Genes, molecular marker primer sets and detection methods for assisting identification of soybean leaf wrinkle in the south

Abstract

The invention discloses a gene for assisting in identifying southern soybean leaf wrinkle disease, wherein the base sequence of the gene is shown in SEQ ID NO.1, the gene can be stably expressed in a wrinkled leaf environment, and is less affected by other adverse conditions, and a molecular marker primer set developed based on the molecular marker gene can quickly and easily determine whether the wrinkled leaf type of a plant to be tested is southern soybean leaf wrinkle disease through a real-time fluorescence quantitative PCR experiment. Compared with the existing field identification method, the detection method of the invention has a short identification cycle, which can be completed within 1 day at the fastest, and the determination is directly performed based on the ΔCt value of the real-time fluorescence quantitative PCR, thereby reducing the difficulty of morphological distinction.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a molecular marker gene, a molecular marker primer set and a detection method for assisting identification of southern soybean leaf wrinkle disease. Background Art

[0002] A phenomenon of soybean leaf wrinkling has appeared in production in Guangxi, Guangdong, Fujian, Guizhou and other places. The symptoms of this wrinkled leaf are characterized by obvious "wrinkles" between leaf veins, light yellow spots with unclear edges on the leaves, slightly yellow leaf edges, leaves that are difficult to stretch, the top of the main veins bend downward, the positive leaves are in a "hook" shape, and the symptoms at the base of the leaves are lighter than those at the top of the leaves. When the symptoms are severe, it can lead to a 40% reduction in soybean production, seriously affecting the production of soybeans in the southern region. This wrinkled leaf disease is called southern soybean wrinkled leaf disease. According to investigations, this symptom has long existed in production, but it was previously mistakenly believed to be caused by viruses. The wrinkled leaf disease is induced by some unknown factor in the environment. It can appear stably in some locations. There are large differences in wrinkled leaves among soybean germplasms and can be stably inherited. However, there are many known factors that cause soybean wrinkled leaves, such as gene mutations, viruses, herbicides, manganese toxicity, nutritional disorders, etc. Although the soybean wrinkled leaf phenotypes caused by different inducements are different, there are also many similarities, so it is difficult to judge the inducement of wrinkled leaves based on the morphology of leaf wrinkling in production. Therefore, how to accurately identify southern soybean leaf wrinkle is of great significance for breeding southern soybean leaf wrinkle-resistant varieties and developing southern soybean production.

[0003] The application team previously established a method for field identification of soybean leaf wrinkle in the south (CN111121629A). This method is simple and accurate to operate, but it takes a long time and relies on a stable soil environment that causes soybean leaf wrinkle. In addition, the leaf wrinkle symptoms caused by different factors are sometimes difficult to distinguish in morphology, making morphological distinction difficult. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a gene, a molecular marker primer set and a detection method for assisting in identifying southern soybean leaf wrinkle disease.

[0005] To achieve the above purpose, the technical solution provided by the present invention is as follows:

[0006] A gene for assisting in identifying southern soybean leaf wrinkle disease, the base sequence of the gene is shown in SEQ ID NO.1, the expression level of the gene is upregulated in soybean plants suffering from southern soybean leaf wrinkle disease, and the gene can be used to assist in identifying southern soybean leaf wrinkle disease.

[0007] The present invention also provides a molecular marker primer set for amplifying the above gene, wherein the forward primer of the molecular marker primer set is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.3. The molecular marker primer set is used for real-time fluorescence quantitative PCR detection.

[0008] The present invention also provides a reagent or a kit containing the molecular marker primer set.

[0009] The application of the above gene in assisting the identification of southern soybean leaf wrinkle disease also falls within the protection scope of the present invention.

[0010] The use of the above molecular marker primer set, reagents or kits containing the molecular marker primer set in assisting the identification of southern soybean leaf wrinkle disease also falls within the protection scope of the present invention.

[0011] The present invention also provides a method for detecting southern soybean leaf wrinkle disease. The primer pair is used to amplify the gene through a real-time fluorescence quantitative PCR experiment, and whether the sample to be tested suffers from southern soybean leaf wrinkle disease is judged according to the ΔCt value.

[0012] Preferably, the detection method comprises the following steps:

[0013] (1) Extracting RNA from leaves of soybean plants to be tested and then reverse transcribing it into cDNA;

[0014] (2) using the cDNA of step (1) as a template and using the molecular marker primer set to perform real-time fluorescence quantitative PCR, wherein the forward primer of the molecular marker primer set is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.3;

[0015] (3) The ΔCt value of real-time fluorescence quantitative PCR was used to determine whether the sample leaf was southern soybean wrinkled leaf syndrome. When ΔCt < 10, the sample leaf was determined to have southern soybean wrinkled leaf syndrome. When ΔCt ≥ 10, the sample leaf was determined not to have southern soybean wrinkled leaf syndrome.

[0016] In the real-time fluorescence quantitative PCR of step (2), the ACTIN gene is selected as the internal reference gene, the forward primer for amplifying the internal reference gene is shown in SEQ ID NO., and the reverse primer is shown in SEQ ID NO.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The invention provides a gene for assisting in identifying southern soybean leaf wrinkle disease. The gene can be stably expressed in a wrinkled leaf environment and is less affected by other adverse conditions. A molecular marker primer set developed based on the gene can quickly and easily determine whether the wrinkled leaf type of a plant to be tested is southern soybean leaf wrinkle disease through a real-time fluorescence quantitative PCR experiment. Compared with the existing field identification method, the detection method of the invention has a short identification cycle and can be completed within 1 day at the fastest. The determination is directly made based on the ΔCt value of the real-time fluorescence quantitative PCR, thereby reducing the difficulty of morphological distinction.

[0019] Instruction Manual

[0020] Figure 1 These are photos of 19 soybean leaf samples collected in Example 2. DETAILED DESCRIPTION

[0021] The following is a detailed description in conjunction with specific embodiments, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. The raw materials used in the examples are all commercially available unless otherwise specified.

[0022] Example 1 Screening and identification of molecular marker genes for assisting identification of southern soybean leaf wrinkle

[0023] Step 1: Use wrinkled leaf differential materials to construct a heterozygous heteroplasmic family of southern soybean wrinkled leaf disease. Select one of the families with normal performance (GY_N) and wrinkled leaves (GY_C) in the wrinkled leaf soil environment, plant them in the wrinkled leaf soil environment, and take the top tender leaves for RNA-seq analysis when they grow to the R1 stage. Take 6 plants from each family. After the data is downloaded, the expression of the gene is quantified by FPKM, and the DESeq software is used to screen the differentially expressed genes. The screening criteria are |log2FC|>1, P value<0.05, and among the up-regulated genes, the lowest value among the 6 plants of CY_C is greater than the maximum value among the 6 plants of GY_N, and among the down-regulated genes, the maximum value among the 6 plants of CY_C is less than the minimum value among the 6 plants of GY_N, and the genes with high expression difference are selected first. Finally, 8 up-regulated genes were screened, including GLYMA_13G167100, GLYMA_04G244000, GLYMA_07G229500, GLYMA_09G130800, GLYMA_15G160600, GLYMA_18G033400, GLYMA_04G242400, and GLYMA_15G156200;

[0024] Step 2, according to the 8 up-regulated genes, the real-time fluorescence quantitative PCR primers were designed, the conventional PCR temperature gradient was designed, and the optimal annealing temperature of the primers was found. The 25 μL system for PCR amplification was: Kangwei Century's 2×Es Taq MasterMix (Dye): 12.5 μL, Forward Primer: 1 μL, Reverse Primer: 1 μL, DNA template: 1 μL, ddH2O: 9.5 μL. PCR amplification program: pre-denaturation temperature 94°C, time 2 min; denaturation temperature 94°C, time 30 s; annealing temperature 60°C, 30 s; extension temperature 72°C, 10 s, final extension temperature 72°C, 2 min. Denaturation-annealing-extension was performed for a total of 38 cycles. Then, the cDNA of the wrinkled leaf sensitive material R1 stage in the wrinkled leaf environment and the non-wrinkled leaf environment soil was used as a template for verification. The results are shown in Table 1. It was found that the expression levels of the six genes GLYMA_18G033400, GLYMA_09G130800, GLYMA_15G160600, GLYMA_15G156200, GLYMA_04G242400, and GLYMA_07G229500 were quite different;

[0025] Table 1: Molecular marker primers developed for 8 genes and expression analysis results of two materials with wrinkled and non-wrinkled leaves

[0026]

[0027]

[0028] Step 3, using drought, waterlogging, chilling, shading, high salt and other stress treatments to verify whether the expression of the six genes GLYMA_18G033400, GLYMA_09G130800, GLYMA_15G160600, GLYMA_15G156200, GLYMA_04G242400, and GLYMA_07G229500 has wrinkled leaf expression specificity. The results are shown in Table 2. It was found that the expression level of the GLYMA_18G033400 gene in the wrinkled leaf environment was significantly higher than that in other adverse conditions, while the expression levels of the other five genes in some adverse conditions were higher than those in the wrinkled leaf environment. This shows that the expression of the other two genes is easily disturbed by other adverse conditions and is not suitable as identification genes.

[0029] Table 2: Changes in expression levels of five genes under adverse stress

[0030]

[0031] Therefore, the GLYMA_18G033400 gene was used as a gene to assist in identifying the southern soybean leaf wrinkle disease. The base sequence of the gene is (SEQ ID NO.1):

[0032] ATGCTCACCCCAAAGTTGTTTATACTATTCTTTGCTTGTCTCCTAATAATTGCTCCCAAT

[0033] TTATCTCCCAACCCAAATGGTGTGGAAGCTACTCAGGTTCTAACCATCCATAAAGGGT

[0034] ACACAAAGCGTCAAGTTTATTCCACTCTGGGGCTCGTGTGCAAATGCTGTGATGGTAA

[0035] AGGTGGCGAATGTACAAGCACATGGGAGGATGATGCTTGCTCCAACCTCGTGTGCAA

[0036] ACCATGGAAGTATTAG

[0037] The molecular marker primer set for detecting the GLYMA_18G033400 gene by real-time fluorescence quantitative PCR has a forward primer base sequence of (SEQ ID NO.2): GCTTGTCTCCTAATAATTGCTC, and a reverse primer base sequence of (SEQ ID NO.3): CCAGAGTGGAATAAACTTGAC.

[0038] Example 2 Identification of Southern Soybean Leaf Crinkle

[0039] Step 1: From April to June 2021, 19 soybean leaf samples with different wrinkled leaf types were collected from soybean production areas in Nanning, Guangxi, Guigang, Guangxi, and Hezhou, Guangxi ( Figure 1 ), when collecting samples, first hang a label to mark the individual plants, and when they are mature, harvest the seeds and return to Nanning for field identification. The field identification method is carried out according to the patent "A field identification method for soybean leaf wrinkle" (CN111121629A). The identification results are shown in Table 3;

[0040] Step 2: The 19 soybean leaf samples collected in step 1 were separately analyzed using RNAsimple Total RNA Kit Kit was used to extract total RNA from leaves, and the quality of RNA extraction was confirmed by agarose gel running. Then, the FastKingRT Kit (With gDNAse) was used to extract total RNA from leaves. The kit reverse transcribes RNA into cDNA as a template, and the 19 samples are analyzed by real-time fluorescence quantitative PCR using a fluorescence quantitative PCR instrument (LC480II). Actin gene is used as the internal reference gene in the experiment;

[0041] Reaction system: cDNA template 1 μL, 2×ChamQTM Univar sal SYBR QPCR Master Mix: 10 μL, forward primer 0.4 μL, reverse primer 0.4 μL, ddH2O: 8.2 μL;

[0042] Reaction conditions: pre-denaturation: 95°C, 3 min; amplification 40 cycles: denaturation 95°C 5 s, annealing 60°C 10 s, extension 72°C 10 s, and collecting fluorescence during the extension stage; dissolution 1 cycle: denaturation 95°C 15 s, annealing 60°C 1 min; cooling: 50°C 10 s.

[0043] Primer sequences:

[0044]

[0045] Identification standard: when ΔCt<10, the sample leaf is judged to be southern soybean leaf wrinkle, and when ΔCt≥10, the sample leaf is judged not to be southern soybean leaf wrinkle;

[0046] The results are shown in Table 3. It can be seen from Table 3 that the identification results using qPCR are consistent with the results of field identification.

[0047] Table 3: Marker identification and field identification results of 19 samples

[0048]

[0049] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A gene for assisting identification of southern soybean leaf wrinkle disease, characterized in that: The base sequence of the gene is shown in SEQ ID NO.

1.

2. Application of a molecular marker primer set in assisting identification of soybean leaf wrinkle in the south, characterized in that: The molecular marker primer set is used to amplify a gene whose base sequence is shown in SEQ ID NO.1, the forward primer of the molecular marker primer set is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.

3. The molecular marker primer set is used for real-time fluorescence quantitative PCR detection.

3. Use of a reagent or a kit for assisting identification of southern soybean leaf wrinkle disease, characterized in that: The reagent or kit contains the molecular marker primer set described in claim 2.

4. A method for detecting soybean leaf wrinkle in the south, characterized in that: Through real-time fluorescence quantitative PCR experiment, the molecular marker primer set described in claim 2 is used to amplify the gene with the base sequence shown in SEQ ID NO.1, and the ΔCt value is used to determine whether the sample to be tested suffers from southern soybean leaf wrinkle disease.

5. The detection method according to claim 4, characterized in that: The following steps are involved: (1) Extracting RNA from leaves of soybean plants to be tested and then reverse transcribing it into cDNA; (2) using the cDNA of step (1) as a template and using the molecular marker primer set to perform real-time fluorescence quantitative PCR, wherein the forward primer of the molecular marker primer set is shown in SEQ ID NO.2, and the reverse primer is shown in SEQ ID NO.3; (3) The ΔCt value of real-time fluorescence quantitative PCR was used to determine whether the sample leaf was southern soybean wrinkled leaf syndrome. When ΔCt < 10, the sample leaf was determined to have southern soybean wrinkled leaf syndrome. When ΔCt ≥ 10, the sample leaf was determined not to have southern soybean wrinkled leaf syndrome.

6. The detection method according to claim 5, characterized in that: In the real-time fluorescence quantitative PCR of step (2), the ACTIN gene is selected as the internal reference gene, the forward primer for amplifying the internal reference gene is shown in SEQ ID NO.18, and the reverse primer is shown in SEQ ID NO.19.

Images