Buffer compositions for nucleic acid isolation for single tube polymerase chain reaction in column format and uses thereof
By using a one-step nucleic acid separation buffer composition and membrane filter kit, the nucleic acid separation process is simplified, solving the problems of complex steps and equipment dependence in existing technologies. This enables rapid and accurate nucleic acid separation and PCR reaction, making it suitable for on-site diagnosis.
Patent Information
- Application Number
- CN202180030392.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-01-15
- Filing Date
- 2021-10-20
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2041-10-20
AI Technical Summary
Existing column-based nucleic acid separation methods are complex, require various devices and tools, are time-consuming and labor-intensive, and are difficult to perform rapid nucleic acid extraction and PCR reactions in non-laboratory environments.
A one-step nucleic acid separation buffer composition comprising ethanol, sodium dodecyl sulfate, sodium chloride, ethylenediaminetetraacetic acid, and tris(hydroxymethyl)aminomethane hydrochloride has been developed. This nucleic acid separation kit, combined with a membrane filter, enables direct nucleic acid separation and PCR reaction in a single tube, simplifying the process to a single step.
It simplifies the nucleic acid separation process, reduces equipment requirements, shortens the time, reduces the risk of nucleic acid damage and contamination, and improves the feasibility of rapid on-site diagnosis.
Smart Images

Figure CN115667508B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a nucleic acid isolation buffer composition for rapid and easy isolation of nucleic acids, a nucleic acid isolation kit containing the same, and a nucleic acid isolation method, featuring the technical characteristic of enabling column-based one-tube polymerase chain reaction (PCR). Background Technology
[0002] Typically, in order to perform various disease diagnoses, examinations of genetically modified plants, etc., a step of refining nucleic acids from samples such as tissues, blood, hair roots, cells, plants, and strains suitable for the purpose of the examination will be performed first.
[0003] Rapid and efficient methods for isolating nucleic acids from biological substances are particularly important in the diagnostic process. Effective and reproducible methods for selectively isolating nucleic acids from multiple substances contained in cell lysis solutions have been the subject of much research.
[0004] Commonly used nucleic acid purification methods include the following steps: performing a pretreatment process in which the sampled sample is cultured in a lysis buffer for a specified time to disrupt the cell wall and cell membrane, thereby exposing the nucleic acid for lysis; and then removing the impurities that have been disrupted.
[0005] More specifically, after pretreatment by placing the sample in lysis buffer and incubating, it is fed into a purification column equipped with a membrane for nucleic acid binding. Nucleic acids are bound to the inner membrane of the purification column by alternating centrifugation and washing steps on the column containing the pretreated nucleic acid sample. Pure nucleic acids are then separated by performing a drying step using the membrane bound to the nucleic acids and by separating the nucleic acids from the membrane using TE buffer, elution buffer, and water.
[0006] Therefore, existing column-based nucleic acid separation methods include pretreatment, centrifugation, washing, drying, and gene isolation steps. This requires various devices such as pretreatment buffers, centrifuges, drying devices, and separation buffers, as well as tools like micropipes. Since sample movement is necessary at each step, significant time and manpower are required. Furthermore, the membranes binding to nucleic acids and the multiple washing steps for removing impurities also contribute to the increased time. Moreover, to use the obtained nucleic acids for polymerase chain reaction (PCR), extremely small μl units of nucleic acid sample must be obtained using specific tools (micropipes), making it difficult to perform nucleic acid extraction and subsequent PCR outside of a laboratory setting.
[0007] Because column-based nucleic acid separation methods require low operator proficiency, they are highly practical. Therefore, it is crucial to find solutions to the problems mentioned above and achieve practical applications.
[0008] On the other hand, in the past 20 years, humanity has experienced viral infectious diseases such as SARS coronavirus (SARS-CoV, Severe acute respiratory syndrome-Coronavirus (2002-2003)) and H1N1 influenza virus (2009), which caused severe respiratory syndromes. More recently, in 2012 and 2015, Middle East Respiratory Syndrome Coronavirus (MERS) caused regional epidemics in Saudi Arabia and South Korea.
[0009] In particular, on December 31, 2019, the novel coronavirus pneumonia (2019-nCoV; COVID-19), first reported by the World Health Organization (WHO), broke out. This viral infectious disease caused a rapid and sustained increase in the number of patients due to its extremely rapid spread, resulting in a very deadly disaster.
[0010] Therefore, rapid on-site diagnosis is particularly important, but existing column-based nucleic acid separation techniques have the problems mentioned above, resulting in poor on-site utilization. A rapid and simple nucleic acid separation technique that can improve these problems is needed. Summary of the Invention
[0011] Technical issues
[0012] The inventors have prepared a novel nucleic acid separation buffer composition for separating nucleic acids and a column-type nucleic acid separation kit containing a membrane filter thereof. When performing a one-tube polymerase chain reaction (PCR) directly using the composition or performing a PCR using a membrane filter with nucleic acids immobilized separately, it was confirmed that nucleic acids can be rapidly and accurately separated from a variety of samples. Thus, a nucleic acid separation technology that does not require separate centrifugation, washing, and drying steps was developed, thus completing the present invention.
[0013] Therefore, one object of the present invention is to provide a buffer composition for one-step nucleic acid separation that can be used in column-based single-tube polymerase chain reaction (PCR).
[0014] Another object of the present invention is to provide a one-step nucleic acid isolation kit.
[0015] Another object of the present invention is to provide a method for isolating nucleic acids from a sample.
[0016] Another object of the present invention is to provide a method for amplifying nucleic acids.
[0017] Technical solution
[0018] To achieve the above objectives, the present invention provides a one-step nucleic acid separation buffer composition comprising ethanol, sodium dodecyl sulfate (SDS), sodium chloride (NaCl), ethylenediaminetetraacetic acid (EDTA), and tris-hydroxymethylaminomethane hydrochloride (Tris-HCl).
[0019] Furthermore, in order to achieve the above-mentioned objective, the present invention provides a one-step nucleic acid isolation kit comprising the nucleic acid isolation buffer composition of the present invention, including a column fitted with a membrane filter.
[0020] Furthermore, in order to achieve the aforementioned other objective, the present invention provides a method for isolating nucleic acids from a sample, which is performed using the nucleic acid isolation kit of the present invention.
[0021] Furthermore, to achieve the above objective, the present invention provides a method for amplifying nucleic acids, which includes the step of performing polymerase chain reaction (PCR) using nucleic acids isolated by the method of the present invention as templates.
[0022] The effects of the invention
[0023] The nucleic acid separation buffer composition, nucleic acid separation kit containing a membrane filter, and nucleic acid separation method of the present invention enable rapid and accurate one-step separation of nucleic acids from a variety of samples. In particular, they can be directly used for polymerase chain reaction (PCR) by placing a column containing a membrane filter with immobilized nucleic acids into a polymerase chain reaction (PCR) mixture without a separate elution step. Existing column-based nucleic acid separation methods require multiple devices and tools due to their complexity, resulting in significant time, financial, and human costs. Furthermore, there are concerns that the separated nucleic acids may be damaged or contaminated during each step. In contrast, since the nucleic acid separation composition, kit, and separation method of the present invention are applicable to column-based single-tube polymerase chain reaction (PCR) methods, no special equipment is required. This allows for simple and rapid nucleic acid separation with minimal risk of damage or contamination, and is available at a low cost. Furthermore, the membrane filter with nucleic acid immobilized can be separated from the column and placed into a separate tube to perform polymerase chain reaction (PCR) or reverse transcription polymerase chain reaction (RT-PCR). It can be used for a variety of polymerase chain reactions (PCR), thus having high utilization rate and can be effectively applied to rapid diagnosis on site. Attached Figure Description
[0024] Figure 1 Part A of the diagram illustrates the process of performing polymerase chain reaction (PCR) (including isothermal polymerase chain reaction (PCR), conventional polymerase chain reaction (PCR), or reverse transcription polymerase chain reaction (RT-PCR)) directly using the nucleic acid isolation buffer composition of the present invention and a syringe equipped with a membrane filter, with the isolated nucleic acids immobilized in the membrane filter. Figure 1 Part B of the diagram illustrates the process of separating the membrane from which the above-mentioned nucleic acids are immobilized by the column, extracting the nucleic acids with the elution solution, and then performing polymerase chain reaction (PCR) (including isothermal polymerase chain reaction (PCR), conventional polymerase chain reaction (PCR), or reverse transcription polymerase chain reaction (RT-PCR)).
[0025] Figure 2 The figure shows the optimal concentrations of sodium dodecyl sulfate (SDS) and ethanol (EtOH) in a nucleic acid separation method that uses the nucleic acid-immobilized membrane filter directly for polymerase chain reaction (PCR) without elution, utilizing the nucleic acid separation buffer composition of the present invention.
[0026] Figure 3A graph confirming the appropriate pore size of the membrane filter in relation to the suitability of the nucleic acid separation buffer composition of the present invention and the commercial membrane filter.
[0027] Figure 4 Figures illustrating the suitability of the nucleic acid separation buffer composition and silica membrane filter of the present invention.
[0028] Figure 5 Figures illustrating the suitability of the nucleic acid separation buffer composition and glass microfiber filter of the present invention.
[0029] Figure 6 The figure shows a method for confirming whether genomic deoxyribonucleic acid (gDNA) is immobilized on the glass fiber filter after separating nucleic acids using the nucleic acid separation buffer composition of the present invention and a syringe equipped with a glass fiber filter.
[0030] Figure 7 A diagram illustrating the optimal size of the glass fiber filter described above for polymerase chain reaction (PCR) in relation to the application of the nucleic acid separation buffer composition and glass fiber filter of the present invention.
[0031] Figure 8 This is a graph illustrating the sensitivity of a polymerase chain reaction (PCR) in which nucleic acids, which are immobilized by a glass fiber filter that has been isolated in one step using the nucleic acid separation buffer composition of the present invention, are used to confirm the amount of genomic deoxyribonucleic acid (gDNA).
[0032] Figure 9 A graph was generated to confirm the sensitivity based on the number of cells that allow nucleic acids to be isolated in a one-step polymerase chain reaction (PCR) using a glass fiber filter in which nucleic acids, which are immobilized by the nucleic acid separation buffer composition of the present invention, are used.
[0033] Figure 10 This figure shows the efficiency of bacterial genomic gDNA separation in a polymerase chain reaction (PCR) using a glass fiber filter in which nucleic acids, which are immobilized and separated in a one-step manner using the nucleic acid separation buffer composition of the present invention, are employed.
[0034] Figure 11 A graph showing the pH-based ribonucleic acid (RNA) separation efficiency in a polymerase chain reaction (PCR) using a glass fiber filter in which nucleic acids, which are immobilized and separated in a one-step manner using the nucleic acid separation buffer composition of the present invention, are employed.
[0035] Figure 12 The figure shows the pH-based polymerase chain reaction (PCR) in which a glass fiber filter in which nucleic acids are immobilized using the nucleic acid separation buffer composition of the present invention, excluding the elution step, is directly used to confirm the PCR. Detailed Implementation
[0036] The present invention will now be described in detail.
[0037] The present invention provides a one-step nucleic acid separation buffer composition comprising ethanol, sodium dodecyl sulfate (SDS), sodium chloride (NaCl), ethylenediaminetetraacetic acid (EDTA), and tris-hydroxymethylaminomethane hydrochloride (Tris-HCl).
[0038] The technical feature of the nucleic acid separation buffer composition of the present invention is that it separates nucleic acids in a one-step process using a column-based single-tube polymerase chain reaction (PCR), with the entire process from nucleic acid separation to PCR taking place in a single tube. The purpose of this invention is to solve several problems in existing column-based nucleic acid separation methods, namely, the complexity of the separation method due to the need for multiple solutions, the requirement for additional equipment, and the excessive waste of time, resources, and manpower.
[0039] In particular, in methods for isolating genomic deoxyribonucleic acid (gDNA), large amounts of salt (such as NaCl) and ethanol (EtOH) are required for cell lysis and binding between the membrane filter and the gDNA. These salts and ethanol can potentially affect the polymerase chain reaction (PCR) results. Therefore, when using the nucleic acid isolation buffer composition of the present invention to isolate nucleic acids in a one-step process and then directly performing PCR using a membrane filter with the isolated nucleic acids immobilized, a combination that minimizes the influence of the salts and ethanol (EtOH) filtered from the membrane filter on the PCR results is crucial, as there is no precise separation step using an elution solution or a separate washing step.
[0040] According to an embodiment of the present invention, in a one-step deoxyribonucleic acid (DNA) separation using the composition of the present invention, the optimal conditions for the above-mentioned sodium dodecyl sulfate (SDS) and ethanol (EtOH) were confirmed, and it was confirmed that the composition containing less than 50% (v / v) ethanol (EtOH) and less than 1% (w / v) sodium dodecyl sulfate (SDS) can excellently separate nucleic acids.
[0041] Therefore, in the one-step nucleic acid separation buffer composition of the present invention, the ethanol may be 10% (v / v) to 50% (v / v), 10% (v / v) to 40% (v / v), 10% (v / v) to 30% (v / v), 10% (v / v) to 20% (v / v), 20% (v / v) to 50% (v / v), 20% (v / v) to 40% (v / v), 20% (v / v) to 30% (v / v), 30% (v / v) to 50% (v / v), 30% (v / v) to 40% (v / v), or 40% (v / v) to 50% (v / v), more preferably, 20% (v / v) to 50% (v / v). If the concentration of ethanol exceeds 50% (v / v), although partial separation of genomic deoxyribonucleic acid (gDNA) can be achieved, crystallization of sodium chloride (NaCl) will occur when the buffer is stored at room temperature.
[0042] Furthermore, the aforementioned sodium dodecyl sulfate (SDS) may contain 0.1% (w / v) to 0.9% (w / v), 0.1% (w / v) to 0.8% (w / v), 0.1% (w / v) to 0.7% (w / v), 0.1% (w / v) to 0.6% (w / v), 0.1% (w / v) to 0.5% (w / v), 0.1% (w / v) to 0.4% (w / v), 0.1% (w / v) to 0.3% (w / v), 0.1% (w / v) to 0.2% (w / v), and 0.2% (w / v) to 0.9% (w / v). ), 0.2% (w / v) to 0.8% (w / v), 0.2% (w / v) to 0.7% (w / v), 0.2% (w / v) to 0.6% (w / v), 0.2% (w / v) to 0.5% (w / v), 0.2% (w / v) to 0.4% (w / v), 0.2% (w / v) to 0.3% (w / v), 0.3% (w / v) to 0.9% (w / v), 0.3% (w / v) to 0.8% (w / v), 0.3% (w / v) to 0.7% (w / v), 0.3% (w / v) to 0.7% (w / v), 0.3% (w / v) to 0.8% (w / v), 0.3% (w / v) to 0.7% (w / v), 0.3% (w / v) to 0.8% (w / v), 0.3% (w / v) to 0.7% (w / v), 0.3% (w / v) to 0.8% (w / v), 0.2% (w / v) to 0.8% (w / v), 0.2% (w / v) to 0.7% (w / v), 0.3 ...2% (w / v) to 0.6% (w / v), 0.2% 0.6% (w / v), 0.3% (w / v) to 0.5% (w / v), 0.3% (w / v) to 0.4% (w / v), 0.4% (w / v) to 0.9% (w / v), 0.4% (w / v) to 0.8% (w / v), 0.4% (w / v) to 0.7% (w / v), 0.4% (w / v) to 0.6% (w / v), 0.4% (w / v) to 0.5% (w / v), 0.5% (w / v) to 0.9% (w / v), 0.5% (w / v) to 0.8% (w / v) ), 0.5% (w / v) to 0.7% (w / v), 0.5% (w / v) to 0.6% (w / v), 0.6% (w / v) to 0.9% (w / v), 0.6% (w / v) to 0.8% (w / v), 0.6% (w / v) to 0.7% (w / v), 0.7% (w / v) to 0.9% (w / v), 0.7% (w / v) to 0.8% (w / v) or 0.8% (w / v) to 0.9% (w / v), more preferably, may contain 0.1% (w / v) to 0.5% (w / v).
[0043] The aforementioned sodium chloride (NaCl) may contain 0.1M to 1M, 0.1M to 0.9M, 0.1M to 0.8M, 0.1M to 0.7M, 0.1M to 0.6M, 0.1M to 0.5M, 0.1M to 0.4M, 0.1M to 0.3M, 0.1M to 0.2M, 0.2M to 1M, 0.2M to 0.9M, 0.2M to 0.8M, 0.2M to 0.7M, 0.2M to 0.6M, 0.2M to 0.5M, 0.2M to 0.4M, 0.2M to 0.3M, 0.3M to 1M, 0.3M to 0.9M, 0.3M to 0.8M, 0.3M to 0.7M, 0.3M to 0.6M, 0... 0.3M to 0.5M, 0.3M to 0.4M, 0.4M to 1M, 0.4M to 0.9M, 0.4M to 0.8M, 0.4M to 0.7M, 0.4M to 0.6M, 0.4M to 0.5M, 0.5M to 1M, 0.5M to 0.9M, 0.5M to 0.8M, 0.5M to 0.7M, 0.5M to 0.6M, 0.6M to 1M, 0.6M to 0.9M, 0.6M to 0.8M, 0.6M to 0.7M, 0.7M to 1M, 0.7M to 0.9M, 0.7M to 0.8M, 0.8M to 1M, 0.8M to 0.9M, or 0.9M to 1M, more preferably, may include 0.5M to 1M.
[0044] The ethylenediaminetetraacetic acid (EDTA) may contain 1 mM to 100 mM, and the tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) may contain 1 mM to 50 mM.
[0045] As a preferred example of the one-step nucleic acid isolation buffer composition of the present invention, it may contain 20% (v / v) to 50% (v / v) ethanol, 0.1% (w / v) to 0.5% (w / v) sodium dodecyl sulfate (SDS), 0.5M to 1M sodium chloride (NaCl), 1mM to 100mM ethylenediaminetetraacetic acid (EDTA), and 1mM to 50mM tris-hydroxymethylaminomethane hydrochloride (Tris-HCl).
[0046] Furthermore, preferably, relative to 100 parts by weight of the buffer composition, the buffer composition may contain 1 to 5 parts by weight of 20% (v / v) to 50% (v / v) ethanol (Ethanol), 1 to 5 parts by weight of 0.1% (w / v) to 0.5% (w / v) sodium dodecyl sulfate (SDS), 2.5 to 10 parts by weight of 0.5M to 1M sodium chloride (NaCl), and 1 to 5 parts by weight of 1mM to 100mM ethylenediaminetetraacetic acid (EDTA). More preferably, relative to 100 parts by weight of the buffer composition, the buffer composition may contain 2.5 parts by weight of 20% (v / v) to 50% (v / v) ethanol, 2.5 parts by weight of 0.1% (w / v) to 0.5% (w / v) sodium dodecyl sulfate (SDS), 5 parts by weight of 0.5M to 1M sodium chloride (NaCl), 2.5 parts by weight of 1mM to 100mM ethylenediaminetetraacetic acid (EDTA), and 2.5 parts by weight of 1mM to 50mM tris-hydroxymethylaminomethane hydrochloride (Tris-HCl).
[0047] In one embodiment of the present invention, as a more preferred example, an aqueous solution comprising 50% (v / v) ethanol (Ethanol), 0.25% (w / v) sodium dodecyl sulfate (SDS), 0.25M sodium chloride (NaCl), 12.5mM ethylenediaminetetraacetic acid (EDTA), and 25mM tris-hydroxymethylaminomethane hydrochloride (Tris-HCl) was prepared.
[0048] In the case of separating genomic deoxyribonucleic acid (gDNA) using the nucleic acid separation buffer composition of the present invention, preferably, the above-mentioned tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) is at pH 8.
[0049] Furthermore, according to an example of the present invention, in the case of separating total RNA using the nucleic acid separation buffer composition of the present invention, it was confirmed that it is preferred to perform the separation at pH 4 to pH 7.
[0050] Therefore, when using the nucleic acid separation buffer composition of the present invention to separate total ribonucleic acid (RNA), the pH of the above-mentioned tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) is preferably pH 4 to pH 7.
[0051] Furthermore, the present invention provides a one-step nucleic acid separation kit comprising the one-step nucleic acid separation buffer composition of the present invention and including a column fitted with a membrane filter.
[0052] Furthermore, the one-step nucleic acid isolation kit of the present invention can be configured such that after filtering the solution with a membrane filter by applying pressure to the upper part of the column, the filtrate is removed from the lower part; more preferably, it is in the form of a syringe. When the above-described kit is manufactured in the form of a syringe, since separate tools such as centrifuges are not required, it has the advantage of allowing for direct on-site testing in a portable manner.
[0053] The membrane filter described above can be selected from the group consisting of polyvinylidene fluoride (PVDF) filter, nylon filter, cellulose nitrate filter, paper filter, glass fiber filter, and silica filter. In the following examples, it was confirmed that the one-step nucleic acid separation buffer composition of the present invention is highly compatible with each of the above-mentioned membrane filters.
[0054] According to the findings confirmed in one embodiment of the present invention, in deoxyribonucleic acid (DNA) separation performed using the nucleic acid separation buffer composition of the present invention and a commercial membrane filter made of polyvinylidene fluoride (PVDF), the filter with a pore size of 0.1 μm was found to exhibit the highest DNA separation efficiency.
[0055] On the other hand, negatively charged membrane filters such as polyvinylidene fluoride (PVDF) membranes, silica membranes, and glass fiber membrane filters require a large amount of salt (0.1–1 M NaCl) as an intermediate medium for the positive charge in order to capture negatively charged genomic deoxyribonucleic acid (gDNA). Therefore, if a polymerase chain reaction (PCR) reaction is performed after adding a polymerase chain reaction (PCR) reaction mixture to a glass fiber filter that captures genomic deoxyribonucleic acid (gDNA) without a separate purification step, the sodium chloride (NaCl) filtered from the glass fiber filter may hinder the PCR reaction. In other embodiments of the present invention, the optimal size of the glass fiber filter was determined during application with the nucleic acid separation buffer composition of the present invention. The results showed that the optimal size of the glass fiber filter for a total volume of 50 μL was determined to be 2 × 2 mm. 2 The following is based on 0.25M sodium chloride (NaCl).
[0056] The aforementioned nucleic acids can be one or more selected from the group consisting of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and peptide nucleic acid (PNA).
[0057] Furthermore, the present invention provides a method for isolating nucleic acids from a sample using the nucleic acid isolation kit of the present invention.
[0058] Furthermore, the present invention provides a method for amplifying nucleic acids, which includes the step of using nucleic acids isolated by the nucleic acid isolation method of the present invention as a template to perform polymerase chain reaction (PCR).
[0059] More specifically, the above method may include the following steps: lysing the sample by immersing it in the nucleic acid separation buffer of the present invention; incubating the lysed sample solution at room temperature; transferring the lysed sample solution to a column equipped with a membrane filter; and immobilizing the nucleic acid on the filter by applying pressure to the column and removing the filtrate. Alternatively, the above method may include the following steps: lysing the sample by immersing it in the nucleic acid separation buffer of the present invention; incubating the lysed sample solution at room temperature; transferring the lysed sample solution to a column equipped with a membrane filter; immobilizing the nucleic acid on the filter by applying pressure to the column and removing the filtrate; introducing an elution solution into the column where the nucleic acid is immobilized and passing it through the membrane filter; and obtaining the elution solution.
[0060] In the nucleic acid amplification method of the present invention, the nucleic acid as a template can be utilized either in a filtered form in which the nucleic acid is directly immobilized or in a form contained in an elution solution.
[0061] In this case, if the aforementioned nucleic acid-immobilized filter is used directly, such as Figure 1 Parts A and B of the formula allow for either direct addition of a polymerase chain reaction (PCR) reaction mixture to the column itself, which houses the nucleic acid-immobilized filter, to perform a PCR reaction, or the reaction can be performed by separating the nucleic acid-immobilized filter, transferring it to a separate tube, and then reacting it with the PCR reaction mixture. In this case, the nucleic acid-immobilized filter can be cut to an appropriate size.
[0062] In this case, the aforementioned polymerase chain reaction (PCR) is a method for confirming the isolated nucleic acid. Any method known in the art can be used as long as it can confirm the isolated nucleic acid. Preferably, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and isothermal amplification polymerase chain reaction (PCR) can be used, but it is not limited to these.
[0063] The use of the elution buffer is not limited as long as it is a well-known elution buffer in the art. Preferably, it can be one of the group consisting of distilled water, TE buffer (Ten E one buffer, TE buffer), and mixtures thereof, but is not limited thereto. Moreover, the elution buffer known in the art can be TE buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA) or elution buffer (10 mM Tris-HCl, pH 7.5–8.5), but is not limited thereto.
[0064] In the nucleic acid isolation method of the present invention, the above-mentioned incubation step, which is to cause cell lysis, can be performed for 2 to 10 minutes, more preferably 5 minutes.
[0065] The above culture can be performed by immersing the sample in 1 ml to 5 ml of the nucleic acid separation buffer of the present invention and shaking and mixing, but is not limited thereto.
[0066] Furthermore, the present invention is characterized in that the above-mentioned samples are biological samples or non-biological samples.
[0067] The biological samples mentioned above are samples containing deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), and can be selected from nasal aspirate, bronchial aspirate, organ secretions, sputum, tears, saliva, cells, cell extracts, whole blood, plasma, serum, mucus, nasal washes, urine, semen, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid, leukocytes, peripheral blood mononuclear cells, erythrocyte sedimentation rate (ESR) buffy coat, glandular fluid, pancreatic fluid, lymph, pleural effusion, etc. It is one or more of the following groups, but not limited to: nipple aspirate, synovial fluid, joint aspirate, and cerebrospinal fluid.
[0068] Moreover, the present invention is characterized in that the above-mentioned non-biological sample contains chemically synthesized peptide nucleic acid (PNA).
[0069] The technical features of the nucleic acid separation buffer composition, the nucleic acid separation kit with a membrane filter containing the present invention, and the nucleic acid separation method are that nucleic acids can be effectively separated from a variety of samples in one step, and in particular, the nucleic acid-fixed membrane filter can be used directly for polymerase chain reaction (PCR) without a separate elution step.
[0070] This significantly improves upon existing column-based nucleic acid separation methods, which suffer from excessive time, financial and human costs, as well as the risk of damaged or contaminated nucleic acids. The aim is to rapidly separate nucleic acids for on-site rapid diagnosis.
[0071] As long as they do not contradict each other, the contents of the present invention described above are adopted in the same way, and the contents implemented by those skilled in the art by applying appropriate modifications are also within the scope of the present invention.
[0072] The present invention will now be described in detail through embodiments, but the scope of the present invention is not limited to the following embodiments.
[0073] Example 1. Preparation of a buffer composition for nucleic acid isolation
[0074] As a preferred embodiment of the buffer composition for isolating nucleic acids, the inventors prepared an aqueous solution containing, based on 100 ml of the buffer composition, 2.5 ml of 50% (v / v) ethanol (Ethanol), 2.5 ml of 0.25% (w / v) sodium dodecyl sulfate (SDS), 5 ml of 0.25 M sodium chloride (NaCl), 2.5 ml of 12.5 mM ethylenediaminetetraacetic acid (EDTA), and 2.5 ml of 25 mM tris-hydroxymethylaminomethane hydrochloride (Tris-HCl).
[0075] On the other hand, existing nucleic acid isolation methods involve complex processes such as pretreatment, centrifugation, washing, drying, and gene isolation. Each step requires lysis buffer, binding buffer, washing buffer, elution buffer, and specialized equipment like centrifuges, consuming significant time, money, and manpower. Furthermore, there are concerns about partial damage or contamination of the isolated nucleic acids during each step. Moreover, to additionally utilize the isolated nucleic acids for polymerase chain reaction (PCR), micropipettes and pipette tips are needed to extract very small amounts (1–5 μl) of the isolated deoxyribonucleic acid (DNA), making on-site operation difficult without the necessary tools. In contrast, the nucleic acid separation buffer composition of the present invention prepared in Example 1 above is a composition in which all structural elements are mixed together, which can separate nucleic acids in one step, enabling rapid separation. Moreover, there is little concern about damage or contamination of the separated nucleic acids, and no additional equipment is required in this regard. Therefore, real-time detection can be performed more conveniently and quickly on site.
[0076] Example 2. Nucleic acid separation method using a nucleic acid separation buffer composition
[0077] 2-1. Nucleic acid isolation methods excluding elution steps
[0078] In the nucleic acid separation method of the present invention, the nucleic acid-fixed filter can be directly used in polymerase chain reaction (PCR) to directly confirm the results without a separate elution step.
[0079] First, sample collection was performed using cotton swabs. After immersing the sample in 2 ml of the nucleic acid separation buffer composition prepared in Example 1 above and shaking to mix, it was incubated at room temperature for 5 minutes to achieve cell lysis.
[0080] After the culture was completed, the solution was transferred to a syringe equipped with a membrane filter, and pressure was slowly applied to force the solution through the membrane filter, thereby immobilizing the nucleic acids and removing the filtrate. Subsequently, polymerase chain reaction (PCR) was performed using the membrane filter with the immobilized nucleic acids.
[0081] More specifically, a polymerase chain reaction (PCR) reaction mixture (25 μl of 2X i-Taq™ PCR mix, 1 μl of 10 pmol / μl forward primer, 1 μl of 10 pmol / μl reverse primer, and 23 μl of distilled water, for a total volume of 50 μl) was added to a syringe containing a membrane filter with immobilized nucleic acids. Then, PCR was performed under the following conditions: initial denaturation: 94°C for 2 minutes, 30 cycles; denaturation: 94°C for 20 seconds; annealing: 55°C for 10 seconds; extension: 72°C for 30 seconds; final extension: 72°C for 5 minutes.
[0082] 2-2. Nucleic acid isolation methods including elution steps
[0083] Furthermore, the membrane filter with nucleic acid immobilized can be used for polymerase chain reaction (PCR) after eluting with an elution solution.
[0084] The step of immobilizing nucleic acids on the membrane filter was performed in the same manner as in Example 2-1 above. Distilled water was added to a syringe containing the filtrate and passed through the membrane filter. In this case, to selectively filter impurities before adding distilled water, the solution could be washed once with 100% ethanol (EtOH). Whether the final solution contained deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) was confirmed using the same method as in Example 2-1 above.
[0085] Example 3. Confirmation of optimal conditions for one-step nucleic acid isolation buffer composition
[0086] In the isolation of genomic deoxyribonucleic acid (gDNA), a large amount of salt and ethanol (EtOH) are required to achieve cell lysis and bind the gDNA to the membrane filter. Therefore, a composition that minimizes the influence of the salt and ethanol (EtOH) is crucial if polymerase chain reaction (PCR) is directly performed using the aforementioned membrane filter after one-step separation of nucleic acids using the nucleic acid separation buffer composition of the present invention.
[0087] To confirm this, the deoxyribonucleic acid (DNA) separation efficiency of nucleic acid separation buffer compositions containing sodium dodecyl sulfate (SDS) (0.5% or 1%), NaCl (0.5M or 1M), or ethanol (EtOH) (50% or 70%) as structural components was verified. Figure 2 The results are shown in the figure. In this case, the procedure was carried out in the same manner as in Example 2-1 or Example 2-2 above, consistent with the individual experimental groups, using glass microfiber filters (GF / C, Whatman Co.) at a density of 1.75 × 10⁻⁶. 9 Similarly, 293T cells (a human cell line derived from the HEK 293 cell line, which expresses the SV40 large T antigen) were used. After mixing 5 μl of the isolated sample with 1 μl of dye and loading onto a 0.8% agarose gel, the results were confirmed using GelDoc (electrophoresis imaging system).
[0088] exist Figure 2In the diagram, line 1 represents a 100bp ladder-like band; line 2 represents the negative control group (no nucleic acid was added initially, but loaded after polymerase chain reaction (PCR)); line 3 represents the result of loading only primers for 5 μl of GAPDH (forward primer: TGCACCACCAACTGCTTAGC (Sequence No. 1), reverse primer: CGCATGGACTGTGGTCATGAG (Sequence No. 2)); and line 4 represents the positive control group (based on results obtained using a commercial gDNA extraction kit). Genomic DNA Extraction Kit (K-3032) of Bioneer was used to perform polymerase chain reaction (PCR) on 1 μg of isolated genomic deoxyribonucleic acid (gDNA). Line 5 shows the result of loading the mixture containing the sample and the nucleic acid separation buffer of the present invention into a membrane filter as described in Example 2-1 (referred to as AB (attach and bind) elution). Line 6 shows the result of loading the membrane filter containing the mixture in line 5 into distilled water after eluting it with distilled water as described in Example 2-2 (referred to as AB (attach and bind)). Lines 5 and 6 are experimental groups used to confirm whether genomic deoxyribonucleic acid (gDNA) binds to the membrane filter. Line 7 shows the result of loading the result obtained by performing the above-described Example 2-1 using 2 ml of the buffer composition of Example 1 (referred to as ST (standard concentration)). Line 8 shows the result of loading the result obtained by performing the above-described Example 2-1 using 2 ml of high-concentration sodium dodecyl sulfate (SDS) (referred to as 1%, HS (High The results of the SDS (Sodium Dodecyl Sulfate) assays are as follows: Line 9 is the result of 2 ml of medium concentration sodium dodecyl sulfate (SDS) (recorded as 0.5%, MS (Medium SDS)); Line 10 is the result of 2 ml of high concentration NaCl (1M, HN (High NaCl)); Line 11 is the result of 2 ml of medium concentration NaCl (recorded as 0.5M, MN (Medium NaCl)); Line 12 is the result of 2 ml of high concentration ethanol (EtOH) (recorded as 70%, HE (High EtOH)); and Line 13 is the result of 2 ml of medium concentration ethanol (EtOH) (recorded as 50%, ME (Medium EtOH)).
[0089] like Figure 2As shown, in confirming whether genomic deoxyribonucleic acid (gDNA) binds to the membrane filter, line 6 exhibits more pronounced luminescence compared to line 5, indicating better binding of nucleic acids to the membrane filter (refer to line 5). This allows for excellent separation of nucleic acids using distilled water (refer to...). Figure 6 Line 1).
[0090] Furthermore, polymerase chain reaction (PCR) using a membrane filter directly can only be performed without an elution step when the ethanol (EtOH) content is below 50% (see line 13). Also, regarding sodium dodecyl sulfate (SDS), it was confirmed that PCR could not be performed when 1% SDS was included (see line 8).
[0091] Therefore, in nucleic acid separation methods that utilize the nucleic acid separation buffer composition of the present invention and exclude the elution step by directly employing a membrane filter in which nucleic acids are immobilized, it has been found that it is preferable to contain less than 1% of the above-mentioned sodium dodecyl sulfate (SDS) and more preferably less than 50% of the above-mentioned ethanol (EtOH).
[0092] Example 4. Confirmation of nucleic acid separation efficiency based on membrane filters
[0093] 4-1. Commercial membrane filter
[0094] A filter suitable for the nucleic acid separation buffer composition of the present invention has been confirmed in commercial membrane filters made of polyvinylidene fluoride (PVDF) material with various pore sizes.
[0095] In this regard, syringes equipped with 0.1 μm polyvinylidene fluoride (PVDF) filters, 0.22 μm polyvinylidene fluoride (PVDF) filters, 0.45 μm polyvinylidene fluoride (PVDF) filters, or paper filters (3M paper filters) and the nucleic acid separation buffer (GB (gDNA extraction buffer) of the present invention) were used. HEK 293T cells (1.0 × 10⁻⁶) were isolated using 5 ml of the nucleic acid separation buffer of the present invention. 6 The DNA was lysed and the genomic deoxyribonucleic acid (gDNA) was isolated using the same method as in Example 2-1 above. The isolation efficiency was confirmed and shown in [the diagram]. Figure 3 5 μl of sample obtained according to the conditions of each experimental group and 1 μl of dye were mixed and loaded into 0.8% agarose gel at 100 V for 30 minutes.
[0096] exist Figure 3 In the image, line 1 represents a 1kb ladder-like band, and line 2 represents the genomic deoxyribonucleic acid (gDNA) control group (comprised of gDNA extracted using a commercial gDNA extraction kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated genomic deoxyribonucleic acid (gDNA) (1 μg) was subjected to polymerase chain reaction (PCR). Lines 3 (0.1 μm pore size filter), 5 (0.22 μm pore size filter), 7 (0.45 μm pore size filter), and 9 (paper filter) were used to filter 100 μl of genomic deoxyribonucleic acid (gDNA) (10 μg) isolated according to Example 2 above + 300 μl of the nucleic acid separation buffer of the present invention (the filtered amount of genomic deoxyribonucleic acid (gDNA) remaining in the nucleic acid separation buffer after filtration was used to confirm the amount of genomic deoxyribonucleic acid (gDNA) remaining in the nucleic acid separation buffer that had not bound to the membrane). Lines 4 (0.1 μm pore size filter), 6 (0.22 μm pore size filter), 8 (0.45 μm pore size filter), and 10 (paper filter) were used to filter 100 μl of genomic deoxyribonucleic acid (gDNA) (10 μg) isolated according to Example 2 above + 300 μl of the nucleic acid separation buffer of the present invention). The filter was an experimental group that obtained nucleic acids by elution with 400 μl of H₂O in the final step of the method in Example 2-2 above. In this case, the membrane filter was washed once with 400 μl of 100% ethanol (EtOH) in lines 4, 6, 8 and 10 to filter impurities.
[0097] like Figure 3 As shown, a distinct band can be identified on line 4. Therefore, among commercially available membrane filters made of polyvinylidene fluoride (PVDF) with various pore sizes, the filter with a pore size of 0.1 μm was found to exhibit the highest DNA separation efficiency. Conversely, in the filter with a pore size of 0.45 μm, genomic DNA (gDNA) did not bind to the membrane filter, and a considerable amount of genomic DNA (gDNA) was identified in the filtered solution. Therefore, among PVDF filters, the filter with a pore size of 0.1 μm was found to be most suitable for the nucleic acid separation buffer composition of the present invention.
[0098] 4-2. Silica membrane filter
[0099] The suitability of the silica membrane filter with the nucleic acid separation buffer composition of the present invention was also evaluated.
[0100] In this study, a syringe equipped with a silica filter was used to isolate genomic deoxyribonucleic acid (gDNA) from 293T cells using the same method as in Example 2, 2-1, and the respective isolation efficiencies were confirmed and illustrated. Figure 4 In this case, the amount of nucleic acid eluted based on the amount of elution solution was confirmed (recorded as silica filter elution 1 to silica filter elution 5).
[0101] exist Figure 4 In the diagram, line 1 represents a 1kb ladder-like band, and line 2 represents the positive control group (in a mixture of 1μg of a commercially available gDNA extraction kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated genomic deoxyribonucleic acid (gDNA) and 400 μl of the nucleic acid separation buffer of the present invention were filtered through a 0.1 μM polyvinylidene fluoride (PVDF) membrane filter, followed by elution with 200 μl of distilled water. Line 3 was an experimental group in which the membrane filter that had undergone one elution in line 2 was eluted again with 200 μl of distilled water (used to confirm that there was no residual genomic deoxyribonucleic acid (gDNA) after elution). Line 4 was an experimental group in which 1 μg of genomic deoxyribonucleic acid (gDNA) of the present invention was filtered through a silica membrane filter. The experimental groups using the acid separation buffer (used to confirm whether genomic deoxyribonucleic acid (gDNA) binds to the silica membrane filter) are as follows: Line 5 is the experimental group that eluted the silica membrane filter with 50 μl of distilled water; Line 6 is the experimental group that eluted the silica membrane filter twice with 50 μl of distilled water; Line 7 is the experimental group that eluted the silica membrane filter three times with 50 μl of distilled water; Line 8 is the experimental group that eluted the silica membrane filter four times with 50 μl of distilled water; and Line 9 is the experimental group that eluted the silica membrane filter five times with 50 μl of distilled water.
[0102] Therefore, as Figure 4 As shown, when using the nucleic acid separation buffer composition and silica membrane filter of the present invention, excellent separation efficiency of genomic deoxyribonucleic acid (gDNA) was confirmed. In particular, distinct bands were observed in lines 5 to 9, and using these as a reference, an appropriate elution solution volume of 100 μl to 200 μl was confirmed.
[0103] 4-3. Glass microfiber filter
[0104] 1) Confirm applicability
[0105] The suitability between the glass fiber filter and the nucleic acid separation buffer composition of the present invention was also evaluated.
[0106] In this study, genomic deoxyribonucleic acid (gDNA) was isolated from 293T cells using a syringe equipped with a glass fiber filter, following the same method as in Example 2, Section 2-1 above. The isolation efficiencies were confirmed and illustrated. Figure 5 .
[0107] exist Figure 5 In the diagram, line 1 represents a 1kb ladder-like band; line 2 represents the negative control group, which consists of an experimental group in which only 200μl of the nucleic acid separation buffer composition of the present invention is added without genomic deoxyribonucleic acid (gDNA); lines 3 and 4 represent experimental groups in which the nucleic acid separation buffer composition of the present invention containing 1μg of genomic deoxyribonucleic acid (gDNA) is filtered through a glass fiber filter and then eluted with 50μl of distilled water, with the same conditions repeated twice; line 5 represents the experimental group in which the glass fiber filter is eluted with 100μl of distilled water; and line 6 represents the experimental group in which the glass fiber filter is eluted with 200μl of distilled water.
[0108] like Figure 5 As shown, distinct bands were observed in lines 1 to 4 of the experimental group using a glass fiber filter, confirming the separation of genomic deoxyribonucleic acid (gDNA). Therefore, when using the nucleic acid separation buffer composition and glass fiber filter of the present invention, excellent genomic deoxyribonucleic acid (gDNA) separation efficiency was also confirmed.
[0109] Furthermore, visual inspection was used to confirm whether the genomic deoxyribonucleic acid (gDNA) was immobilized on the glass fiber filter to demonstrate its presence. Figure 6 Therefore, after treating a glass fiber filter with ethidium bromide (EtBr), luminescence was confirmed under ultraviolet (UV) light to verify whether luminescence occurred, thereby confirming whether genomic deoxyribonucleic acid (gDNA) was immobilized on the glass fiber filter and demonstrating its presence. Figure 6 .
[0110] exist Figure 6In the diagram, lines 1 and 4 represent the control group, which consists of 200 μl of the nucleic acid separation buffer composition of the present invention without genomic deoxyribonucleic acid (gDNA). Lines 2 and 3 represent the experimental group that was repeatedly tested under the same conditions, which does not involve polymerase chain reaction (PCR). Lines 5 and 6 represent the experimental group that was repeatedly tested under the same conditions, which involves polymerase chain reaction (PCR).
[0111] Based on the glass fiber membrane filter that confirms binding to genomic deoxyribonucleic acid (gDNA) via ultraviolet (UV) light without an elution step. Figure 6 The results showed clear luminescence in lines 2 and 3, confirming that genomic deoxyribonucleic acid (gDNA) was well bound to the glass fiber membrane filter. Furthermore, when polymerase chain reaction (PCR) was performed directly using the glass fiber membrane filter with an exclusion elution step, the remaining amount of genomic deoxyribonucleic acid (gDNA) in the glass fiber membrane filter was slightly reduced compared to before the PCR was performed. This suggests that some genomic deoxyribonucleic acid (gDNA) was mixed into the PCR reaction mixture during the PCR process.
[0112] Therefore, when using the nucleic acid separation buffer composition and glass fiber membrane filter of the present invention, excellent binding efficiency and separation efficiency with genomic deoxyribonucleic acid (gDNA) were confirmed.
[0113] 2) Confirm the optimal size
[0114] On the other hand, negatively charged membrane filters, such as polyvinylidene fluoride (PVDF) membranes, silica membranes, and glass fiber membrane filters, require a large amount of salt (0.1–1 M NaCl) as an intermediate medium for the positive charge in order to capture negatively charged genomic deoxyribonucleic acid (gDNA). Therefore, glass fiber filters containing nucleic acids contain a large amount of Na+, which, if polymerase chain reaction (PCR) is performed without separate purification, may hinder the PCR reaction. The most effective way to prevent this problem is to make the glass fiber filter as small as possible compared to the PCR volume, thereby minimizing the effect of Na+. However, if it is too small, it is difficult to manufacture a column-shaped nucleic acid separation kit with a glass fiber membrane filter installed. Therefore, in the application of the nucleic acid separation buffer composition of the present invention, an optimal size of glass fiber filter has been confirmed.
[0115] Genomic DNA (gDNA) was isolated from 293T cells using the same method as in Example 2-1 above. The isolation efficiencies were confirmed and shown in [the figures]. Figure 7 .
[0116] In this case, to confirm the polymerase chain reaction (PCR) products, a 0.8% agarose gel was used and loaded at 100V for 30 minutes. Furthermore, the PCR was performed in a total volume of 50 μl, with 5 μl of sample and 1 μl of dye mixed together for loading.
[0117] exist Figure 7 In the diagram, line 1 represents a 100 bp ladder-like band (2 μl of ladder-like band + 3 μl of H₂O); line 2 represents the negative control group, which consists of 200 μl of the nucleic acid separation buffer composition of this invention without genomic deoxyribonucleic acid (gDNA); line 3 represents the experimental group loaded only with primers for 5 μl of GAPDH (forward primer: TGCACCACCAACTGCTTAGC (Sequence No. 1), reverse primer: CGCATGGACTGTGGTCATGAG (Sequence No. 2)); and line 4 represents the positive control group (for the experimental group using a commercial genomic deoxyribonucleic acid (gDNA) separation kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated 1 μg of gDNA and subjected it to polymerase chain reaction (PCR). Line 5 represents the experimental group (line 6 is the control group) after filtering the nucleic acid separation buffer of the present invention containing 1 μg of gDNA through a glass fiber filter and then performing PCR on the filtered buffer. Line 6 represents 400 μl of the nucleic acid separation buffer of the present invention containing 1 μg of gDNA through a glass fiber filter and cutting it into 1 / 8 pieces (4×4 mm). 2 The experimental group that underwent polymerase chain reaction (PCR) was as follows: Line 7 was the control group (Line 8), which was prepared by filtering 400 μl of the nucleic acid separation buffer of the present invention containing 1 μg of genomic deoxyribonucleic acid (gDNA) through a glass fiber filter and then performing PCR on the filtered buffer. Line 8 was the control group, which was prepared by filtering 400 μl of the nucleic acid separation buffer of the present invention containing 1 μg of genomic deoxyribonucleic acid (gDNA) through a glass fiber filter and cutting it into 1 / 16 pieces (2 × 2 mm). 2 The experimental group that then underwent polymerase chain reaction (PCR) was selected.
[0118] like Figure 7 As shown, using a total volume of 50 μl of polymerase chain reaction (PCR) as a baseline, a distinct band was observed at line 8, confirming the presence of a band at 2 × 2 mm. 2 Polymerase chain reaction (PCR) was successfully performed at a size (1 / 16). Conversely, as with line 6, at 4×4 mm... 2 At a size of 1 / 8, it was confirmed that polymerase chain reaction (PCR) could not be performed. Therefore, the optimal size of the glass fiber filter for each total volume of 50 μL was confirmed to be 2 × 2 mm. 2 The following (based on 0.25M NaCl).
[0119] Example 5. Confirmation of the nucleic acid separation efficiency of the one-step nucleic acid separation method
[0120] 5-1. Confirm the sensitivity based on the amount of genomic deoxyribonucleic acid (gDNA).
[0121] In a nucleic acid separation method that utilizes the nucleic acid separation buffer composition of the present invention and excludes the elution step, directly using a membrane filter in which nucleic acids are immobilized for polymerase chain reaction (PCR), it was confirmed whether small amounts of genomic deoxyribonucleic acid (gDNA) could also be detected by polymerase chain reaction (PCR). When using a glass fiber filter, the sensitivity of the amount of genomic deoxyribonucleic acid (gDNA) (in units from μg (micrograms) to pg (picograms)) needs to be tested.
[0122] Therefore, a commercially available genomic deoxyribonucleic acid (gDNA) isolation kit was used for gDNA extraction. Deoxyribonucleic acid (DNA) was extracted from 293T cells using the Genomic DNA Extraction Kit (K-3032) of Bioneer. A total of 120 μg of extracted genomic DNA (gDNA) was mixed with 400 μl of the nucleic acid separation buffer composition of the present invention. One-tenth (40 μl) of this mixture was then added to 360 μl of the nucleic acid separation buffer composition of the present invention. After seven serial dilutions of the above-mixed solution and the nucleic acid separation buffer composition of the present invention, the solution was filtered through a glass fiber filter. The solution was then filtered through a 2×2 mm filter. 2 The filter was cut and placed into a polymerase chain reaction (PCR) reaction mixture to confirm whether PCR amplification occurred.
[0123] In this case, 0.1% agarose gel was used and loaded at 100V for 30 minutes. Furthermore, polymerase chain reaction (PCR) was performed in a total volume of 50 μl, mixing 5 μl of sample with 1 μl of dye and loading.
[0124] exist Figure 8 In the diagram, line 1 represents a 100bp ladder-like band; line 2 represents the negative control group, which consists of 200μl of the nucleic acid separation buffer composition of this invention without genomic deoxyribonucleic acid (gDNA); line 3 represents the experimental group loaded only with primers for 5μl of GAPDH (forward primer: TGCACCACCAACTGCTTAGC (Sequence No. 1), reverse primer: CGCATGGACTGTGGTCATGAG (Sequence No. 2)); and line 4 represents the positive control group (for the experimental group using a commercial genomic deoxyribonucleic acid (gDNA) separation kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated 1 μg of gDNA and performed polymerase chain reaction (PCR). Line 5 was used to fix 120 μg of gDNA onto a glass fiber filter and then cut it into 2×2 mm pieces. 2 The results were measured and placed in a polymerase chain reaction (PCR) reaction mixture to confirm whether PCR amplification occurred in the experimental group. Line 6 represents the PCR result of 12 μg of genomic deoxyribonucleic acid (gDNA), line 7 represents the PCR result of 1.2 μg of genomic deoxyribonucleic acid (gDNA), line 8 represents the PCR result of 120 ng of genomic deoxyribonucleic acid (gDNA), line 9 represents the PCR result of 12 ng of genomic deoxyribonucleic acid (gDNA), line 10 represents the PCR result of 1.2 ng of genomic deoxyribonucleic acid (gDNA), line 11 represents the PCR result of 120 pg of genomic deoxyribonucleic acid (gDNA), and line 12 represents the PCR result of 12 pg of deoxyribonucleic acid (DNA).
[0125] like Figure 8 As shown, a distinct band was observed on line 12 (12 pg of genomic deoxyribonucleic acid (gDNA)), confirming that even a small amount of genomic deoxyribonucleic acid (gDNA) can produce excellent polymerase chain reaction (PCR) amplification.
[0126] 5-2. Confirm the sensitivity based on cell number.
[0127] In nucleic acid separation methods that utilize the nucleic acid separation buffer composition of the present invention and exclude the elution step, directly using a membrane filter in which nucleic acids are immobilized for polymerase chain reaction (PCR), it is necessary to verify the sensitivity based on the amount of genomic deoxyribonucleic acid (gDNA) obtained from a small number of cells. For this purpose, in the case of using a glass fiber filter, sensitivity based on the amount of genomic deoxyribonucleic acid (gDNA) ranging from 100,000 cells to several hundred has been confirmed.
[0128] Therefore, 100,000 293T cells were lysed in 400 μl of water, and 200 μl of the diluted solution was transferred to a new tube. Then, 200 μl of water was added to mix the lysate, and this process was repeated to dilute the cells by half (each diluted tube contained 200 μl). Cell lysis was performed using the nucleic acid separation buffer composition (GB, gDNA extraction buffer) of the present invention, followed by elution through a glass fiber filter at a 2×2 mm depth. 2 The glass fiber filter was cut to the desired size and placed into a polymerase chain reaction (PCR) reaction mixture to confirm whether PCR amplification occurred.
[0129] In this case, 0.1% agarose gel was used and loaded at 100V for 30 minutes. Furthermore, polymerase chain reaction (PCR) was performed in a total volume of 50 μl, mixing 5 μl of sample with 1 μl of dye and loading.
[0130] exist Figure 9 In the diagram, line 1 represents a 100bp ladder-like band (2μl of the ladder-like band + 3μl of H₂O); line 2 represents the experimental group loaded only with primers for GAPDH (forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO. 1), reverse primer: CGCATGGACTGTGGTCATGAG (SEQ ID NO. 2)); and line 3 represents the positive control group (for samples extracted using a commercial genomic deoxyribonucleic acid (gDNA) isolation kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated genomic deoxyribonucleic acid (gDNA) (1 μg) was used for polymerase chain reaction (PCR). Line 4 is the negative control group (the experimental group containing only 200 μl of the nucleic acid isolation buffer composition of the present invention without genomic deoxyribonucleic acid (gDNA), AB-control). Line 5 is the positive control group (1 μg of complementary strand deoxyribonucleic acid (qDNA) and 200 μl of the nucleic acid isolation buffer composition of the present invention, AB+control). Line 6 is the experimental group of 100,000 cells (200 μl of the nucleic acid isolation buffer composition of the present invention). Line 7 is the experimental group of 50,000 cells (200 μl of the nucleic acid isolation buffer composition of the present invention). Experimental groups (acid separation buffer composition): Line 8 is an experimental group of 25,000 cells (200 μl of the nucleic acid separation buffer composition of the present invention), Line 9 is an experimental group of 12,500 cells (200 μl of the nucleic acid separation buffer composition of the present invention), Line 10 is an experimental group of 6,250 cells (200 μl of the nucleic acid separation buffer composition of the present invention), Line 11 is an experimental group of 3,125 cells (200 μl of the nucleic acid separation buffer composition of the present invention), Line 12 is an experimental group of 1,563 cells (200 μl of the nucleic acid separation buffer composition of the present invention), and Line 13 is an experimental group of 781 cells (200 μl of the nucleic acid separation buffer composition of the present invention).
[0131] like Figure 9 As shown, although the number of cells reached a small number of 781, it was confirmed that polymerase chain reaction (PCR) amplification was successfully achieved in the genomic deoxyribonucleic acid (gDNA) (see line 13).
[0132] 5-3. Confirm the isolation efficiency of bacterial gDNA.
[0133] In a nucleic acid separation method that uses the nucleic acid-fixed membrane filter directly for polymerase chain reaction (PCR) by utilizing the nucleic acid separation buffer composition of the present invention and excluding the elution step, it was confirmed whether bacterial genomic deoxyribonucleic acid (gDNA) with a cell wall could also be separated when using a glass fiber filter.
[0134] Therefore, after lysing 10⁹ E. coli cells with 400 μl of the nucleic acid separation buffer of the present invention, 200 μl was extracted and transferred to a new tube. Then, 200 μl of the nucleic acid separation buffer of the present invention was added and mixed. This process was repeated to continuously dilute the sample by half (each diluted tube had a volume of 200 μl). After elution through a glass fiber filter, the sample was filtered at a 2×2 mm... 2 The glass fiber filter was cut to the desired size and placed into a polymerase chain reaction (PCR) reaction mixture to confirm whether PCR amplification occurred.
[0135] To amplify the bacterial genomic deoxyribonucleic acid (gDNA), the primers used were those for the uidA gene: forward primer (uidA Up): TATGGAATTTCGCCGATTTT (Sequence No. 3), reverse primer (uidA Down): TGTTTGCCTCCCTGCTGCGG (Sequence No. 4) . Furthermore, the polymerase chain reaction (PCR) reaction mixture and PCR conditions used were the same as those described in the examples above.
[0136] In this case, 0.1% agarose gel was used and loaded at 100V for 30 minutes. Furthermore, polymerase chain reaction (PCR) was performed in a total volume of 50 μl, mixing 5 μl of sample with 1 μl of dye and loading.
[0137] exist Figure 10 In the diagram, line 1 represents a 100 bp ladder-like band; line 2 represents the negative control group (200 μl of the nucleic acid isolation buffer composition of this invention); line 3 represents the experimental group containing only 5 μl of primers for the E. coli gene; and line 4 represents the positive control group (using a commercial genomic deoxyribonucleic acid (gDNA) extraction kit). Genomic DNA Extraction Kit (K-3032) of Bioneer isolated genomic deoxyribonucleic acid (gDNA) (1 μg) was subjected to polymerase chain reaction (PCR), with line 5 showing a value of 1.75 × 10⁻⁶. 9 Cell (200 μl of the nucleic acid isolation buffer composition of the present invention) experimental group, line 6 was 1.75 × 10⁶. 8 Experimental group of 100 Escherichia coli (E. coli) cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 7 was 1.75 × 10⁻⁶. 7Experimental group of 100 E. coli cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 8 was 1.75 × 10⁸. 6 Experimental group of 100 E. coli cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 9 was 1.75 × 10⁻⁶. 5 Experimental group of 10 Escherichia coli (E. coli) cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 10 was 1.75 × 10⁻⁶. 4 Experimental group of *E. coli* cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 11 was 1.75 × 10⁻⁶. 3 Experimental group of *E. coli* cells (200 μl of the nucleic acid isolation buffer composition of the present invention), line 12 was 1.75 × 10⁻⁶. 2 Experimental group of 100 Escherichia coli (E. coli) cells (200 μl of the nucleic acid separation buffer composition of the present invention).
[0138] like Figure 10 As shown, with a small amount of bacterial genomic deoxyribonucleic acid (gDNA) of about 175 units, it was confirmed that polymerase chain reaction (PCR) amplification could also be successfully performed (see line 12).
[0139] 5-4. Confirm pH-based RNA separation efficiency
[0140] In a nucleic acid separation method using the nucleic acid separation buffer composition of the present invention and a membrane filter in which nucleic acids are immobilized without an elution step, the separation efficiency of total ribonucleic acid (RNA) based on the pH of the cells was confirmed.
[0141] To isolate total ribonucleic acid (RNA) from cells, different pH variations than those for deoxyribonucleic acid (DNA) are required. Total ribonucleic acid (RNA) was isolated using the nucleic acid separation buffer composition and glass fiber filter of this invention under various pH variations, and eluted after immobilization in the filter to confirm whether total ribonucleic acid (RNA) separation was achieved. In this case, the cells were 293T cells, and the concentration was 1 × 10⁻⁶. 6 Used in the same way.
[0142] The cells were mixed with 2 ml of the present invention's nucleic acid separation buffer composition (GB, gDNA extraction buffer) and incubated for 5 minutes to achieve lysis. Subsequently, total RNA was immobilized on a glass fiber filter by elution, and total RNA extraction was confirmed by elution with distilled water. To analyze the pH-based total RNA extraction efficiency, 25 mM Tris-HCl (pH 4 to pH 8) was used.
[0143] In this case, 1% agarose gel was used, and loading was performed at 100V for 30 minutes. Furthermore, polymerase chain reaction (PCR) was performed in a total volume of 50 μl, with 5 μl of sample and 1 μl of dye mixed for loading.
[0144] exist Figure 11 In the diagram, line 1 represents a 100bp ladder-like band (2μl of the ladder-like band + 3μl of H₂O), and line 2 represents the positive control group (using a commercial total RNA extraction kit). Total ribonucleic acid (RNA) (1 μg) isolated by the Universal RNA Extraction Kit of Bioneer; Line 3 represents other control groups, the same as Line 2 above, where total ribonucleic acid (RNA) (1 μg) obtained using a commercial total ribonucleic acid (RNA) isolation kit was lysed using the nucleic acid isolation buffer composition of the present invention containing 2 ml of 25 mM Tris-HCl at pH 8; Lines 4 to 8 represent experimental groups where cells were lysed using the nucleic acid isolation buffer composition of the present invention containing 25 mM Tris-HCl at pH 4 to pH 8.
[0145] like Figure 11 As shown, the separation of total RNA is not ideal at pH 8, which is suitable for genomic deoxyribonucleic acid (gDNA), but it has been confirmed that the separation of total RNA is ideal at pH 7 and below. Therefore, in the method for separating total RNA using the nucleic acid separation buffer composition and glass fiber filter of the present invention, and using a membrane filter in which nucleic acids are immobilized without an elution step, it has been confirmed that it is preferred to perform the procedure at pH 4 to pH 7.
[0146] 5-5. Confirm the efficiency of pH-based polymerase chain reaction (PCR) after ribonucleic acid (RNA) digestion.
[0147] Total ribonucleic acid (RNA) was isolated from cells and immobilized in a membrane filter using the nucleic acid separation buffer composition and glass fiber filter of the present invention. The membrane with total ribonucleic acid (RNA) immobilized was then placed in a polymerase chain reaction (PCR) tube to confirm whether a polymerase chain reaction (PCR) could be performed directly.
[0148] Unlike deoxyribonucleic acid (DNA), RNA separation requires buffer compositions with different pH levels than DNA. To analyze the effect of pH-based extraction of total RNA on polymerase chain reaction (PCR), 25 mM Tris-HCl (pH 4–8) was used. Under various pH variations, 2 ml of the nucleic acid separation buffer composition of this invention was used to achieve 1 × 10⁻⁶ PCR results. 6 293T cells were cultured for 5 minutes and lysed. Total RNA was fixed in a glass fiber filter by elution at a 2×2 mm size. 2 After being cut to size, the sample was placed in a polymerase chain reaction (PCR) reaction mixture to confirm whether PCR amplification occurred.
[0149] In this case, 1% agarose gel was used and loaded at 100V for 30 minutes. Furthermore, polymerase chain reaction (PCR) was performed in a total volume of 50 μl, mixing 5 μl of sample with 1 μl of dye and loading.
[0150] exist Figure 12 In the diagram, line 1 represents a 100bp ladder-like band (2 μl of the ladder-like band + 3 μl of H₂O); line 2 represents the negative control group, which consists of experimental groups that only used 200 μl of the nucleic acid separation buffer composition of this invention; line 3 represents the result using primers loaded only for 5 μl of GAPDH (forward primer: TGCACCACCAACTGCTTAGC (serial number 1), reverse primer: CGCATGGACTGTGGTCATGAG (serial number 2)); and line 4 represents the result using the positive control group (commercial total RNA extraction kit). Total RNA (RNA) (1 μg) isolated using the Universal RNA Extraction Kit of Bioneer; Line 5 represents the experimental group where total RNA (RNA) (1 μg) obtained using a commercial total RNA isolation kit as described above (Line 4) was lysed using the nucleic acid isolation buffer composition of the present invention containing 2 ml of 25 mM Tris-HCl at pH 8; Line 6 represents the positive control group (the experimental group was lysed using a commercial gDNA extraction kit). The following experimental groups were used to perform polymerase chain reaction (PCR) on genomic deoxyribonucleic acid (gDNA) (1 μg) isolated by the Genomic DNA Extraction Kit (K-3032) of Bioneer. Line 7 is the experimental group that used the nucleic acid isolation buffer composition of the present invention containing 2 ml of 25 mM Tris-HCl at pH 8 to lyse genomic deoxyribonucleic acid (gDNA) (1 μg) obtained by the commercial genomic deoxyribonucleic acid (gDNA) isolation kit as described in line 6 above. Lines 8 to 12 are the experimental groups that used the nucleic acid isolation buffer composition of the present invention containing 25 mM Tris-HCl at pH 4 to pH 8 to lyse cells.
[0151] like Figure 12 As shown, after lysing cells with the nucleic acid separation buffer composition of the present invention containing 25 mM tris-hydroxymethylaminomethane hydrochloride (Tris-HCl) at pH 4 to pH 7, the cells were filtered through a glass fiber filter and then directly placed into a polymerase chain reaction (PCR) tube to perform a polymerase chain reaction (PCR). It was confirmed that the reaction could be successfully performed in this way.
[0152] In summary, the nucleic acid separation buffer composition and the nucleic acid separation kit containing the membrane filter of the present invention enable one-tube polymerase chain reaction (PCR) and one-step separation of nucleic acids from various samples. Excellent compatibility between the aforementioned nucleic acid separation buffer composition and membrane filters of various materials has been confirmed. Furthermore, in the nucleic acid separation method using these components, it has been confirmed that the membrane filter with immobilized nucleic acids can be directly used for polymerase chain reaction (PCR) without a separate elution step. Therefore, the nucleic acid separation composition, kit, and separation method of the present invention can be effectively applied to rapid on-site diagnosis. sequence list <110> GENE2US Co., Ltd. <120> Buffer compositions for nucleic acid separation in column-based single-tube polymerase chain reactions and their applications <130> SCH1-1PCT <150> KR 10-2021-0005968 <151> 2021-01-15 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primers for GAPDH <400> 1 tgcaccacca actgcttagc 20 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> GAPDH reverse primer <400> 2 cgcatggact gtggtcatga g 21 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer of uidA <400> 3 tatggaattt cgccgatttt 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer of uidA <400> 4 tgtttgcctc cctgctgcgg 20
Claims
1. A method for isolating and amplifying nucleic acids from a sample, characterized in that, Includes the following steps: Lysis is achieved by immersing the sample in a nucleic acid separation buffer, which consists of 20% (v / v) to 50% (v / v) ethanol, 0.1% (w / v) to 0.5% (w / v) sodium dodecyl sulfate, 0.5M to 1M sodium chloride, 1mM to 100mM ethylenediaminetetraacetic acid, and 1mM to 50mM tris(hydroxymethyl)aminomethane hydrochloride. The lysed solution of the above sample was cultured at room temperature; The lysed solution of the above sample was transferred to a column equipped with a membrane filter; as well as The nucleic acid is immobilized on the filter and the filtrate is removed by applying pressure to the column described above; Furthermore, without performing an elution step, the membrane filter immobilized with nucleic acids is directly used for polymerase chain reaction.
2. The method according to claim 1, characterized in that, The above culture should be performed for 2 to 10 minutes.
3. The method according to claim 1, characterized in that, The above samples may be biological or non-biological.
4. The method according to claim 3, characterized in that, The biological samples mentioned above are selected from one or more of the following groups: nasal aspirate, bronchial aspirate, organ secretions, sputum, tears, saliva, cells, cell extracts, whole blood, plasma, serum, mucus, nasal wash, urine, semen, peritoneal lavage fluid, ascites, cystic fluid, meningeal fluid, amniotic fluid, leukocytes, peripheral blood mononuclear cells, erythrocyte sedimentation rate (ESR) brown layer, glandular fluid, pancreatic juice, lymph, pleural effusion, nipple aspirate, synovial fluid, joint aspirate, and cerebrospinal fluid.
5. The method according to claim 3, characterized in that, The aforementioned non-biological samples contain chemically synthesized peptide nucleic acids.
6. The method according to claim 1, characterized in that, The polymerase chain reaction mentioned above is selected from one of the groups consisting of conventional polymerase chain reaction, reverse transcription polymerase chain reaction, and isothermal amplification polymerase chain reaction.
7. The method according to claim 1, characterized in that, The membrane filter is selected from one of the following groups: polyvinylidene fluoride filter, nylon filter, nitrocellulose membrane filter, paper filter, glass fiber filter, and silica filter.
8. The method according to claim 1, characterized in that, The column equipped with the membrane filter is configured in the form of a syringe.
9. The method according to claim 1, characterized in that, The nucleic acid is selected from at least one of the groups consisting of deoxyribonucleic acid, ribonucleic acid, and peptide nucleic acid.
Citation Information
Patent Citations
Biological markers useful in cancer immunotherapy
KR1020210005968A
Rapid nucleic acid extraction method and apparatus
CN105524915A
Kit for nucleic acid extraction and storage
CN204369906U
Methods and compositions for isolation of biological macromolecules
US20020127587A1