC9600891.
[0246] The first step for efficient internalization of in vitro transcribed (IVT) mRNA can be the interaction between the delivery system and the cell membrane. The attachment to the cell surface may occur through electrostatic interactions between the system and the membrane surface, which is favored for those systems presenting a cationic nature. Cell binding can also be improved by incorporating ligands able to interact with specific cell surface receptors into the vectors. The main mechanism of cell entry is endocytosis. It comprises a variety of complex processes that determine the intracellular disposition of the mRNA. The vectors are included in endosomes by the invagination of the cell membrane. Endosomes mature and fuse with lysosomes, where the acidic environment and the presence of hydrolytic enzymes can degrade the vector and the nucleic acid. Therefore, endosomal escape before degradation is considered a bottleneck for successful mRNA therapy, and, as in the case of cellular internalization, the delivery system plays a crucial role. The foremost proposed mechanisms of endosomal escape include endosome disruption, active transport, or fusion of the delivery system with the endosomal membrane. However, it was recently identified that late endosome / lysosome formation is essential for the functional delivery of exogenously presented mRNA.
[0247] mRNA vaccines work by introducing a piece of mRNA that corresponds to a viral protein, usually a small piece of a protein found on the virus’s outer membrane. Individuals who get an mRNA vaccine are not exposed to the virus, nor can they become infected by the vaccine. Using this mRNA blueprint, cells produce the viral protein.
[0248] As part of a normal immune response, the immune system recognizes that the protein is foreign and produces specialized proteins called antibodies. Antibodies help protect the body against infection by recognizing individual viruses or other pathogens, attaching to them, andmarking the pathogens for destruction. Once produced, antibodies remain in the body, even after the body has rid itself of the pathogen, so that the immune system can quickly respond if exposed again. If a person is exposed to a virus after receiving mRNA vaccination for it, antibodies can quickly recognize it, attach to it, and mark it for destruction before it can cause serious illness.Modulation of Immunogenicity
[0249] Exogenous mRNA is inherently immunostimulatory, as it is recognized by a variety of cell surface, endosomal and cytosolic innate immune receptors. Depending on the therapeutic application, this feature of mRNA could be beneficial or detrimental. It is potentially advantageous for vaccination because in some cases it may provide adjuvant activity to drive dendritic cell (DC) maturation and thus elicit robust T and B cell immune responses. However, innate immune sensing of mRNA has also been associated with the inhibition of antigen expression and may negatively affect the immune response. Kariko, K. et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. 16, 1833-1840 (2008); Kariko, K., Muramatsu, H., Ludwig, J. & Weissman, D. Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA. Nucleic Acids Res. 39, el42 (2011). Although the paradoxical effects of innate immune sensing on different formats of mRNA vaccines are incompletely understood, some progress has been made in recent years in elucidating these phenomena. Studies over the past decade have shown that the immunostimulatory profile of mRNA can be shaped by the purification of IVT mRNA and the introduction of modified nucleosides as well as by complexing the mRNA with various carrier molecules. See, e.g., Kariko (2008), Kariko (2011), Fotin-Mleczek, M. et al. Messenger RNA-based vaccines with dual activity induce balanced TLR-7 dependent adaptive immune responses and provide antitumor activity. J. Immunother. 34, 1—15 (2011). As a mimic of viral genomes and replication intermediates, dsRNA is a potent pathogen-associated molecular pattern (PAMP) that is sensed by pattern recognition receptors in multiple cellular compartments. Recognition of IVT mRNA contaminated with dsRNA results in robust type I interferon production, which upregulates the expression and activation of protein kinase R (PKR; also known as EIF2AK2) and 2'-5'- oligoadenylate synthetase (OAS), leading to the inhibition of translation and the degradation of cellular mRNA and ribosomal RNA, respectively. Studies have demonstrated that contaminatingdsRNA can be efficiently removed from IVT mRNA by chromatographic methods such as reverse-phase fast protein liquid chromatography (FPLC) or high-performance liquid chromatography (HPLC). Strikingly, purification by FPLC has been shown to increase protein production from IVT mRNA by up to 1,000-fold in primary human DCs. Thus, appropriate purification of IVT mRNA seems to be critical for maximizing protein (immunogen) production in DCs and for avoiding unwanted innate immune activation.
[0250] Besides dsRNA contaminants, single-stranded mRNA molecules are themselves a PAMP when delivered to cells exogenously. Single-stranded oligoribonucleotides and their degradative products are detected by the endosomal sensors Toll-like receptor 7 (TLR7) and TLR8, resulting in type I interferon production. Crucially, it was discovered that the incorporation of naturally occurring chemically modified nucleosides, including but not limited to pseudouridine and 1 -methylpseudouridine, prevents activation of TLR7, TLR8 and other innate immune sensors, thus reducing type I interferon signalling. Nucleoside modification also partially suppresses the recognition of dsRNA species. Anderson, B. R. et al. Incorporation of pseudouridine into mRNA enhances translation by diminishing PKR activation. Nucleic Acids Res. 38, 5884-5892 (2010). As a result, nucleoside-modified mRNA is translated more efficiently than unmodified mRNA in vitro, particularly in primary DCs, and in vivo in mice. Notably, the highest level of protein production in DCs was observed when mRNA was both FPLC-purified and nucleoside-modified. These advances in understanding the sources of innate immune sensing and how to avoid their adverse effects have substantially contributed to the current interest in mRNA-based vaccines and protein replacement therapies. Pardi, N., et al. mRNA vaccines — a new era in vaccinology. Nat Rev Drug Discov 17, 261-279 (2018).Genetic Editing and Detection
[0251] A detector with a specific Payload mRNA can contain instructions for the tumor cells to express a custom Universal Cancer Antigen (UCA). Genetic modification can be performed using technology such as Retron Library Recombineering (RLR) Platform, Cas-CLOVER nucleases, Mini-Cas9 enzymes, NgAgo Protein Gene Editing System, Zinc Finger Nucleases (ZFNs), Transcription activator-like effector nucleases (TALENs), FANA Antisense Oligonucleotide (FANA ASO) technology.Retron Library Recombineering (RLR) Platform
[0252] Retrons are segments of bacterial DNA that undergo reverse transcription to produce fragments of single-stranded DNA (ssDNA). researchers have become more interested in them over the last few years because they, like CRISPR, could be used for precise and flexible gene editing in bacteria, yeast, and even human cells. Retrons have the ability to produce ssDNA within the cells that are targeted to edit rather than trying to force them into the cell from the outside, and without damaging the native DNA. The retrons is that their sequences themselves can serve as “barcodes” that identify which individuals within a pool of bacteria have received each retron sequence, enabling dramatically faster, pooled screens of precisely-created mutant strains. Another feature that distinguishes RLR is that the proportion of bacteria that successfully integrate a desired mutation into their genome increases over time as the bacteria replicate. RLR could potentially be combined with CRISPR to improve its editing performance, or could be used as an alternative in the many systems in which CRISPR is toxic.Cas-CLOVER Nucleases
[0253] While the CRISPR Cas9 technology uses a single guide RNA that is to create genomic cuts in unwanted sites, a high-precision Cas-CLOVER gene has an undetectable off- target activity that can be used as an alternative to CRISPR / Cas9. It achieves this specificity through the utilization of two guide RNA.Mini-Cas9 Enzymes
[0254] The Cas9 enzyme and the single RNA strand are too large to function in the viruses used for gene therapy. Researchers have responded by creating a mini-Cas9 from the bacterium Staphylococcus aureus, which is small enough to fit inside of these viruses and has been tested in mice to correct the gene responsible for muscular dystrophy.NgAgo Protein Gene Editing System
[0255] Researchers have also unveiled a new gene-editing system using the NgAgo protein to cut DNA at a specific site without requiring a guide RNA. This approach relies on proteins from the Argonaute family as alternative to, or in combination with CRISPR Cas9 gene editing. Long prokaryotic Argonaute proteins (pAgos) are programmable endonucleases that have recently been proposed as flexible tools for genome editing. Prokaryotic Argonautes (pAgos) have been proposed as more flexible tools for gene-editing as they do not require sequence motifs adjacent to their targets for function, unlike popular CRISPR / Cas systems. One promisingpAgo candidate, from the halophilic archaeon Natronobacterium gregoryi (NgAgo), has been shown to act as a nicking DNA endonucleaseZinc Finger Nucleases (ZFNs)
[0256] ZFNs were the first endonucleases that could recognize and cleave target DNA at specific positions. They are made up of around 30 amino acid modules that interact with nucleotide triplets and can recognize long DNA sequences providing on-target specificity. Gene editing has been performed using ZFNs.Transcription activator-like effector nucleases (TALENs)
[0257] These are restriction enzymes engineered to cut specific DNA sequences made by fusing a TAL effector, which can be engineered to bind to any desired DNA sequences. When combined with a suitable nuclease, these TALENs can easily cut DNA at specific locations.FANA Antisense Oligonucleotide (FANA ASO)
[0258] FANA Antisense Oligonucleotide (FANA ASO) technology can be used to silence or regulate mRNA, microRNA etc. The FANA oligos do not need any delivery agents or transfection reagents and can work on both in vitro and in vivo models. The platform is easy to optimize, non-toxic and cost-effective.CRISPR-Cpfl System
[0259] The CRISPR-Cpfl serves as a viable alternative to CRISPR Cas9 as it is much easier to deliver into the cells and tissues due to its smaller size than CRISPR-Cas9. This is because it requires only one RNA whereas CRISPR Cas9 requires two. It also cuts the DNA with more precision, enabling researchers to integrate DNA more efficiently.
[0260] Using CRISPR to treat most people with genetic disorders requires clearing an enormous hurdle: getting the molecular scissors into the body and having it slice DNA in the tissues where it's needed. Recently, researchers have injected a CRISPR drug into the blood of people born with a disease that causes fatal nerve and heart disease and shown that in three of them it nearly shut off production of toxic protein by their livers. Thus, CRISPR has proven to work therapeutically inside the body. See, e.g., J. Kaier, CRISPR injected into the blood treats a genetic disease for first time, Science, June 2021, www.science.org / news / 2021 / 06 / crispr- injected-blood-treats-genetic-disease-first-time.
[0261] Because of the need for precise diagnosis in many disease situations, another important application of the CRISPR-Cas system has emerged: detection of diseases andmicrobes. Although robust and potent platforms were developed based on CRISPR-Cas9, the discovery of Casl3a (formerly C2c2) and Casl2a (formerly Cpfl) which both have collateral cleavage activity has revolutionized the field of nucleic acid detection. Casl3a is a singlecomponent, RNA-guided and targeting enzyme, which is specific for ssRNA and collaterally cleaves neighbor non-targeted RNAs. In contrast, Casl2a is an RNA-guided, DNA-targeting enzyme which targets DNA and collaterally cleaves ssDNA. Different platforms have been developed based on these two proteins. Specific high sensitivity enzymatic reporter unlocking (SHERLOCK) was introduced by Gootenberg in 2017, which exploits Casl3a for the detection of RNA molecules and a diagnostic platform based on this method was developed in 2018 At the same time, a Cas-12a-based diagnostic tool called one-hour low-cost multipurpose highly efficient system (HOLMES) was introduced in 2017 and a diagnosis platform was described in 2018. A striking example of the power of these systems is the extremely fast development of a CRISPR-Cas-based diagnostic test, which can rapidly and with a high sensitivity diagnose SARS-CoV-2, an emerging virus responsible for the COVID- 19 pneumonia disease. This demonstrated the high potential of CRISPR-Cas systems for the development of rapid detection of newly emerging diseases. Jolany vangah, S., Katalani, C., Boone, H.A. et al. CRISPR-Based Diagnosis of Infectious and Noninfectious Diseases. Biol Proced Online 22, 22 (2020). https: / / doi.org / 10.1186 / sl2575-020-00135-3.
[0262] Detection can be performed to identify DNA / RNA based mutation for specific cancers using a detector designed for the custom payload. A different detector is designed for each cancer or group of cancers. Computer-based Al or machine learning can be used in the discovery of reliable mutation markers. The ICGC / TCGA Pan-Cancer Analysis of Whole Genomes Project (PCAWG, or the Pan-Cancer Project), a collaboration involving more than 1,300 scientists and clinicians from 37 countries, analyzed more than 2,600 whole genomes of 38 different tumor types — the largest publicly available whole-genome dataset in the cancer genomics field. Fifty -two members of the Broad Institute of MIT and Harvard contributed to this research throughout the six-year long project. Using the collected data, 16 working groups examined multiple aspects of cancer development, causation, progression, and classification, confirming previous findings and generating new knowledge about cancer biology, including identifying a large diversity of molecular processes that generate cancer-causing mutations. The Pan-Cancer Project also improved and developed new methods for analyzing cancer genomes.Previous cancer genome studies focused on the 1 percent of the genome that codes for proteins, known as the exome. The Pan-Cancer Project explored the remaining 99 percent of the genome, which includes regions that regulate the activity of genes. See, S. McPherson, Collaboration generates most complete cancer genome map, The Harvard Gazette, February 5, 2020, news.harvard.edu / gazette / story / 2020 / 02 / big-step-toward-identifying-all-cancer-causing-genetic- mutations / .
[0263] While CRISPR / Cas systems have been used for genome editing, based on their ability to accurately recognize and cleave specific DNA and RNA sequences, other gene editing platforms may also be used. Moreover, following recognition of the target sequence, certain CRISPR / Cas systems including orthologues of Casl3, Casl2a, and Casl4 exhibit collateral nonspecific catalytic activities that can be employed for nucleic acid detection, for example by degradation of a labeled nucleic acid to produce a fluorescent signal. CRISPR / Cas systems are amenable to multiplexing, thereby enabling a single diagnostic test to identify multiple targets down to attomolar (10-18 mol / L) concentrations of target molecules. Developing devices that couple CRISPR / Cas with lateral flow systems allow inexpensive, accurate, highly sensitive, infield deployable diagnostics. These sensors have myriad applications, from human health to agriculture. CRISPR-based biosensing technologies have significant potential use in a myriad of applications. See, R. Aman, et al., ACS Synth. Biol. 2020, 9, 6, 1226-1233, Publication Date:March 11, 2020, https: / / doi.org / 10.1021 / acssynbio.9b00507.
[0264] The CRISPR detector can refer to the polypeptide or polypeptide components involved in gene editing, or any polynucleotide(s) encoding the polypeptide or polypeptide components. In some embodiments, the polypeptide domain having DNA binding activity is a polypeptide domain having programmable DNA binding activity. In some embodiments, the polypeptide domain having programmable DNA binding activity comprises a nucleic acid guided DNA binding domain, for example, a CRISPR-Cas protein, for example, a Cas9 nickase, a Cpfl nickase, or another CRISPR-Cas nuclease. In some embodiments, the polypeptide domain having DNA polymerase activity comprises a template-dependent DNA polymerase, for example, a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase. In some embodiments, the DNA polymerase is a reverse transcriptase. In some embodiments, the prime editor comprises additional polypeptides or polypeptide domains involved in prime editing, for example, a polypeptide domain having 5’ endonuclease activity, e.g., a 5' endogenous DNA flapendonucleases (e.g., FEN1), for helping to drive the prime editing process towards the edited product formation. In some embodiments, the prime editor further comprises an RNA-protein recruitment polypeptide, for example, a MS2 coat protein.
[0265] In some embodiments, the DNA binding domain and a DNA polymerase domain that are derived from different species. In some embodiments, a prime editor comprises a Cas polypeptide and a reverse transcriptase polypeptide that are derived from different species. For example, a prime editor may comprise a S. pyogenes Cas9 polypeptide and a Moloney murine leukemia virus (M-MLV) reverse transcriptase polypeptide.
[0266] In some embodiments, polypeptide domains of a prime editor may be fused or linked by a peptide linker to form a fusion protein. In other embodiments, a prime editor comprises one or more polypeptide domains provided in trans as separate proteins, which are capable of being associated to each other through non-peptide linkages or through aptamers or recruitment sequences.CRISPR On and Off
[0267] Over the past decade, the CRISPR-Cas9 gene editing system has revolutionized genetic engineering, allowing scientists to make targeted changes to organisms’ DNA. While the system could potentially be useful in treating a variety of diseases, CRISPR-Cas9 editing involves cutting DNA strands, leading to permanent changes to the cell’s genetic material.Researchers describe a new gene editing technology called CRISPRoff that allows researchers to control gene expression with high specificity while leaving the sequence of the DNA unchanged. The method is stable enough to be inherited through hundreds of cell divisions, and is also fully reversible.
[0268] The classic CRISPR-Cas9 system uses a DNA-cutting protein called Cas9 found in bacterial immune systems. The system can be targeted to specific genes in human cells using a single guide RNA, where the Cas9 proteins create tiny breaks in the DNA strand. Then the cell’s existing repair machinery patches up the holes. Because these methods alter the underlying DNA sequence, they are permanent. Moreover, their reliance on “in-house” cellular repair mechanisms means it is hard to limit the outcome to a single desired change. There is thus a need for a different kind of gene editor — one that didn’t alter the DNA sequences themselves, but instead changed the way they were read in the cell. This sort of modification is what scientists call “epigenetic” — genes may be silenced or activated based on chemical changes to the DNAstrand. Problems with a cell’s epigenetics are responsible for many human diseases such as Fragile X syndrome and various cancers and can be passed down through generations.
[0269] Epigenetic gene silencing often works through methylation — the addition of chemical tags to certain places in the DNA strand — which causes the DNA to become inaccessible to RNA polymerase, the enzyme which reads the genetic information in the DNA sequence into messenger RNA transcripts, which can ultimately be the blueprints for proteins. To build an epigenetic editor that could mimic natural DNA methylation, the researchers created a tiny protein machine that, guided by small RNAs, can tack methyl groups onto specific spots on the strand. These methylated genes are then “silenced,” or turned off, hence the name CRISPRoff To investigate the potential of CRISPRoff for practical applications, the scientists have tested the method in induced pluripotent stem cells. These are cells that can turn into countless cell types in the body depending on the cocktail of molecules they are exposed to, and thus are powerful models for studying the development and function of particular cell types.Marking
[0270] If a cancer cell is detected, then the Payload mRNA would be released. The Payload mRNA would contain instructions for the tumor cells to express a custom Universal Cancer Antigen (UCA). In certain embodiments, the UCA can be a non-naturally occurring designer protein. mRNA requires a delivery vehicle to protect against nucleases and facilitate cellular uptake and release into the cytoplasm. Efficient in vivo mRNA delivery is critical to achieving therapeutic relevance. Exogenous mRNA must penetrate the barrier of the lipid membrane in order to reach the cytoplasm to be translated to functional protein. mRNA uptake mechanisms seem to be cell type dependent, and the physicochemical properties of the mRNA complexes can profoundly influence cellular delivery and organ distribution. There are two basic approaches for the delivery of mRNA vaccines that have been described to date. First, loading of mRNA into DCs ex vivo, followed by re-infusion of the transfected cells; and second, direct parenteral injection of mRNA with or without a carrier. Ex vivo DC loading allows precise control of the cellular target, transfection efficiency and other cellular conditions, but as a form of cell therapy, it is an expensive and labor-intensive approach to vaccination. Direct injection of mRNA is comparatively rapid and cost-effective, but it does not yet allow precise and efficient cell-type- specific delivery, although there has been recent progress in this regard. Both of these approaches have been explored in a variety of forms. See, e g., Pardi, infra, (2018).Vaccination
[0271] An antibody is a protein complex (also referred to as immunoglobulin) uniquely designed to look for antigens, a specific structure found on a foreign virus or particle. When an antibody binds to the antigen, it serves as a flag to attract disease-fighting molecules or as a trigger that promotes cell destruction by other immune system processes. The difficulty is that cancer cells may outpace the immune system, avoid detection, or block immune system activity.
[0272] The main direct mechanism by which many antibodies induce tumor cell death is the blockade of growth factor receptor signaling. Pro-tumor growth and survival signaling is perturbed when mAbs bind their target growth factor receptors and manipulate their activation state or block ligand binding. For example, epidermal growth factor receptor (EGFR) is overexpressed by many different cancers and signaling via EGFR leads to tumor cell proliferation, migration, and invasion. Cetuximab, for example, which is an anti-EGFR mAb, induces apoptosis in tumor cells by blocking ligand binding and receptor dimerization. Human epidermal growth factor receptor 2 (HER2) is a tyrosine kinase receptor that is overexpressed in many cancers but primarily ovarian and breast carcinomas. It is distinct from EGFR in that it has no known ligand and instead hetero-dimerizes with other growth factor receptors to enhance their activation. Antibodies targeting HER2 therefore achieve signaling perturbation by inhibiting hetero-dimerization and internalization. Trastuzumab was the first FDA approved anti- HER2 mAh and remains a vital component of treatments for Fffi7?2-amplified breast cancer. Indirect mechanisms of action of mAbs require the engagement of components of the host immune system and are CDC, antibody-dependent cellular phagocytosis (ADCP), and ADCC. Most targeted mAbs are able to activate the complement system. For instance, rituximab depends in part on CDC for its in vivo efficacy. In a preclinical model, rituximab anti-tumor effects were completely abolished by knockout of the complement cascade component Clq. The importance of CDC in mAb therapy is further supported by the fact that genetic polymorphisms in the ClqA gene correlate with clinical response to rituximab in patients with follicular lymphoma. Likewise, optimization of CDC via antibody engineering can enhance anti-tumor activity. For example, the anti-CD20 mAb ofatumumab, which mediates amplified CDC, demonstrated greater efficacy than rituximab in a clinical trial of chronic lymphocytic leukemia (CLL) patients. ADCP occurs when FcyRI expressed on cells such as macrophages binds to IgGl orIgG3 mAbs that have opsonized a tumor cell. There have been very limited studies of ADCP; however, there is some evidence that ADCP plays an important role in destruction of circulating tumor cells following mAb therapy. First described in 1965 by Erna Moeller, ADCC has since been established as an immune mechanism where target cells become opsonized by antibodies which then recruits effector cells to induce target cell death by non-phagocytic mechanisms. Antibodies act as bridges between by binding to antigens on the target cell surface via their Fab portions and linking the effector cells via their Fc portions. While IgG, IgA, and IgE can all mediate ADCC, IgGl is the most relevant subclass for anti-cancer therapeutic antibodies. Effector cells must express FcR that will bind the antibody in order to facilitate ADCC. Each class of antibody has a corresponding class of FcR such as FcyR, which binds IgG, and FcaR, which binds IgA. FcyR is the most relevant class to ADCC of tumor cells and encompasses both the activating FcyRI (CD64), FcyRIIA (CD32A), FcyRIIIA (CD16A), and inhibitory FcyRIIB (CD32B) receptors. When an activating FcyR on an effector cell binds the Fc region of an antibody receptor crosslinking and downstream signal propagation occurs. NK cells are the main effector type that mediate ADCC; however other myeloid types such as monocytes, macrophages, neutrophils, eosinophils, and dendritic cells are also capable. Effector cells induce target cell death via cytotoxic granule release, Fas signaling, and initiation of reactive oxygen species. While several myeloid cell types have been demonstrated to mediate ADCC during immunotherapy, the clinical efficacy of most targeted mAbs is mainly NK cell dependent.
[0273] A UCA-antibody can be developed to target those cells with UCA expression (identified cancer cells) and induce an immune response. In particular, the UCA antibody can bind to, and inhibit the function of, proteins expressed by cancer cells. The UCA antibody can induce an immune response that can cause cell death (apoptosis). Immunotherapy has been used to treat several types of cancers including for example, skin cancer, bladder cancer, brain cancer (brain tumor), breast cancer, cervical cancer and ovarian cancer, colorectal (colon) cancer, head and neck cancer, kidney cancer, liver cancer and lung cancer and leukemia. There are several main types of immunotherapy that may be applied with the claimed immunotherapy platform.
[0274] The antibody can be a monoclonal antibody (mAbs or MoAbs) - man-made versions of immune system proteins designed to attack a very specific part of a cancer cell (in this case, for example, the UCA). Monoclonal antibodies are laboratory-produced molecules engineered to serve as substitute antibodies that can restore, enhance or mimic the immune system's attack oncancer cells. They are designed to bind to antigens that are generally more numerous on the surface of cancer cells than healthy cells Monoclonal antibodies are designed to function in different ways. A particular drug may actually function by more than one means. The role of the drug in helping the immune system may include the following:
[0275] Flagging cancer cells. Some immune system cells depend on antibodies to locate the target of an attack. Cancer cells that are coated in monoclonal antibodies may be more easily detected and targeted for destruction.
[0276] Triggering cell-membrane destruction. Some monoclonal antibodies can trigger an immune system response that can destroy the outer wall (membrane) of a cancer cell.
[0277] Blocking cell growth. Some monoclonal antibodies block the connection between a cancer cell and proteins that promote cell growth — an activity that is necessary for tumor growth and survival.
[0278] Preventing blood vessel growth. In order for a cancerous tumor to grow and survive, it needs a blood supply. Some monoclonal antibody drugs block protein-cell interactions necessary for the development of new blood vessels.
[0279] Blocking immune system inhibitors. Certain proteins that bind to immune system cells are regulators that prevent overactivity of the system. Monoclonal antibodies that bind to these immune system cells give the cancer-fighting cells an opportunity to work with less inhibition.
[0280] Directly attacking cancer cells. Certain monoclonal antibodies may attack the cell more directly, even though they were designed for another purpose. When some of these antibodies attach to a cell, a series of events inside the cell may cause it to self- destruct.
[0281] Delivering radiation treatment. Because of a monoclonal antibody's ability to connect with a cancer cell, the antibody can be engineered as a delivery vehicle for other treatments. When a monoclonal antibody is attached to a small radioactive particle, it transports the radiation treatment directly to cancer cells and may minimize the effect of radiation on healthy cells. This variation of standard radiation therapy for cancer is called radio immunotherapy.
[0282] Delivering chemotherapy. Similarly, some monoclonal antibodies are attached to a chemotherapeutic drug in order to deliver the treatment directly to the cancer cells while avoiding healthy cells.
[0283] Binding cancer and immune cells. Some drugs combine two monoclonal antibodies, one that attaches to a cancer cell and one that attaches to a specific immune system cell. This connection may promote immune system attacks on the cancer cells.
[0284] In certain embodiments, the antibody can be a bi-specific antibody that binds T-cells to ensure a more precise immune response can be used. In certain embodiments, the antibody may be used as a checkpoint inhibitor, or a drug that takes the ‘brakes’ off the immune system, which helps it recognize and attack cancer cells. In other embodiments, the antibody can be used as a part of a chimeric antigen receptor (CAR) T-cell therapy. This therapy takes some T-cells from a patient's blood, mixes them with a special virus that makes the T-cells learn how to attach to tumor cells, and then gives the cells back to the patient so they can find, attach to, and kill the cancer.
[0285] In yet other embodiments, the antibody can be used to modulate, activate or inhibit cytokines (small proteins that carry messages between cells) to stimulate the immune cells to attack cancer. The cytokines can include interferon or interleukin proteins.
[0286] In yet other embodiments, the antibody can also be used as a general immunomodulatory drug that generally boosts parts of the immune system to treat certain types of cancer.EXAMPLESExample 1 - Identifying Marker 1 / Step 1
[0287] A novel ranking algorithm was used to evaluate surface proteins to identify an optimal Marker 1 within and / or across cancer types. Marker l is a marker molecule, such as a protein, carbohydrate or lipid expressed on a cell surface that allows that cell to be detected and targeted with specificity. In this example, The Cancer Surfaceome Atlas (TCSA) was used because it integrates genomic, functional and drug response data to identify actionable targets. Based on TCSA, there are 3,567 cell-surface proteins that can potentially act as a Marker 1. An ideal Marker 1 is selected based on the ability to strongly separate cancer cells from healthy cells, have a low expression across healthy cells, and be highly expressed in cancer cells. A webbased tool can be used to find and download publicly available RNA-seq expression data forcancer samples and healthy samples. This expression data can then be used as input into the novel ranking algorithm. In this example, the UCSC Xena Browser was used to obtain RNA-seq expression data for both healthy and cancer samples. A major benefit of using the UCSC Xena Browser is that computational batch effects are non-existent due to running all samples through the same computational pipeline.
[0288] The ranking algorithm is the sum of the Z-score (one-tailed Wilcoxon test(cancer vs mean(each healthy tissue type))) + Z-score(mean(mean (expression of each healthy tissue type))) +(- 1 * Z-score(mean expression of cancer type)). Expression is measured as transcripts per million (TPM) units to estimate gene expression based on RNA-seq data. For a given gene, the number of mapped reads can be dependent on its expression level and gene length, and also the sequencing depth. To normalize these dependencies, the RPKM (reads per kilobase of transcript per million reads mapped) and TPM (transcripts per million) can be used to measure gene or transcript expression levels.
[0289] In this example, the expression of surface proteins was used to identify potential Marker 1 candidates. The ranking algorithm was used Z-score(one-tailed Wilcoxon test(cancer vs mean(each healthy tissue type))) +Z-score(mean(mean (expression of each healthy tissue type))) +(- 1 * Z-score(mean expression of cancer type)).
[0290] Referring to Fig. 7A, the UCSC Xena Browser was used as a resource for Marker 1 identification. UCSC Xena RNA-seq samples were derived from two Databases, TCGA & GTEX. Referring to Fig. 7B, the TCGA Dataset Contains RNA-seq Data For 33 Different Cancer Types. Referring to Fig. 7C, the GTEX & TCGA dataset contained RNA-seq Data for 37 Different Healthy Tissues. Referring to Fig. 7D, using the ranking algorithm, CEACAM6 was the top ranked marker 1 for pancreatic adenocarcinoma (PAAD). Referring to Fig. 7E, TM4SF4 was ranked 2ndin PAAD. Referring to Fig. 7F, MSLN was ranked 4thin PAAD. After identifying the optimal Marker 1 candidates, the next step was to optimize tissue specificity of the conditional Payload mRNA by identifying Target miRNA(s) that are specific to off-target healthy tissues (Step 2).
[0291] The following refer to computational Marker 1 selection results examples for Hepatocellular (HCC) and cholangiocarcinoma (CHOL) tumors.
[0292] Fig. 7G shows TPM expression for HCC 122 Low EpCAM in various tissue types.
[0293] Fig. 7H shows TPM expression for HCC 122 Low TM4SF4 in various tissue types.
[0294] Fig. 71 shows TPM expression for HCC 122 Low MUC1 in various tissue types.
[0295] Fig. 7J shows TPM expression for ICC 122 Low TM4SF4 in various tissue types.
[0296] Fig. 7K shows TPM expression for ICC 122 Low EpCAM in various tissue types.
[0297] Fig. 7L shows TPM expression for ICC 122 Low MUC1 in various tissue types.
[0298] The following figures show improved computational Marker 1 selection results by incorporating single cell RNA seq data. Top PDAC Marker 1 proteins were selected via bulk RNA-seq were further selected using single cell RNA-seq data. This is because bulk RNA-seq data does not provide insight into the percentage of cancer cells that accurately express selected Marker 1 proteins, unlike single-cell RNA-seq. However, single cell RNA-seq data is limited across cancer types and healthy tissues. For this reason, bulk RNA-seq and single cell RNA-seq are needed to identify optimal Marker 1 proteins for each cancer type.
[0299] Fig. 7M shows EpCAM is highly expressed in PAAD compared to healthy tissues.
[0300] Fig. 7N shows MUC1 is highly expressed in PAAD compared to healthy tissues.
[0301] Fig. 70 shows a PDAC reference single cell RNA-seq clusters.
[0302] Fig. 7P shows that EpCAM and MUC1 are the top-ranked surface proteins that are most consistently expressed in PDAC cells, which make them optimal markers.
[0303] Fig. 7Q shows that EpCAM is often expressed in pancreatic ductal cells.
[0304] Fig. 7R shows that EpCAM is similarly expressed in cancer and ductal cells.Example 2 - Identifying Marker 2 / Step 2
[0305] A Payload mRNA contains sequences that are complementary to Target miRNA(s) which are expressed in Marker 1 off target healthy tissues. This is shown for example, in Fig. 2. The cap is followed by the 5’ UTR. The Custom Protein Sequence (CPS) is flanked by the 5’ UTR and the 3’ UTR. The 3 ’UTR is followed by a polyA tail.
[0306] Publicly available miRNA-seq datasets were obtained for cancer and healthy samples. 31 Cancer Types from TCGA have miRNA-seq data, and 41 healthy tissues from TCGA and miRNATissueAtlas2 have miRNA-seq data.The Target miRNA ranking algorithm was used Z-score(one-tailed Wilcoxon test(cancer vs mean(each healthy tissue type))) +(-l * Z-score(mean(mean(expression of each healthy tissue type)))) + Z-score(mean expression of cancer type).Pancreatic Adenocarcinoma (PAAD) Cells and Pancreatic Ductal Adenocarcinoma(PDAC) Subtype
[0307] Referring to Fig. 8A, this figure shows that not all healthy tissues express a miRNA that is not expressed in PAAD. The lack of has-mir-130a-3p expression across healthy tissues suggests its poor potential as a Target miRNA for the Payload mRNA.
[0308] Referring to Fig. 8B, this figure shows that it is only necessary to identify a Target miRNA(s) that are expressed in healthy tissues that express Marker 1 and in healthy tissues where nanoparticle accumulation will likely occur (i.e. liver, spleen, lung and kidney).
[0309] Referring to Fig. 8C, hsa-miR-45 la was shown to be highly expressed in the CEACAM6 off-target tissues salivary gland and lung but not in head and neck tissue relative to PAAD.
[0310] Referring to Fig. 8D and 8E, this shows how the addition of multiple Complementary miRNA Sequences to the Payload mRNA decreases off target effects in select healthy tissues. miR-45 la would induce degradation in salivary gland and lung tissues while miR-205-5p would induce degradation in head and neck tissues. In regards to the PAAD cells, the lack of expression of these miRNAs will allow the Payload mRNA to be expressed.
[0311] In one embodiment, a Payload mRNA contains Marker 2 sequences that are complementary to miRNA(s) that are expressed in Marker 1 off target healthy tissues.
[0312]
[0313] Referring to Fig. 8F, 8G, 8H, 81, and 8 J, these graphs show selection of Marker 2 Target miRNAs that are highly expressed in Marker 1 EpCAM off-target tissues relative to Pancreatic Ductal Adenocarcinoma (PDAC) cells. Values are median reads per million (RPM). The low expression of these Target miRNAs in PDAC cells relative to potential off-target tissues suggest that adding these Complementary miRNA Sequences to Payload mRNA will improve tissue specific expression of the Payload mRNA
[0314] Fig. 8F shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-122-5p.
[0315] Fig. 8G shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-45 la.
[0316] Fig. 8H shows a box plot of EpCAM off-target tissues for PDAC for hsa-miR-142-5p.
[0317] Fig. 81 shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-126-5p.
[0318] Fig. 8 J shows a box plot of EpCAM off-target tissues for PDAC hsa-miR-378-3p.Table 3: Top down regulated PDAC Target miRNAs relative to EpCAM Marker 1 off- target healthy tissues*Values are median reads per million (RPM).*This table more clearly demonstrates that combinations of Target miRNAs will improve tissue selectivity in potential off-target tissues when targeting EpCAM as a Marker 1
[0319] Referring to the next figures, these graphs show selection of Marker 2 Target miRNAs that are expressed in Marker 1 MUC1 off-target tissues relative to Pancreatic Ductal Adenocarcinoma (PDAC) cells. Values are median reads per million (RPM). Since hypoglycosylated MUC1 is primarily cancer specific, MUC1 off-target tissues were selected based on where nanoparticles often accumulate (i.e. liver, spleen, lung and kidneys).
[0320] Fig. 8K shows a box plot of MUC1 off-target tissues for PDAC hsa-miR-122-5p.
[0321] Fig. 8L shows a box plot ofMUCl off-target tissues for PDAC hsa-miR-451a.
[0322] Fig. 8M shows a box plot ofMUCl off-target tissues for PDAC for hsa-miR-142-5p.
[0323] Fig. 8N shows a box plot ofMUCl off-target tissues for PDAC hsa-miR-126-5p.
[0324] Fig. 80 shows a box plot ofMUCl off-target tissues for PDAC hsa-miR-378a-3p.Fig. 8P shows that in the TCGA PDAC dataset, lower expression of miR-451a, miR-126-5p, miR-142-5p and miR-378a-3p is associated with a worse overall survival. These findings suggest that these miRNAs act as tumor suppressors in PDAC and further validates their use as TargetmiRNAs when targeting PDAC cells. Cholangiocarcinoma (CHOL) and Intrahepatic Cholangiocarcinoma (ICC) Tumor Subtype
[0325] The following graphs show selection of Marker 2 Target miRNAs when using EpCAM as a Marker 1 to target cholangiocarcinoma (CHOL) tumors, specifically the intrahepatic cholangiocarcinoma (ICC) tumor subtype. Values are median reads per million (RPM).
[0326] Fig. 8Q shows a box plot of EpCAM off-target tissues for ICC hsa-miR-45 la.
[0327] Fig. 8R shows a box plot of EpCAM off-target tissues for ICC hsa-miR-142-5p.
[0328] Fig. 8S shows a box plot of EpCAM off-target tissues for ICC hsa-miR-126-5p.
[0329] Fig. 8T shows a box plot of EpCAM off-target tissues for ICC hsa-miR-378-3p.
[0330] Fig. 8U shows survival plots indicating that lower expression of miR-45 la was associated with a worse survival in CHOL.Table 4: Top down regulated ICC Target miRNAs relative to EpCAM Marker 1 off-target healthy tissue^Values are median reads per million (RPM).Hepatocellular Carcinoma (HCC) Tumors
[0331] Figures 7G-7I shows selection of Marker 1 on hepatocellular carcinoma (HCC) tumors, specifically a subset of tumor with miR-122-5p expression less than 5,000 RPM (HCC 122 LowTable 5: Top down regulated HCC 122 Low Target miRNAs relative to EpCAM Marker 1 off- target healthy tissues*Values are median reads per million (RPM).
[0332] Example 3 - Creating a Nanoparticle With a Cell-Targeting Moiety Containing a Payload mRNA In one example, a cell-targeting moiety can be an aptamer. As shown in Fig. 1 B and 1C, stable thiol functionalized aptamers were synthesized as a capped species using standard oligonucleotide synthesis reagents, equipment and purification methods. Prior to the free thiol species was prepared via reduction of the disulfide capped aptamer, purified by dialysis and used to prepare the aptamer-nanoparticle conjugate. A DNA aptamer was attached to the surface of nanoparticle using the thiol-maleimide chemistry.
[0333] To prepare the aptamer-nanoparticle conjugate, a maleimide functionalized (e.g., PEG-Mal) lipid derivative was incorporated in the nanoparticle’s membranes during the nanoparticle preparation. A 5’ thiol functionalized DNA aptamer with a C6 carbon spacer and PEG18 linker was successfully attached to the surface of nanoparticle. Free thiol functionalized DNA aptamer was added to maleimide functionalized (PEG-Mal) lipid particles in phosphate buffered saline. The DNA aptamer surface conjugated nanoparticles were separated from unconjugated aptamer by size exclusion chromatography. The resulting particles were processed by standard nanoparticles preparation techniques. Standard analytical parameters show successful preparation of aptamer conjugation to particles while preserving the particle integrity and incorporation of mRNA equivalent the unmodified particle.
[0334] Any suitable linkers may be used based on the required spacing and facilitation of chemical conjugation reaction, allowing the aptamer sufficient space from surface of particle to interact with target on cell surface.
[0335] For example, any appropriate chemistry can be used to conjugate the marker 1 binding moiety to the PEG-lipid, including maleimide, amine and click chemistry. For conjugation reactions nanoparticle functionalization reagents can include lipid-PEG-maleimide, lipid-PEG-cysteine, lipid-PEG- N-Hydroxysuccinimide (NHS) ester, lipid-PEG-Carboxylic, Acid lipid-PEG-alkyne, PEG-dibenzocyclooctyne (DBCO), and lipid-PEG-azide. The binding moiety can be functionalized with an appropriate group to participate in the conjugation reaction with the functionalized lipid-PEG species. In some examples a thiol, amine or azide group is incorporated into the binding moiety. Other bioconjugation chemistry methods may also be applied
[0336] Marker 1 targeting moieties are selected based on their ability to interact with molecules that could be found on the surface or related to cancer cells. An optimal targeting moiety is one that would target the widest number of cancers and be selective over healthy tissue, or that would have suitable affinity and selectively for the desired target cells. An optimal target may facilitate nanoparticle uptake more efficiently compared to other cells and may be more desirable in certain embodiments. Table 6 represents a list of possible aptamers. Table 7 represents a list of possible antibodies.Table 6: Table of AptamersTable 7: Table of Antibodies
[0337] In certain embodiments, aptamers that target EpCAM can be applied. In certain embodiments, aptamers that target MUC1 can be applied. In certain embodiments, aptamers thattarget MSLN can be applied. In certain embodiments, aptamers that target CEA can be applied. In certain embodiments, aptamers that target EGFR can be applied. In certain embodiments, aptamers that target PD-L1 can be applied. In certain embodiments, aptamers that target CD 133 can be applied. In certain embodiments, aptamers that target PSMA can be applied. A desirable Marker 1 in cancer therapy is a molecule that is highly expressed on many types of carcinomas, e.g., including those of the colon, pancreas, stomach, lung, liver and bilde ducts. These targets are an effective marker for cancer stem cells, which are responsible for tumor growth and metastasis.
[0338] Exemplary structures of applicable aptamers are provided below in Table 8.Table 8: Table of Applicable Aptamers
[0339] Linkers, e.g., phosphate diester linkers were chosen based on the required spacing needed.
[0340] In certain embodiments, the cell -targeting moiety is attached to the nanoparticle by a linker. The linker can attach the cell-targeting moiety by maleimide, amine or click chemistry.
[0344] In certain embodiments, each of the first linker and the second linker can be a bivalent linker. In certain embodiments, a linker may represent a bond or a bivalent substituent group, and wherein X represents an optionally substituted hydrocarbon group, for example a monoacid or diacid lipid, or a salt thereof.
[0345] In some embodiments, the bivalent substituent group comprises: an alkylene group, optionally interrupted by a double bond, a triple bond, a carbonyl group, an oxycarbonyl group, an imino group, an alkylimino group, a sulfonyl group, an oxy group, a sulfide group, an ester bond, an amide bond, a carbonate bond or combinations thereof.X= aptamer3'-3'T - 3’ inverted dT base.
[0349] FIG. IB depicts an exemplary construct used in the novel cancer immunotherapy platform with an exemplary linker.
[0350] FIG. 1C depicts an exemplary construct used in the novel cancer immunotherapy platform with an exemplary disulfide linker. The disulfide linkers are designed to prevent the constructs from adhering to each other.Example 4 - Data for Synthetic and Endogenous Target miRNA mediated degradation of a Payload GFP mRNA
[0351] Cancer absence or selective loss of Target miRNA expressions allows for selective expression of Payload mRNA encoded proteins. These experiments show that one can predict functional Marker 2 Target miRNA across diverse different human cancer types for selective Payload mRNA expression. Synthetic addition of Target miRNAs were shown to drastically decrease expression of 4 test Payload GFP mRNAs within 4 different cancer cell lines. Endogenous Target miRNA levels in HEK293T and PANC-1 cells were shown to reduce GFP expression selectively on a Marker 2 Payload GFP mRNA.
[0352] The following materials and methods were used.
[0353] Cell culture: PANC-1, A549, HL-60, A673, HS-578T, and HEK293. All cells were cultured at 37°C under 5% CO2. PANC-1 and A673 cells were grown in DMEM, supplemented with 1% penicillin / streptomycin (pen / strep) and 10% fetal bovine serum (FBS). A549 cells were cultured in F-12K media supplemented with 1% pen / strep and 10% FBS. HS-578T cells were cultured in DMEM supplemented with 1% pen / strep, 10% FBS, and 0.01 mg / mL human insulin. HEK293 cells were cultured in DMEM supplemented with 1% pen / strep and 10% FBS.
[0354] LNP-SNA synthesis: Lipid nanoparticles (LNPs) were synthesized containing 50% ionizable lipid, 38.5% cholesterol, 10% DSPC, and 1.5% DMG-PEG2000. Particles were synthesized using the rapid ethanol dilution method where lipids into an aqueous solution of mRNA in 10 mM sodium citrate buffer at pH 4. Spherical Nucleic Acid (SNA) nanoparticles were synthesized using standard procedures.
[0355] Target miRNA transfection: Synthetic Target miRNA was transfected using Lipofectamine RNAi MAX.
[0356] Data was collected 24 hours after Target miRNA transfection. Particles and duplexes were added at 1 ug / mL Payload GFP mRNA.
[0357] Payload mRNA encoding green fluorescent protein (GFP) was synthesized with or without a Marker 2 Complementary miRNA Sequence for miRNA targeting. The Target miRNA medicated changes in expression were determined by measuring GFP fluorescence via flow cytometry.
[0358] LNP-SNA delivered Payload GFP mRNA containing a Marker 2 Complementary miRNA Sequence in the 3’UTR shows reduced GFP expression in the presence of the endogenous Target miRNA. Different human cancer cell lines with minimal expression of one or more Target miRNA were transfected with synthetic surrogates to restore expression of the lacking Target miRNA. Payload GFP mRNA with a Marker 2 Complementary miRNA Sequence was used to detect Target miRNA mediated expression changes. The following table shows cancer cell lines and corresponding Target miRNA deficiencies. As shown in the Figures 12A-12F, miRNA-Seq data can be used to determine Target miRNAs for tissue specific expression of Payload mRNA. These figures also show that Payload mRNA can be conditionally expressed by both synthetic and endogenous Target miRNAs.Table 9 - Target miRNA selections and their associated cell lines
[0359] Referring to FIG. 12A, this shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the pancreatic cancer cell line.
[0360] Referring to FIG. 12B, this shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the lung cancer cell line.
[0361] Referring to FIG. 12C, this shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the Ewing sarcoma cell line.
[0362] Referring to FIG. 12D, this shows synthetic Target miRNA mediated Payload GFP mRNA degradation in the breast cancer cell line.
[0363] Referring to FIG. 12E, this shows synthetic Target miRNA degradation of Payload GFP mRNA in PANC-1 cells at a cellular level.
[0364] Referring to FIG. 12F, this shows endogenous Target miRNA degradation of Payload GFP mRNA in HEK293 cells.
[0365] Referring to FIG. 13A, this shows Target miRNA hsa-miR-10a-5p expression in PANC-1. Validation of miRNA levels in PANC-1 cells was performed using quantitative PCR. Referring to FIG. 13B, this shows endogenous Target miRNA presence can regulate Payload GFP mRNA expression in PANC-1 Cells. It shows endogenous Target miRNA hsa-miR-10a-5p miRNA can repress Payload GFP mRNA with a Complementary hsa-miR-10a-5p Sequence. This demonstrates that Target miRNA can significantly reduce Payload mRNA. It is critical to evaluate endogenous Target miRNAs in cancer cells to make sure that Payload mRNA will not be degraded in those cells, allowing the intended therapeutic response to occur.Example 5 -Synthetic Complementary miRNA Spacer Sequence for Improved Payload mRNA Regulation
[0366] Synthetic Complementary miRNA spacer sequences can be designed for improved Payload mRNA regulation. In certain embodiments, a single Target miRNA may not be specific enough to induce Payload mRNA degradation in all off-target healthy tissues Therefore, using multiple Complementary miRNA Sequences may be necessary to increase selectivity of targeted cancer cells and avoid healthy and other off-target cells. In certain embodiments, more than one Complementary miRNA Sequence may be used to increase selectivity of the targeted cancer cells. In other words, the cells must be missing or have low expressions of all or effectively all Complementary miRNA Sequences for the Payload mRNA to be translated, and for the CustomProtein Sequence expressed. When using multiple Complementary miRNA Sequences, it is necessary to provide a spacer sequence between each Complementary miRNA Sequence.
[0367] In certain embodiments, using mRNA design tools and computational analysis, specific spacer sequences can be designed that surprisingly improve mRNA regulation. Spacer sequences that separate Complementary miRNA Sequences in the 3’ UTR may affect how Target miRNAs bind to the Payload mRNA. This synthetic sequence may improve degradation and or expression of the Payload mRNA in the desired tissue.
[0368] These novel specific spacer sequences are selected to: (i) prevent mRNA secondary structures which may affect its functionality, (ii) provide sufficient spacing to improve binding of the intended miRNA, and (iii) also avoid the creation of sequences that would result in binding sites for other unintended miRNAs.
[0369] The impact of mRNA secondary structures on miRNA binding are as follows: (1) impeded access: secondary structures can block miRNA binding sites, making them less accessible; (2) binding affinity: structures may alter the miRNA-mRNA interaction to either weaken or prevent binding; (3) regulation efficiency: structures can influence the effectiveness of of miRNA-mediated repression or degradation; and (4) structural unfolding: RNA-binding proteins or environmental factors can expose Target miRNA sites by unfolding mRNA structures.
[0370] The following spacer sequences are exemplary, for sequences between 6-40 nt long.Table 10: Spacer Types and Scores
[0371] The MFE score refers to the minimum free energy score that represents the thermodynamic stability of the most stable predicted structure. A lower or more negative number indicates a more stable structure. In RNA fold, the “MFE Frequency” refers to how often the predicted MFE structure appears in an ensemble of possible RNA structures.
[0372] Ensemble diversity is a measure of the structural variability of an RNA sequence by calculating the average base pair distance between all possible structures in the Boltzmann ensemble.
[0373] The centroid score refers to the free energy of the centroid structure within an ensemble of possible RNA secondary structures.
[0374] In this example, three 3’ UTRs with different miRNA spacer sequences were tested:• Alpha Globin 3’ UTR (natural 3’ UTR spacer sequences)• Stable 3’ UTR (synthetic spacer sequence; AATTGGGGGGAAACCCCCTTAA) (SEQ ID NO: 9)• Unstable 3’ UTR (synthetic spacer sequence; AACTTCCTAATCCTTCAA) (SEQ ID NO: 10)
[0375] Each 3’ UTR had 3 miR-45 la binding sites, 2 miR-122-5p binding sites and 1 miR- 378a-3p binding site
[0376] 1) HepG2 cells were seeded at a density of IxlO4cells / 0.32 cm2well and left overnight to adhere.
[0377] 2) The following day, cells were transfected with the indicated miRs (60 nM miR and0.3 pL lipofectamine per well) (miRNA Transfected), or treated with media only (No miRNA Transfected).
[0378] 3) Cells were incubated for 24 hours after miR / control exposure, before being transfected with luciferase-encoding Payload mRNA constructs (1 pg / mL Payload mRNA and 0.3 pL lipofectamine per well).
[0379] 4) After another 24-hour incubation, luciferase activity was quantified with the commercially available Bright-Glo assay system, following manufacturer instruction.
[0380] 5) Luciferase activity was expressed as a % of cells that were transfected with eachPayload mRNA construct only.
[0381] Referring to Fig. 15 A, HepG2 cells were previously identified to have low expression of miR-122-5p, miR-378a-3p and miR-45 la relative to primary hepatocytes. These absolutequantities of select miRNAs determined that the Payload FLuc mRNA wouldn’t experience substantial degradation in HepG2 cells.
[0382] Referring to Fig. 15B, Payload FLuc mRNAs with different 3 ’ UTR Complementary miRNA spacer sequences were transfected into HepG2 cells without synthetic Target miRNAs. These results show in the absence of synthetic Target miRNA, the 3’ UTR Complementary miRNA spacer sequences had little to zero effect on the translation of FLuc mRNA.
[0383] Referring to Fig. 15C, Payload FLuc mRNAs with different 3’ UTR Complementary miRNA spacer sequences were transfected into HepG2 cells with synthetic miRNAs transfected 24 hours earlier This shows unstable Complementary miRNA spacers significantly reduced FLuc translation vs. alpha-globin spacers in miR-378a-3p and miR-451a tests.
[0384] Referring to Fig. 15D, Delta FLuc was calculated by subtracting the mean “miRNA transfection” value from the mean “No miRNA transfection” value. This shows unstable Complementary miRNA spacers yielded the highest Delta FLuc response in 2 of 3 experiments. Suggesting that unstable Complementary miRNA spacer sequences are best for tissue specific expression of Payload mRNA.Example 6 - Creation of Homogenous Aptamer Particles
[0385] Referring to FIG. ID, this chart shows successful preparation of homogenous aptamer functionalized particles. Aptamer functionalized particles demonstrate expected changes in particle size and surface charge (zeta potential). Referring to FIG. IE, this gel demonstrates successful preparation of homogenous aptamer functionalized particles. Different molecular weight of PEG functionalized lipids was successfully prepared. PEG2K-Mal and PEG5K-MAL. E17.2 and E17.4 respectively. Particle integrity and functionality to load mRNA for delivery was measured by poly dispersity index (PDI) mRNA loading. The PDI values and mRNA loading are equivalent to non-aptamer functionalized particlesExample 7 - Conformation of Successful Aptamer Conjugation by Agarose Gel Electrophoresis Separation
[0386] Referring to FIG. IE, this figure shows highly purified particles and control reactions were analyzed by agarose gel. Lanes 1 and 10 are molecular weight reference standards. Lane 2 is mRNA alone as a size reference for comparison. Control reactions in Lanes 3, 4 and 7 show no products as expected. Lanes 5 and 6 show successful conjugation of the DNA aptamer to PEG - MAL of different molecular weights of PEG. Lanes 8 and 9 show no changes to conjugation ofthe DNA aptamer product after cysteine addition to block potentially unreacted PEG - MAL functionalized lipid, thereby demonstrating complete conjugation of DNA aptamer to all PEG - MAL functionalized lipid sites. This demonstrates that purified particles were capable of successfully incorporating desired mRNA for delivery. Moreover, only the purified particles show successful conjugation and successful loading of mRNA.Example 8 - Evaluation of Endogenous Canonical miRNA Binding to Complementary miRNA Sequences
[0387] Despite targeted cancer cells having low or absence expression of Target miRNAs, a Payload mRNA can still be degraded in the cell of interest due to canonical binding of endogenous miRNAs. To determine if select Complementary miRNA Sequences will induce endogenous canonical miRNA binding, an algorithm was created that scored potential canonical binding sites of miRNAs against a Target miRNA. In addition, the median expression of the endogenous miRNA within the cancer of interested was evaluated.
[0388] Fig. 5A depicts canonical miRNA binding sites, showing exemplary seed matches. It is suggested that if at least 6 nucleotides in a row in the seed region match the Complementary miRNA Sequence then there can be binding of the miRNA to the Payload mRNA and cause repression. However, this repression is not as impactful as if the whole seed region binds. Published studies have shown that increased complementary binding of the miRNA seed region increases the effect of mRNA repression. Where 6mers and off-set 6mers induce little to no mRNA repression. Referring to Figures 5B and 5C, miR-451a and miR-205-5p have little to no canonical miRNA binding in PDAC. With respect to PAAD, as shown in Fig. 5B, none of these miRNAs follow the canonical mRNA binding for hsa-miR-451a, suggesting that hsa-miR-451a is unlikely to be degraded by miRNAs in PAAD. Similarly, as shown in Fig. 5C, none of these miRNAs follow the canonical mRNA binding for hsa-miR-205-5p, suggesting that hsa-miR-205- 5p is unlikely to be degraded by miRNAs in PAAD. Referring to the table below, it was found that the Complementary miRNA Sequence miR-122-5p induces canonical binding of miR-574- 5p and miR-574-5p and that these miRNAs are expressed in PDAC.Table 11 - miR-122-5p will induce canonical binding of endogenous miRNAs in PDACPDAC miR-122-5p Median RPM = 0
[0389] Referring to the table below, it was found that altering miR-122-5p can reduce PDAC endogenous canonical miRNA binding to Complementary miRNA Sequences, for example, to overcome effects of endogenous canonical and non-canonical miRNA binding.Table 12 - Altering miR-122-5p pos 9 from a C to a G reduces canonical binding of endogenous miRNA in PDAC
[0390] Referring to the table below, it was found that miR-45 la practically has no endogenous canonical miRNA binding in PDAC. This finding adds support that miR-45 la is a potential Target miRNA in PDAC.Table 13 - miR-451a practically has no canonical endogenous miRNA binding in PDAC• PDAC mir-122-5p Median RPM = 153
[0391] Referring to the table below, it was found that miR-142-5p has practically no endogenous canonical miRNA binding in PDAC. This adds support that miR-142-5p is a potential Target miRNA for PDAC.Table 14 - miR-142-5p practically has no PDAC endogenous canonical miRNA binding• PDAC miR-142-5p Median RPM = 149
[0392] Referring to the table below, it was found that miR-126-5p has practically no endogenous canonical miRNA binding in PDAC. This finding adds support that miR-126-5p is a potential Target miRNA for PDAC.Table 15 - miR-126-5p practically has no PDAC canonical miRNA endogenous binding• PDAC mir-126-5p Median RPM = 246
[0393] .Referring to the table below, it was found that miR-215-5p has very high endogenous canonical miRNA binding in PDAC via miR-192-5p This finding suggests that addition of a Complementary miR-215-5p Sequence to Payload mRNA can negatively impact expression in PDAC cells.Table 16 - miR-215-5p has very high PDAC endogenous canonical miRNA binding in PDAC by miR-192-5pPDAC mir-215-5p Median RPM = 155
[0394] These examples show that adding Complementary miRNA Sequence(s) to Payload mRNA may cause unwanted degradation / repression in the target tissue due to canonical miRNA binding. Thus, in order to maximize Payload mRNA expression in the target tissue, potential binding of endogenous miRNAs to Complementary miRNA Sequence(s) can be evaluated.Example 9 - Evaluation of Endogenous Non-Canonical miRNA Binding to Complementary miRNA Sequences
[0395] As shown in Fig. 6, there are also thought to be non-canonical miRNA binding sites where 3’ compensatory, centered binding, and seedless binding can overcome the lack of binding of the seed region and cause repression of the Payload mRNA. Similar to the evaluation of canonical miRNA binding, an algorithm was created by the inventors to determine if selected Complementary miRNA Sequences incorporated into the Payload mRNA will cause endogenous non-canonical miRNAs binding in the target tissue.
[0396] Fig. 6 depicts non-canonical miRNA binding sites where only the 3' and / or centered regions can bind to the complementary mRNA region and cause repression. Another example of non-canonical miRNA binding is seedless binding. This is where all miRNA nucleotides except the seed region bind to Complementary mRNA.
[0397] Referring to the table below, it was observed that adding a Complementary miR-45 la Sequence to a Payload mRNA would unlikely induce repression of the Payload mRNA in PDAC.Table 17 - PDAC Nou-Canonical Binding is Unlikely for miR-451a
[0398] It was also observed that miR-122-5p, miR-142-5p (SEQ ID NO: 20), miR-126-5p (SEQ ID NO: 22) and miR-378a-3p (ACUGGACUUGGAGUCAGAAGGC; SEQ ID NO: 30) Complementary miRNA Sequences didn’t appear to induce non-canonical binding of endogenous PDAC miRNAs. However, this may not be the case in all cancer types and with all potential Target miRNAsExample 10 - Conditional Logic and Targeted Antigen Expression
[0399] In one example, the Payload mRNA is designed and inserted into an LNP. The LNP is then allowed to enter a cell.
[0400] In this example, and as shown in Fig. IF, the taRNA has the unique characteristic that both the replicase mRNA strand and the transreplicon mRNA strand both need to be present within the cell to express the protein of interest. The viral replicase proteins allow the printing press idea to function in a targeted manner. Within the delivered RNA, the genetic code to produce proteins transcribes RNA within the cytoplasm. However, these replicase proteins can only bind to RNA that have a specific sequence, which is not naturally found in humans.
[0401] Using the following conditional logic, the antigen printing press only happens if two conditions are true.Condition! = the miRNA conditionalized replicase mRNA with Complementary_miRNA_Sequencel in the 3’ UTR region Condition2 = the miRNA conditionalized transreplicon mRNA, with Complementary _miRNA_Sequence2 in the 3’ UTR regionCondition! is true if and only if the cell is absent the Target miRNAl that matches the Complementary miRNA Sequence 1Condi tion2 is true if and only if the cell is absent the Target_miRNA2 that matches the Complementary _miRNA_Sequence2.Conditions = Condition ! AND Condition2Conditions is true, if any only if, Conditionl AND Condition2 are true.
[0402] Referring to FIG. 1H, this depicts a flow chart of taRNA conditional logic such that the replicase and CPS transreplicon will be present in the same cell allowing RNA selfamplification to occur, if and only if both conditions are true. In this figure, “miRNA conditionalized replicase mRNA” is the same as a Payload mRNA with the replicase encoded in the mRNA coding sequence (Conditionl), and “miRNA conditionalized transreplicon” is the same as a Payload mRNA with the CPS transreplicon encoded in the mRNA coding sequence (Condition2). When Conditionl and Condition2 are true, both mRNA will be transcribed produce the replicon and the CPS transreplicon, which activates the self-amplified production of the encoded protein. In short, the miRNA provides conditionalized allowance of the underlying mRNA. If the replicase mRNA and transreplicon mRNA both “conditionally” appear together in the cell, then they interact with each other and the antigen printing press starts - i.e. Condition 3 is true. If not, then nothing happens, which is to be expected in a healthy cell.Example 11 - Data Demonstrating Sars-CoV-2 N Protein or Truncated Version as Payload mRNA
[0403] In one example, the CPS of a Payload mRNA can be a viral protein in which much of the human population has pre-existing immunity to. One possible protein is the Sars-CoV-2 N protein. This is because much of the human population was infected with Sars-CoV-2 during the COVID-19 pandemic. In addition, it would be ideal that the viral protein contains epitopes that could bind to a wide range of MCH Class I HLA allele types. Having epitopes that bind to numerous MHC Class I HLA allele types would allow the Payload mRNA to be effective across different populations. To more fully evaluate MHC Class I binding, the Immune Epitope Database (IEDB) was utilized.
[0404] Referring to Fig. 14A, an IEDB coverage calculation shows that Sars-CoV-2 N protein will bind to an MHC Class I HLA allele in about 99% of the world’s population. The average hit refers to the average number of epitope hits / HLA combinations recognized by thepopulation. The PC90 refers to the minimum number of epitope hits / HLA combinations recognized by 90% of the population.
[0405] Referring to Fig. 14B, shows protein domains for the Sars-CoV-2 N protein. The truncation of either the N-arm or C-tail is belived to reduce protein functionalite and increase safety. Here, a custom script was created to identify whether the N-arm or the C-tail was less immunogenic.
[0406] Referring to Fig. 14C, internal analysis identified that removing amino acids 374-419 (C-tail) has little effect on Sars-CoV-2 N protein immunogenicity. This finding suggests that the truncated Sars-CoV-2 may be used as a CPS in a paylaod mRNA with increased safety while maintaining an ability to elicit a pre-existing immune response. The table below shows that the Sars-Cov-2 N (nucleocapsid) protein was selected over other Sars-CoV-2 proteins based on its ability to elicit a CD8 T-cell responses vs CD4 T-cells responses, its medium length (amino acid length allows better nanoparticle packaging) ), known epitope count and wide coverage.
[0407] Referring to Fig. 14D, this data shows that Payload mRNAs encoding a measles N protein or a Sars-CoV-2 N protein delivered to cancer cells elicited an immune response in human derived T-cells. The Payload mRNAs herein did not have any Complementary miRNA Sequences. A two-sample t-test was used for statistics. In this example, two Payload mRNAs were synthesized. One payload encoded the measles N protein while the other payload encoded the Sars-CoV-2 N protein. A-375 cells were seeded into optical 96-well plates in Opti-MEM medium (5% serum, pen / strep) and allowed to adhere overnight. The next day, cells were transfected with eGFP mRNA (Miltenyi, #130-101-114), measles N protein mRNA, Sars-Cov-2 N protein mRNA or Lipofectamine reagent alone (Thermo, #LMRNA008) and incubated for a further 24 hours. Peripheral blood mononuclear cells (PBMCs) were exposed to transfected cells at a 10: 1 effectortarget ratio (based on initial densities, IxlO5cells / 0.32 cm2well), or peptidecontrols without tumour cells, PBMCs were incubated with each target for a total of 72 hours. At the point of PBMC exposure, all assay media were switched to RPMI 1640 with 20 U / mL IL-2 and 10 U / mL IL-7 (5% serum, pen / strep). Four hours before each incubation is complete, 10 pg / mL Brefeldin A, was added to each well. After the incubation, PBMCs were aspirated and inputted to FACS. Viability (Fixable NiR), CD45, CD3, CD4, CD8, CD45RA, CCR7, IFN-y (IC).
[0408] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
Claims
CLAIMSWhat is claimed is:
1. A method for marking cancer-cells comprising: applying a nanoparticle having a cell-targeting moiety and containing a Payload mRNA associated with a specific cancer, allowing the nanoparticle to enter a targeted cell through endosomal escape and release the Payload mRNA, wherein the Payload mRNA contains a Complementary miRNA Sequence(s), allowing the Payload mRNA to recruit Target miRNA(s) for tissue specific expression, and once binding occurs, degrading and / or repressing the Payload mRNA, and if no binding occurs, allowing the Payload mRNA to be translated to express a custom protein sequence (CPS).
2. The method of claim 1, wherein the nanoparticle is a lipid nanoparticle.
3. The method of claim 1, wherein the nanoparticle is a liposome.
4. The method of claim 1, wherein the nanoparticle is a polymer.
5. The method of claim 1, wherein the nanoparticle is a viral particle.
6. The method of claim 1, wherein the nanoparticle is a virus-like replicon particle.
7. The method of claim 1, wherein the cell-targeting moiety is a small molecule.
8. The method of claim 1, wherein the cell-targeting moiety is a functionalized aptamer.
9. The method of claim 1, wherein the cell-targeting moiety is a capped aptamer.
10. The method of claim 1, wherein the cell-targeting moiety is a DNA.
11. The method of claim 1, wherein the cell-targeting moiety is a RNA.
12. The method of claim 1, wherein the cell-targeting moiety is a peptide.
13. The method of claim 1, wherein the cell-targeting moiety is an antibody.
14. The method of claim 1, wherein the cell-targeting moiety is a small molecule.
15. The method of claim 1, wherein the cell-targeting moiety is attached to the surface of the nanoparticle using thiol-mal eimide chemistry.
16. The method of claim 2, wherein the cell-targeting moiety is the lipid nanoparticle’s preferential accumulation in a specific tissue.
17. The method of claim 1, wherein the following construct is applied to attach a celltargeting moiety to a nanoparticle26. The method of claim 1 wherein more than one Complementary miRNA Sequence is used to increase selectivity of the targeted cancer cells.
27. The method of claim 1 wherein the cells must be missing, or have low expressions of, all Target miRNAs for the Payload mRNA to be translated and Custom Protein Sequence expressed.
28. The method of claim 19, further comprising providing a spacer sequence between each of the Complementary miRNA Sequences.
29. The method of claim 1, wherein the Complementary miRNA spacer sequence is selected to: (i) prevent mRNA secondary structures which might affect its functionality, (ii) provide sufficient spacing to improve canonical binding of the intended miRNA, and (iii) prevent formation of new sequences that might create binding sites for other unintended miRNAs.
30. The method of claim 1, wherein the Complementary miRNA spacer sequence is derived from the alpha globin 3’ UTR31. The method of claim 1, wherein the Complementary miRNA spacer sequence produces stem loops in the 3’ UTR.
32. The method of claim 1, wherein the Complementary miRNA spacer sequence is AATTGGGGGGAAACCCCCTTAA (SEQ ID NO: 9).
33. The method of claim 1, wherein the Complementary miRNA spacer sequence reduces 3’ UTR mRNA folding.
34. The method of claim 1, wherein the Complementary miRNA spacer sequence is AACTTCCTAATCCTTCAA (SEQ ID NO: 10).
35. The method of claim 1 wherein the Payload mRNA contains a nucleic acid sequence coded into the 3’ untranslated region (UTR) that binds to the naturally occurring Target miRNA or Marker 2.
36. The method of claim 1 wherein the CPS is an engineered to be translated into a Universal Cancer Antigen (UCA).
37. The method of claim 1 wherein the CPS is an engineered to be a protein that enhances anti-tumor response or exerts a cell to undergo apoptosis.
38. The method of claim 1 wherein the Payload mRNA is translated into a spike protein, cytokine, or self-destruct facilitator), a known disease antigen, immune signaling protein, a protein that restores loss functionality to cancer cells.
39. The method of claim 1 wherein the Payload mRNA is translated TP53, SMAD4 or other protein that functions in cell destruction, immune response or activating other immune or cancer fighting mechanisms.
40. The method of claim 1 wherein the Payload mRNA is released into a cancer cell detected and marked with enhanced precision, allowing it to be attacked with a modality that corresponds to the CPS.
41. The method of claim 24 wherein Marker 2 is encoded in a viral expression payload.
42. The method of claim 1 wherein the targeted cell is pancreatic ductal adenocarcinoma (PDAC).
43. The method of claim 1, wherein adding Complementary miRNA Sequences complementary sites into the Payload mRNA induces degradation in PDAC due to endogenous Target miRNA expression.
44. The method of claim 32 wherein the endogenous miRNAs are miR-574-5p and miR- 542-3p45. The method of claim 1 wherein the Target miRNA sequence is AAACCGUUACCAUUACUGAGUU (SEQ ID NO: 16).
46. The method of claim 1 wherein the Target miRNA sequence is CAUAAAGUAGAAAGCACUACU (SEQ ID NO: 20).
47. The method of claim 1 wherein the Target miRNA sequence is CAUUAUUACUUUUGGUACGCG (SEQ ID NO: 22).
48. The method of claim 1 wherein the Target miRNA sequence is ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 30).
49. The method of claim 1 wherein the Target miRNA sequence is UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 11).
50. The method of claim 1 wherein the Target miRNA sequence is UGAGUGUGUGUGUGUGAGUGUGU (SEQ ID NO: 13).
51. The method of claim 1 wherein the Target miRNA sequence is UACCAUUAGAAGAGCUGGAAGA (SEQ ID NO: 17).
52. The method of claim 1 wherein the Target miRNA sequence is UCCAUUACACUACCCUGCCUCU (SEQ ID NO: 18).
53. The method of claim 1 wherein the Target miRNA sequence is AGGUUACCCGAGCAACUUUGCAU (SEQ ID NO: 19).
54. The method of claim 1 wherein the Target miRNA sequence is UGUGACAAUAGAGAUGAACAUG (SEQ ID NO: 12).
55. The method of claim 1 wherein the Target miRNA sequence is UGUGACAGAUUGAUAACUGAAA (SEQ ID NO: 14).
56. The method of claim 1 wherein the Target miRNA sequence is UAGUAGACCGUAUAGCGUACG (SEQ ID NO: 21).
57. The method of claim 1 wherein the Target miRNA sequence is UCUUUGGUUAUCUAGCUGUAUGA (SEQ ID NO: 23).
58. The method of claim 1 wherein the Target miRNA sequence is CUGACCUAUGAAUUGACAGCC (SEQ ID NO: 25).
59. The method of claim 1, wherein the cell-targeting moiety is attached to the nanoparticle by a maleimide, amine or click chemistry.
60. The method of claim 1, wherein the CPS is a universal cancer antigen (UCA).
61. The method of claim 2, wherein the UCA is a non-naturally occurring protein.
62. The method of claim 1, wherein the CPS is a known disease antigen.
63. The method of claim 1, wherein the CPS is coronavirus antigen, tetanus antigen, measles antigen, flu antigen, polio antigen, pertussis antigen, flu antigen, hepatitis, mumps antigen or a bacterial antigen.
64. The method of claim 1, wherein the miRNA binds to an Argonaute protein to form an RNA-induced silencing complex (RISC).
65. The method of claim 6 wherein the miRNA contains a seed sequence that guides the RISC to a complementary sequence on an mRNA strand in the cell.
66. The method of claim 1, wherein an Argonaute protein binds the miRNA and positions it in a conformation that facilitates target recognition by binding to a complementary sequence.
67. The method of claim 1, wherein the binding results in a full match.
68. The method of claim 1 , wherein the binding is partial binding.
69. The method of claim 1, wherein the binding contains a mismatch.
70. The method of claim 78, wherein the partial binding causes repression of the complementary RNA sequence.
71. The method of claim 1, wherein at least 6 consecutive nucleotides match the complementary mRNA sequence.
72. The method of claim 1, wherein the binding occurs in a non-canonical miRNA binding site.
73. The method of claim 1, wherein the binding occurs in a canonical miRNA binding site.
74. The method of claim 1, further comprising selecting an miRNA to ensure that the Target miRNA will bind to a 3’ UTR or 5’ UTR of the Payload mRNA.
75. The method of claim 1, further comprising selecting an miRNA to ensure that the Target miRNA will bind to a coding sequence region of the Payload mRNA76. The method of claim 1, further comprising selecting an miRNA to ensure that the Target miRNA will bind to a centered region of the Payload mRNA.
77. The method of claim 1, further comprising selecting an miRNA to ensure that the Target miRNA will bind to a seed region of the Payload mRNA.
78. The method of claim 1, wherein the expressed or translated Payload mRNA reduces tumorigenesis.
79. The method of claim 1, wherein the expressed or translated Payload mRNA reduces angiogenesis.
80. The method of claim 1, wherein the expressed or translated Payload mRNA activates an immune response.
81. The method of claim 1, wherein the expressed or translated Payload mRNA activates an effector cell response.
82. The method of claim 1, wherein the expressed or translated Payload mRNA activates a memory cell response.
83. The method of claim 1, wherein the expressed or translated Payload mRNA modulates a cytokine response.
84. The method of claim 11, wherein the expressed or translated Payload mRNA modulates an interferon response.
85. The method of claim 1 1, wherein the expressed or translated Payload mRNA modulates an interleukin response.
86. The method of claim 1, wherein the expressed or translated Payload mRNA binds to a bi-specific antibody that binds T-cells to ensure a more precise immune response.
87. The method of claim 1, wherein the Payload mRNA comprises a conventional mRNA.
88. The method of claim 1, wherein the Payload mRNA comprises a saRNA.
89. The method of claim 1, wherein the Payload mRNA comprises a taRNA.
90. The method of claim 1, wherein the Payload mRNA comprises a circRNA91. The method of claim 87, wherein binding results in degradation or repression of the Payload conventional mRNA.
92. The method of claim 87, wherein binding results in the allowance of the conventional mRNA.
93. The method of claim 88, wherein binding results in degradation or repression of the saRNA.
94. The method of claim 88, wherein binding results in the allowance of the saRNA.
95. The method of claim 89, wherein binding results in the degradation or repiession of the taRNA.
96. The method of claim 89, wherein binding results in the allowance of the taRNA.
97. The method of claim 90, wherein binding results in the degradation or repression of the circRNA.
98. The method of claim 90, wherein binding results in the allowance of the circRNA.
99. The method of claim 1, wherein the nanoparticle is applied in a multivalent immunotherapy.
100. The method of claim 1, wherein the Payload mRNA comprises a replicase mRNA and transreplicon mRNA.
101. The method of claim 1, wherein there are two nanoparticles with one comprising a replicase mRNA and the other comprising a transreplicon mRNA.
102. The method of claim 101, wherein the replicase mRNA and transreplicon mRNA appear together in the cell and activate antigen printing.
103. A composition for treating cancer comprising:a nanoparticle having cell-targeting moiety containing a Payload mRNA associated with a specific cancer, the Payload mRNA contains a Complementary miRNA Sequence(s) to recruit Target miRNA in healthy off target tissues and binding of the Target miRNA to the Payload mRNA Complementary miRNA Sequence results in either degradation or repression of the Payload mRNA, preventing translation of a Custom Protein Sequence.
104. The composition of claim 103, wherein the composition is administered intraperitoneally.
105. The composition of claim 103, wherein the composition is administered intratumorally.
106. The composition of claim 1103, wherein the composition is administered subcutaneously.
107. The composition of claim 103, wherein the composition is administered intramuscularly.
108. The composition of claim 103, wherein the composition is administered intradermally.
109. The composition of claim 103, wherein the composition is administered intravenously.
110. A method for marking cancer-cells comprising: applying a viral particle having a cell-targeting moiety expressing a Payload mRNA associated with a specific cancer, allowing the viral particle to enter a targeted cell and express the Payload mRNA, wherein the Payload mRNA contains a Complementary miRNA Sequence(s), allowing the Payload mRNA to recruit Target miRNA(s) for tissue specific expression, and once binding occurs, degrading and / or repressing the Payload mRNA, and if no binding occurs, allowing the Payload mRNA to be translated to express a custom protein sequence (CPS).