Preparation method and application of multivalent aptamers for detecting Salmonella based on HCR
The preparation of Salmonella multivalent aptamers by HCR based methods solves the problems of low sensitivity and insufficient specificity in the existing detection methods, and achieves high affinity and high sensitivity Salmonella detection, which is suitable for food safety monitoring and other fields.
Patent Information
- Application Number
- CN202211081913.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-06
- Publication Date
- 2025-02-11
- Estimated Expiration
- 2042-09-06
AI Technical Summary
The existing Salmonella detection methods have problems such as low sensitivity, insufficient specificity and complex detection process. Especially under the interference of food matrix, the affinity of aptamers is reduced, which limits the sensitivity of the detection.
Using the preparation method for detecting multivalent aptamers of Salmonella by mixing biotinylated hairpin DNA with trigger strand DNA to form an HCR skeleton, and assemble biotinylated Salmonella aptamers on it to form a high-valent state Multivalent aptamer. This method utilizes the programmability of DNA and base complementary pairing to achieve high affinity of aptamers and signal amplification.
The sensitivity of Salmonella detection was improved, the affinity of multivalent aptamers was increased by 33 times, and Salmonella at 7 cfu/mL was detected and showed good specificity in different common food-borne pathogenic bacteria.
Smart Images
Figure CN116087508B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a method for detecting Salmonella, and in particular to a method for preparing a multivalent aptamer for detecting Salmonella based on HCR and application thereof. Background Art
[0002] salmonella( Salmonella ) is a common foodborne pathogen. Although there are already perfect standards and legislative systems to control its contamination of food, Salmonella still poses a huge threat to human health. Therefore, establishing a reliable and sensitive detection method for Salmonella is the key to ensuring food quality and safety.
[0003] Traditional bacterial culture is the gold standard method for detecting foodborne pathogens, but it is time-consuming and labor-intensive and cannot meet the needs of rapid detection. In the past few decades, molecular amplification technology (such as polymerase chain reaction, PCR) and immunological methods (enzyme-linked immunosorbent assay, ELISA) based on molecular biology have high sensitivity, but the false positives caused by aerosol contamination are the main reason limiting the application of these methods. Immunological methods usually amplify the detection signal through antigen-antibody reaction and enzyme-catalyzed reaction. This method has high specificity and can avoid the problems of complex DNA extraction and aerosol contamination. However, the complex antibody preparation process and fragile antibody activity make these methods have the defects of high cost and short shelf life. Therefore, there is an urgent need to develop a simple, sensitive and specific method for the detection of foodborne pathogens.
[0004] Aptamers are short single-stranded DNA or RNA oligonucleotides with high specificity for the target selected from a large number of random sequence nucleic acid libraries. Compared with antibodies, aptamers have the advantages of versatility in structural design, low synthesis cost, good reproducibility, easy modification, and good stability. Therefore, aptamers are considered to be recognition elements that can replace antibodies and play an important role in the detection of foodborne pathogens. However, due to the interference of complex food matrices, the affinity of most aptamers is reduced, which limits the practical application of aptamers. In order to compensate for the low sensitivity caused by the reduction in affinity, aptamer-based detection methods mostly use signal amplification strategies, isothermal nucleic acid amplification technology, enzyme cascade amplification, etc. It is worth noting that the detection of single Salmonella in different samples can be achieved by combining aptamer allosteric probes with RNA amplification and CRISP-Cas13a to obtain three-stage amplification. However, the cumbersome preparation and modification of these nanomaterials and the complex cascade amplification design limit the application of these aptamer-based detection methods. Therefore, there is an urgent need for a simple and effective signal amplification strategy or a method to enhance the affinity of aptamers to improve the sensitivity of aptamer-based detection methods. Hybridization chain reaction (HCR) is a signal amplification technology that does not require enzyme participation and uses base complementary pairing for alternating hybridization. At present, there are no published research reports on the method of using HCR for the construction of multivalent aptamers and signal amplification for the detection of Salmonella at home and abroad. Summary of the invention
[0005] The technical problem to be solved by the present invention is to provide a preparation method and application of a multivalent aptamer for detecting Salmonella based on HCR with high sensitivity and strong specificity.
[0006] The technical solution adopted by the present invention to solve the above technical problems is: a method for preparing a multivalent aptamer for detecting Salmonella based on HCR, comprising the following steps:
[0007] (1) biotinylated hairpin DNA 1, biotinylated hairpin DNA 2, and biotinylated Salmonella aptamer are subjected to annealing pretreatment respectively;
[0008] (2) The trigger DNA (trigger) was mixed with biotinylated hairpin DNA 1 and biotinylated hairpin DNA 2, and the mixture was reacted at 37°C overnight to obtain an HCR backbone solution. Then, the biotinylated Salmonella aptamer was added to the HCR backbone solution and reacted at 37°C for 2 hours to obtain a multivalent aptamer solution for detecting Salmonella.
[0009] Furthermore, the nucleotide sequence of the hairpin DNA 1 in step (1) is as follows: TTTCCCTTATATTCTCTCTCTCTCCTGCGGGAATGTCTAGGTGATTGAGTGGTGTGTTATCCCACTCAATCACCTAGACCATTCCGCAACAACATAC (the underlined part is complementary to the aptamer
[0010] part); the nucleotide sequence of the hairpin DNA2 is as follows: GATAACACACCACTCAATCACCTAGACATTCCCGCAGTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG; the nucleotide sequence of the Salmonella aptamer is as follows: GAGAGAGAATATAAGGGAAA AAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT (the underlined part is the complementary part to hairpin DNA 1).
[0011] Furthermore, the annealing pre-treatment in step (1) is to heat at 95°C for 10 minutes and then immediately place on ice for 15 minutes.
[0012] Furthermore, the nucleotide sequence of the trigger chain DNA (trigger) described in step (2) is as follows: GTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG.
[0013] Further, step (2) specifically includes mixing 0.5 μL of 0.1 μM trigger DNA (trigger) with 0.5 μL of 5 μM biotinylated hairpin DNA 1 and 0.5 μL of 5 μM biotinylated hairpin DNA 2, and diluting the volume to 2.5 μL with phosphate buffer, reacting at 37°C overnight to obtain the HCR backbone; then adding 0.6 μL of 5 μM biotinylated aptamer to the HCR backbone solution, diluting the volume to 10 μL with phosphate buffer, and reacting at 37°C for 2 hours to obtain a multivalent aptamer solution for detecting Salmonella. This ensures that the biotinylated hairpin DNA 1 on the HCR backbone and the biotinylated Salmonella aptamer are fully bound through complementary chains.
[0014] The method for detecting Salmonella using the multivalent aptamer obtained by the above preparation method is as follows: 50 μL of the Salmonella test solution is added to the high adsorption ELISA plate, incubated for 2 hours, and then 1wt% bovine serum albumin solution is added and incubated for 30 minutes, followed by adding 50 μL of 0.05 μM Salmonella detection multivalent aptamer solution, discarding the unbound multivalent aptamer after 45 minutes, and then adding 50 μL of streptavidin horseradish peroxidase (SA-HRP) and incubating for 25 minutes, and then adding 50 μL of 3,3',5,5'-tetramethylbenzidine (TMB) color development solution, and after color development for 15 minutes in the dark, 50 μL of 2 MH 2 SO 4 The reaction was terminated, and quantitative detection was performed using an enzyme marker. The concentration of Salmonella in the test solution was quantitatively detected based on the curve obtained by detecting the absorbance values corresponding to different concentrations of Salmonella.
[0015] Furthermore, the incubation temperature is 37° C., and the plate is washed three times with phosphate buffer containing 0.01% Tween-20 after each incubation step.
[0016] Principle of the invention: Taking advantage of the fact that the HCR product is a long double-stranded DNA and the programmability of DNA, an extension sequence is designed at the 5' end of the hairpin DNA1 to complement the extension sequence at the 5' end of the aptamer (Apt), and the aptamer is connected to the HCR backbone through simple base complementary pairing to obtain a high-valent multivalent aptamer for capturing Salmonella. In order to detect the output of the signal, biotin is modified at the 5' end of the aptamer (Apt), and it is combined with streptavidin-horseradish peroxidase (SA-HRP) through the binding mode of streptavidin-biotin, and finally the substrate is added for color development. At the same time, biotin is modified at the 3' ends of the two hairpin DNAs at the same time, and this biotin-rich HCR is used as a scaffold for the signal carrier (horseradish peroxidase, HRP) to improve the detection sensitivity. During the detection, Salmonella is first adsorbed on a high-adsorption enzyme label plate, and after blocking, a multivalent aptamer is added. Because it has a high affinity for Salmonella, it will specifically bind to Salmonella. Then, the streptavidin-horseradish peroxidase (SA-HRP) was combined with the biotin on the multivalent aptamer through the binding mode of streptavidin-biotin, and finally the substrate was added for color development. The absorbance value was linearly related to the concentration of Salmonella. The higher the concentration of Salmonella added, the more multivalent aptamers were specifically bound, the more streptavidin-horseradish peroxidase was bound, the better the final color development effect was, and the higher the absorbance value was.
[0017] Compared with the prior art, the present invention has the advantages of
[0018] (1) The hybridization chain reaction (HCR) in the present invention is an enzyme-free isothermal amplification technology. The product has the characteristic of large molecular weight. Through sequence design, the aptamer can be assembled on the HCR product through simple base complementary pairing to obtain a high-valent multivalent aptamer.
[0019] (2) The HCR-based multivalent aptamer for Salmonella in the present invention increases the affinity of the aptamer by 33 times due to its high valency.
[0020] (3) The present invention utilizes the programmability of DNA to modify the two hairpin DNAs in HCR amplification. The obtained HCR product is used as a scaffold for the signal carrier (horseradish peroxidase), thereby achieving signal amplification and greatly improving the sensitivity of the detection method.
[0021] (4) In the present invention, by modifying the hairpin DNA, the HCR product serves as a multivalent aptamer backbone and also as a scaffold for the signal carrier. Due to the synergistic effect of the high affinity of the multivalent aptamer and the HCR signal amplification, this method can detect 7 cfu / mL of Salmonella.
[0022] In summary, the present invention is a preparation method and application of a multivalent aptamer for detecting Salmonella based on HCR, which gives play to the bifunctionality of the HCR skeleton. On the one hand, the HCR product is used as a scaffold for the assembly of multivalent aptamers to enhance the binding affinity of the aptamer to Salmonella; on the other hand, using the programmability of DNA, HCR is used as a scaffold of a signal carrier, and the detection sensitivity is further improved by interacting with streptavidin-biotin, and the sensitivity of detection is greatly improved by a one-step dual signal amplification. And due to the high specificity of multivalent aptamers, the present invention has good specificity in different common foodborne pathogens, and shows good detection performance in actual samples. In addition, the object of detection can be changed by the replacement of aptamers. Therefore, the method has broad application prospects in other bacterial detection, food safety monitoring, medical imaging, drug transportation, etc. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is a schematic diagram of the construction principle of the multivalent aptamer of the present invention;
[0024] Figure 2 This is an agarose gel electrophoresis diagram of the multivalent aptamer constructed in the specific embodiment 1;
[0025] Figure 3 is the affinity value of the multivalent aptamer and the monovalent aptamer of the present invention binding to Salmonella;
[0026] Figure 4 It is a fluorescence microscope image of the multivalent aptamer and the monovalent aptamer of the present invention binding to Salmonella;
[0027] Figure 5 This is a schematic diagram of the principle of detecting Salmonella by the multivalent aptamer of the present invention;
[0028] Figure 6 The present invention detects different concentrations (10 1 - 10 7 The linear relationship between the absorbance value of Salmonella (CFU / mL) and the concentration of Salmonella;
[0029] Figure 7 The present invention detects different concentrations (10 2 - 10 7 CFU / mL) linear relationship between the absorbance value of Salmonella and the concentration of Salmonella;
[0030] Figure 8 For the specific embodiment 3 detection method, 10 5 CFU / mL Staphylococcus aureus, 10 5 CFU / mL Listeria monocytogenes, 10 5 CFU / mL Escherichia coli, 10 5 CFU / mL Salmonella, 10 5 CFU / mL Staphylococcus aureus: 10 5 CFU / mL Listeria monocytogenes: 10 5 CFU / mL Escherichia coli: 10 5 The absorbance value for detection was CFU / mL Salmonella = 1:1:1:1. DETAILED DESCRIPTION
[0031] The present invention is further described in detail below with reference to the accompanying drawings. Specific embodiment 1
[0033] Construction of multivalent aptamers
[0034] The long double-stranded DNA obtained by hybridization chain reaction (HCR) is connected with the aptamer through complementary pairing to obtain a multivalent aptamer structure. The schematic diagram is shown in Figure 1As shown. The specific experimental steps are as follows: First, the two biotinylated hairpin DNAs 1 and 2 and the biotinylated aptamers were heated at 95 °C for 10 minutes and then immediately inserted into ice for 15 minutes for annealing pre-treatment. Subsequently, 0.5 μL of 0.1 μM trigger chain DNA (trigger) was mixed with 0.5 μL of 5 μM biotinylated hairpin DNA 1 and 2, and the volume was adjusted to 2.5 μL with phosphate buffer, and reacted at 37 °C overnight to obtain the HCR backbone; finally, 0.6 μL of 5 μM biotinylated aptamer was added to the HCR backbone solution, and the volume was adjusted to 10 μL with phosphate buffer, and reacted at 37 °C for 2 hours to obtain the multivalent aptamer. The nucleotide sequence of the trigger chain DNA (trigger) is as follows: GTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG; the nucleotide sequence of hairpin DNA1 is as follows: TTTCCCTTATATTCTCTCTC TCTCCTGCGGGAATGTCTAGGTGATTGAGTGGTGTGTTATCCCACTCAATCACCTAGACCATTCCGCAACAACATAC (the underlined part is the complementary part to the aptamer); the nucleotide sequence of hairpin DNA2 is as follows: GATAACACACCACTCAATCACCTAGACATTCCCGCAGTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG; the nucleotide sequence of the aptamer (Apt) is as follows: GAGAGAGAATATAA GGGAAA AAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT (the underlined part is the complementary part to H1).
[0035] To verify the construction of the multivalent aptamer in the first specific embodiment of the present invention, biotinylated DNA1 (annealed biotinylated DNA1), biotinylated DNA2 (annealed biotinylated DNA2), trigger (trigger stock solution), biotinylated DNA1 + biotinylated DNA2 (0.5 μL 5 μM annealed biotinylated DNA1 and 2 were mixed and fixed to 2.5 μL with phosphate buffer and reacted at 37°C overnight), HCR backbone (HCR backbone prepared by the above method), multivalent aptamer (multivalent aptamer prepared by the above method), and biotinylated aptamer (annealed biotinylated aptamer) were sequentially added to 1% agarose gel electrophoresis for separation (GelRed nucleic acid dye staining, electrophoresis buffer was 1 × TAE, 130V constant voltage for 30 minutes) and imaged on a gel imager. The results are shown in Figure 2. Figure 2As shown, lanes 1-3 and lane 7 are biotinylated DNA1, biotinylated DNA12, trigger, and biotinylated aptamer, respectively. Different bands are presented due to the different molecular weights. The mobility of the HCR product (lane 5) obtained after the mixed reaction of biotinylated DNA1, biotinylated DNA2 and trigger is significantly reduced, and with the addition of biotinylated aptamer (lane 6), the mobility is further reduced, indicating that the construction of the multivalent aptamer is completed. Specific embodiment 2
[0037] Comparison of binding affinity between multivalent and monovalent aptamers and Salmonella
[0038] 50 μL of 10 5 CFU / mL Salmonella solution was added to the high-absorption ELISA plate, incubated at 37 °C for 2 hours, washed three times with phosphate buffer containing 0.01% Tween-20, blocked at 37 °C for 30 minutes with 150 μL 1 wt% bovine serum albumin solution, washed three times in the same way, and then 50 μL of multivalent aptamers (1, 2.5, 5, 10, 25, 50, 100 nM) or monovalent aptamers (annealed biotinylated Salmonella aptamers) (250, 500, 800, 1000, 1200 nM) diluted with phosphate buffer were added and incubated at 37 °C for 45 minutes. After three washes, 50 μL of streptavidin-horseradish peroxidase was added. After incubation at room temperature for 25 minutes, the plate was washed three times, 50 μL of TMB colorimetric solution was added, and after color development for 15 minutes in the dark, 50 μL of 2 MH 2 SO 4 Stop the reaction and measure the absorbance at 450 nm using an enzyme-labeled instrument. The data is calculated according to the formula: Y = B max X / (Kd + X) (where X represents the aptamer concentration, Y represents the measured absorbance value, B max represents the maximum absorbance value) to calculate the affinity value Kds. The result is as follows Figure 3 As shown, the affinity values of the multivalent aptamer and the monovalent aptamer were 11.72 nM ( Figure 3 A) and 389.63nM ( Figure 3 B).
[0039] In addition, the binding degree of the multivalent aptamer and the monovalent aptamer to Salmonella was compared by fluorescence microscopy to reflect the strength of affinity. The 5' end of the aptamer (Apt) was modified with a fluorescent group (FAM) and a multivalent aptamer was constructed according to Example 1. 100 μL 10 9CFU / mL Salmonella solution was incubated with 2.5 μL 1 μM monovalent aptamer or multivalent aptamer at 37°C for 2 hours, centrifuged at 6000 rpm for 5 minutes, washed twice with phosphate buffer to remove the supernatant to wash away the monovalent aptamer or multivalent aptamer that was not bound to Salmonella, and the obtained aptamer-Salmonella mixture was re-dissolved in 1 mL phosphate buffer and observed under a fluorescence microscope. The results are shown in Figure 4 As shown, Salmonella ( Figure 4 A) The fluorescence intensity is much higher than that of the monovalent aptamer ( Figure 4 B), indicating that the affinity of multivalent aptamers is much higher than that of monovalent aptamers. Specific embodiment three
[0041] Multivalent aptamers for detection of Salmonella
[0042] 50 μL of the Salmonella test solution was added to the high-absorption ELISA plate, incubated at 37°C for 2 hours, washed three times with phosphate buffer containing 0.01% Tween-20, added 150 μL of 1wt% bovine serum albumin solution and blocked at 37°C for 30 minutes, washed three times in the same way, then added 50 μL of multivalent aptamer diluted to a concentration of 0.05 μM in phosphate buffer and incubated at 37°C for 45 minutes, after three washes, added 50 μL of streptavidin horseradish peroxidase (SA-HRP). After incubation at room temperature for 25 minutes, washed three times, added 50 μL of 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution, and after color development for 15 minutes in the dark, stained with 2 MH 2 SO 4 Stop the reaction and use an enzyme-labeled instrument for quantitative detection. Figure 5 shown.
[0043] The curve obtained by detecting the absorbance values corresponding to different concentrations of Salmonella can be used to quantitatively detect the concentration of Salmonella in the test solution; when the concentration of added Salmonella is higher, the more multivalent aptamers it specifically binds to, the more enzymes it binds to, and the better the final color development effect and the higher the absorbance value.
[0044] like Figure 6 As shown, different concentrations (10 1 - 10 7 The linear relationship between the absorbance value of Salmonella and the concentration of Salmonella (CFU / mL) is y = 0.247 x – 0.0970, and the correlation coefficient is R 2 = 0.988, with a detection limit of 7 CFU / mL, which can be used to detect Salmonella of unknown concentration. Specific embodiment 4
[0046] In order to verify the value of the detection method in the third specific embodiment of the present invention in practical applications, a Salmonella standard solution was added to milk as an actual sample, and different concentrations of Salmonella in the milk were detected. The results are as follows: Figure 7 As shown, different concentrations of milk (10 2 - 10 7 The linear relationship between the absorbance value of Salmonella and the concentration of Salmonella (CFU / mL) is y = 0.0739x - 0.0563, and the correlation coefficient is R 2 = 0.968, and the detection limit was 128 CFU / mL. Specific embodiment five
[0048] In order to verify the detection specificity of the detection method of the third specific embodiment of the present invention, 10 5 CFU / mL Staphylococcus aureus, 10 5 CFU / mL Listeria monocytogenes, 10 5 CFU / mL Escherichia coli, 10 5 CFU / mL Salmonella, 10 5 CFU / mL Staphylococcus aureus, 10 5 CFU / mL Listeria monocytogenes, 10 5 CFU / mL Escherichia coli, 10 5 CFU / mL Salmonella = 1:1:1:1 for absorbance detection. The results are as follows Figure 8 As shown, when Salmonella is present, the absorbance value detected is much greater than the absorbance value of interfering foodborne pathogens, indicating that the detection method is specific to Salmonella. Specific embodiment six
[0050] In order to verify the accuracy and stability of the detection method of the third specific embodiment of the present invention, different concentrations of Salmonella in milk were detected and the recovery rate was calculated.
[0051] Table 1 shows the results of the experiments on different concentrations of milk (1 × 10 3 - 1 × 10 5 CFU / mL) recovery rate of Salmonella
[0052]
[0053] As shown in Table 1, different concentrations of milk (1 × 10 3 - 1 × 10 5 The recovery rates of Salmonella in 100 CFU / mL (range, 40.04-120.08) were 84.75% - 119.07%, and the average recovery rate was 104.32%, indicating that this detection method can be applied to the detection of Salmonella in food samples.
[0054] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.
Claims
1. A method for preparing a multivalent aptamer for detecting Salmonella based on HCR, characterized in that The following steps are involved: (1) biotinylated hairpin DNA 1, biotinylated hairpin DNA 2 and biotinylated Salmonella aptamer are subjected to annealing pre-treatment respectively, wherein the nucleotide sequence of the hairpin DNA 1 is as follows: TTTCCCTTATATTCTCTCTCTCTCCT GCGGGAATGTCTAGGTGATTGAGTGGTGTGTTATCCCACTCAATCACCTAGACCATTCCG CAACAACATAC; the nucleotide sequence of the hairpin DNA 2 is as follows: GATAACACACCACTCAATCAC CTAGACATTCCCGCAGTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG; the nucleotide sequence of the Salmonella aptamer is as follows: GAGAGAGAATATAAGGGAAAAAAAACTCCTCTGACTGT AACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT; (2) The trigger chain DNA was mixed with biotinylated hairpin DNA 1 and biotinylated hairpin DNA 2, and the mixture was reacted at 37° C. overnight to obtain an HCR backbone solution, and then biotinylated Salmonella aptamer was added to the HCR backbone solution and reacted at 37° C. for 2 hours to obtain a multivalent aptamer solution for detecting Salmonella, wherein the nucleotide sequence of the trigger chain DNA was as follows: GTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG.
2. The method for preparing a multivalent aptamer for detecting Salmonella based on HCR according to claim 1, characterized in that: Features: The annealing pretreatment described in step (1) is to heat at 95°C for 10 minutes and then immediately place on ice for 15 minutes.
3. The method for preparing a multivalent aptamer for detecting Salmonella based on HCR according to claim 1, characterized in that Step (2) specifically comprises mixing 0.5 μL of 0.1 μM trigger chain DNA with 0.5 μL of 5 μM biotinylated hairpin DNA 1 and 0.5 μL of 5 μM biotinylated hairpin DNA 2, and diluting the volume to 2.5 μL with phosphate buffer, reacting at 37°C overnight to obtain the HCR backbone; then adding 0.6 μL of 5 μM biotinylated aptamer to the HCR backbone solution, diluting the volume to 10 μL with phosphate buffer, and reacting at 37°C for 2 hours to obtain a multivalent aptamer solution for detecting Salmonella.
4. A method for detecting Salmonella using the multivalent aptamer for detecting Salmonella obtained by the preparation method according to any one of claims 1 to 3, characterized in that The specific steps are as follows: 50 μL of the Salmonella test solution is added to the high-adsorption ELISA plate, incubated for 2 hours, and then a 1wt% bovine serum albumin solution is added and incubated for 30 minutes, followed by adding 50 μL of a 0.05 μM Salmonella detection multivalent aptamer solution, discarding the unbound multivalent aptamer after 45 minutes, and then adding 50 μL of streptavidin-horseradish peroxidase and incubating for 25 minutes, adding 50 μL of 3,3',5,5'-tetramethylbenzidine colorimetric solution, and after color development in the dark for 15 minutes, 50 μL of 2M H2SO4 is used to terminate the reaction, and quantitative detection is performed using an ELISA instrument, and the concentration of Salmonella in the test solution is quantitatively detected according to the curve obtained by detecting the absorbance values corresponding to different concentrations of Salmonella.
5. The method for detecting Salmonella using a multivalent aptamer for detecting Salmonella according to claim 4, characterized in that: The incubation temperature is 37° C. After each incubation step, the plate is washed three times with a phosphate buffer solution containing 0.01% Tween-20.