Glycerol dehydrogenase mutants and uses thereof

Abstract

The application discloses a glycerol dehydrogenase mutant and application thereof, and the glycerol dehydrogenase is derived from Klebsiella pneumoniae and is encoded by gene dhaD. The application improves the molecular structure of the glycerol dehydrogenase by rational design and a site-directed mutagenesis technology to obtain a mutant enzyme F245Q / GDH, and the mutant enzyme is back-supplemented into Klebsiella pneumoniae which is deficient in glycerol dehydrogenase. Compared with a wild-type strain, the yield of a main product 1,3-propanediol of the back-supplemented mutant enzyme F245Q / GDH strain is improved, and the yield of a by-product 2,3-butanediol is significantly reduced.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to construction and application of a glycerol dehydrogenase mutant and an expression strain thereof. BACKGROUND

[0002] 1,3-propanediol has a very large application and demand, and has strong growth momentum. Klebsiella pneumoniae is a main strain for industrial production of 1,3-propanediol, and has high yield and certain fermentation advantages. However, there are certain disadvantages in the synthesis of 1,3-propanediol by using Klebsiella pneumoniae, such as the existence of byproduct 2,3-butanediol, which not only competes with 1,3-propanediol for nutrients, but also is very unfavorable for subsequent product separation and purification, and increases the production cost. Due to the limitation of the self-function of the natural strain, it is difficult to meet the demand of industrial production, which is a very common problem. Researchers have been trying to optimize the metabolic pathway by using genetic engineering and other means, in order to break through the bottleneck of industrial application.

[0003] Based on the above problems, the applicant designs a rational design method to direct evolution of glycerol dehydrogenase coded by dhaD in Klebsiella pneumoniae, so as to greatly reduce the synthesis of byproduct 2,3-butanediol while maintaining the yield of main product 1,3-propanediol. SUMMARY

[0004] In view of the problem of accumulation of byproduct 2,3-butanediol, the purpose of the application is to design a glycerol dehydrogenase mutant, and construction and application of an expression strain thereof.

[0005] The amino acid sequence of the glycerol dehydrogenase mutant F245Q / GDH is shown in SEQ ID No 1.

[0006] The gene sequence of the glycerol dehydrogenase mutant F245Q / GDH is shown in SEQ ID No 2.

[0007] The application of the glycerol dehydrogenase mutant refers to backfilling of the glycerol dehydrogenase mutant into Klebsiella pneumoniae with glycerol dehydrogenase deficiency by site-directed mutation of the amino acid at the 245th position of glycerol dehydrogenase from phenylalanine to glutamine, so that the yield of 1,3-propanediol produced by Klebsiella pneumoniae is improved, and the synthesis of byproduct 2,3-butanediol is significantly reduced. BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 A structure diagram for glycerol and acetoin docking with a model active pocket;

[0009] Figure 2 An amino acid conservation analysis diagram for composing an active pocket of glycerol dehydrogenase of M2014574

[0010] Figure 3 Figure 1 is a map of pET-nar plasmid. DETAILED DESCRIPTION

[0011] The application will be further described in connection with the following specific examples. It should be understood that the following examples are intended to illustrate the application and are not intended to limit the scope of the application.

[0012] In the example, the formula of the seed culture medium is as follows:

[0013] K2HPO4 3H2O 7g / L, (NH4)2SO4 1g / L, KH2PO4 2g / L, MgCl2 7H2O 0.1g / L, yeast extract 7g / L, trace elements each 0.3ml, and pH adjusted to 7.0.

[0014] In the example, the formula of the seed culture medium is as follows:

[0015] KCl 0.75g / L, NaH2PO4 1.38g / L, (NH4)2SO4 5.35g / L, Na2SO4 0.28g / L, MgSO4 6H2O 0.26g / L, citric acid 0.42g / L, yeast extract 2g / L, trace elements each 0.3ml, glycerol 40g / L, and pH adjusted to 7.0.

[0016] In the example, the formula of the seed culture medium is as follows:

[0017] ZnCl2 34.2g / L, FeCl3 6H2O 2.7g / L, MnCl2 4H2O 10g / L, CuCl2 2H2O 0.85g / L, CoCl2 2H2O 23.8g / L, H3BO3 0.31g / L, Na2MoO4 0.25g / L.

[0018] In the example, the formula of the LB medium is as follows: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, and 1.5% agar powder is additionally added to the solid medium.

[0019] In the example, the method for determining the dry weight of the bacteria in the fermentation broth is as follows:

[0020] 1.0ml of the fermentation broth is diluted 7 times with deionized water as a blank control, and the spectrophotometer wavelength is set to 620nm to read OD. 5ml of the bacterial solution with different bacterial concentrations is centrifuged at 12000rpm to collect the bacteria, and the bacteria are washed with deionized water for more than three times. The bacteria collected after centrifugation are placed on filter paper which has been dried and weighed, and dried at 80°C. The dry weight of the bacteria is weighed and the OD 620The standard curve. The dry weight of the bacteria will then be determined using the bacterial OD... 620 The value is calculated using the standard curve formula.

[0021] Example 1: Structural and conservation analysis of the glycerol dehydrogenase active pocket

[0022] The dhaD gene sequence (LOCUS: 4641343..4642440, complement) from the genome sequence of Klebsiella pneumoniae C2051 (LOCUS: CP073920) registered with NCBI was compared with the genome sequencing results of Klebsiella pneumoniae CCTCCM2014574 (M2014574). The results showed a 100% sequence similarity. The original nucleotide sequence of M2014574 glycerol dehydrogenase is shown in SEQ ID No. 3. Homology modeling of M2014574 glycerol dehydrogenase was performed using Swiss Model. Then, the protein structure was analyzed using the molecular docking software Autodock and the visualization software Pymol. The structural diagrams of the docking of the substrate acetoin and glycerol with the three-dimensional model are attached. Figure 1 It can be seen that its active pocket is mainly composed of Thr120, Asp121, Ala122, Phe245, Asp171, His254, and His271. Since Asp171, His254, and His271 are related to the coordination of zinc ions, they are generally not chosen as mutation sites. Subsequently, conservation analysis was performed on the amino acid sequence of the active pocket of the M2014574 glycerol dehydrogenase, specifically residues from position 120 to 280, as shown in the attached figure. Figure 2 As shown, the results indicate that the amino acid sequence is highly conserved.

[0023] Example 2: Construction of pET-nar plasmid and dhaD gene deletion strain

[0024] Construction of pET-nar plasmid

[0025] Because the T7 promoter inherent in the pET-28a(+) plasmid cannot function in Klebsiella pneumoniae, we modified the promoter of this plasmid. First, the nar promoter sequence is: ctcttgatcgttatcaaatcccacgctgtttcagagcggtataatgcccttaaa. During synthesis, BglII and BamI restriction enzyme sites were added to both ends of the sequence. Then, the nar promoter fragment with restriction sites and the pET-28a(+) plasmid were double-digested with BglII and BamI, ligated using T4 ligase, and finally transformed into E. coli DH5α for amplification to obtain the pET-nar plasmid. The diagram is attached. Figure 3shown.

[0026] Construction of dhaD gene deletion strain

[0027] According to the position of SEQ ID No 3 in M2014574 genome, the dhaD gene in M2014574 genome was knocked out by λ-Red homologous recombination method, and the obtained recombinant bacteria was M2014574AdhaD.

[0028] Example 3, obtaining of mutant enzyme F245Q / GDH and construction of recombinant bacteria

[0029] Obtaining of mutant enzyme F245Q / GDH coding gene

[0030] According to the sequence SEQ ID No 3, the primers SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 and SEQ ID No 7 were designed, wherein SEQ ID No 4 and SEQ ID No 7 were forward primer and reverse primer, SEQ ID No 5 and SEQ ID No 6 were mutated forward primer and reverse primer, and M2014574 genome was used as template for overlap extension PCR amplification, and finally the gene fragment F245Q / dhaD with Xba I and Hind III restriction sites was obtained.

[0031] Construction of recombinant plasmid

[0032] The purified pET-nar plasmid was double digested with Spe I and Hind III restriction enzymes at 37℃ water bath, and the purified gene fragment F245Q / dhaD was double digested with Xba I and Hind III restriction enzymes at 37℃ water bath; after the product was recovered, the gene fragment and the plasmid fragment were connected under the action of T4 ligase at 16℃ environment, and then transformed into E. coli DH5α for amplification, and finally the plasmid was extracted to obtain the recombinant plasmid of overexpressing glycerol dehydrogenase mutant F245Q / GDH.

[0033] Construction of recombinant expression strain dhaDF245Q / M2014574AdhaD

[0034] The recombinant plasmid of the glycerol dehydrogenase mutant F245Q / GDH was transformed into the strain M2014574AdhaD by electroporation, and the transformation product was plated on LB (containing 20 mg / L kanamycin) plates and cultured at 37°C. Part of the single colonies were randomly picked and verified by colony PCR to obtain positive clones. The positive clones were inoculated into 10 mL liquid LB tubes and cultured at 37°C, 200 rpm overnight, and then the bacterial solution was stored at -20°C. Thus, the recombinant expression strain dhaDF245Q / M2014574AdhaD was obtained.

[0035] Example 4, Construction of Wild-type and Other Glycerol Dehydrogenase Mutant Recombinant Expression Strains

[0036] Construction of Wild-type Glycerol Dehydrogenase Expression Strain

[0037] The M2014574 glycerol dehydrogenase encoding gene was obtained by PCR amplification using the primer SEQ ID No 4 and SEQ ID No 7 as forward and reverse primers, and introducing Xba I and Hind III enzyme sites in the full-length sequence amplification. The glycerol dehydrogenase encoding gene was obtained by purification and recovery of the fragment. Then, according to the method shown in Example 3, the wild-type recombinant plasmid was constructed, and the plasmid was transformed into the strain M2014574AdhaD by electroporation to obtain the wild-type expression strain dhaD / M2014574AdhaD.

[0038] Construction of Other Glycerol Dehydrogenase Mutant Expression Strains

[0039] The mutant primers were designed according to the mutation primer construction method shown in Example 3, and the sequence SEQ ID No 3 was used as the forward and reverse primers to introduce T120H, A122K and F245M mutations in the sequence. Then, the M2014574 glycerol dehydrogenase mutant encoding gene was obtained by PCR amplification using the primer as a template. Finally, according to the method shown in Example 3, the mutant recombinant plasmid was constructed, and the plasmid was transformed into the strain M2014574AdhaD by electroporation to obtain the mutant expression strains dhaDT120H / M2014574AdhaD, dhaDA122K / M2014574AdhaD and dhaDF245M / M2014574AdhaD.

[0040] Example 5, Performance of Glycerol Dehydrogenase Wild-type and Mutant Shake Flask Fermentation

[0041] Seed culture

[0042] The foregoing strains were inoculated into test tubes containing 5 mL of liquid LB medium at an inoculation amount of 1%, and incubated at 37°C and 200 rpm for 12 hours, and then inoculated into 250 mL shake flasks containing 50 mL of liquid seed culture medium at an inoculation amount of 1%, and anaerobically cultured for 10 hours.

[0043] Shake flask fermentation

[0044] The cultured seed was inoculated into 250 mL shake flasks at an inoculation amount of 1%, and 3 shake flasks were used for each strain to perform parallel tests, the liquid volume in the shake flasks was 50 mL, the bottle mouth was plugged with a gas-impermeable rubber plug, and the culture was performed at 37°C and 220 rpm for 24 hours. Gas phase detection of metabolites and determination of the OD620 of the fermentation broth were used to determine the cell concentration.

[0045] Table 1 Shake flask fermentation results

[0046]

[0047]

[0048] As can be seen from Table 1, first of all, the lack of glycerol dehydrogenase encoded by dhaD causes the strain M2014574 to be unable to grow normally in the medium with glycerol as the carbon source, after complementation of the dhaD gene, the growth of the strain is restored, but the synthesis of the product 1,3-propanediol does not increase, and in addition, it causes the yield of the byproduct 2,3-butanediol to increase.

[0049] However, after complementation of the glycerol dehydrogenase mutant F245Q / GDH, not only the yield of 1,3-propanediol is increased, but also importantly, the yield of the byproduct 2,3-butanediol is reduced. Compared with the starting strain M2014574, the yield of 1,3-propanediol is increased by 10%, and the secretion of the byproduct 2,3-butanediol is reduced by 49%.

[0050] Table 1 also shows the complementation of the glycerol dehydrogenase mutant at the site, and it is found that mutations at other sites will cause the production of the main product 1,3-propanediol to decrease to varying degrees. SEQUENCE LISTING <110> East China University of Technology <120> Glycerol dehydrogenase mutant and application thereof <130> 2022 / 05 / 13 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 365 <212> PRT <213> (artificial sequence) <400> 1 Met Leu Lys Val Ile Gin Ser Pro Ala Lys Tyr Leu Gin Gly Pro Asp 1 5 10 15 Ala Ala Val Leu Phe Gly Gin Tyr Ala Lys Asn Leu Ala Glu Ser Phe 20 25 30 Phe Val Ile Ala Asp Asp Phe Val Met Lys Leu Ala Gly Glu Lys Val 35 40 45 Val Asn Gly Leu Gin Ser His Asp Ile Arg Cys His Ala Glu Arg Phe 50 55 60 Asn Gly Glu Cys Ser His Ala Glu Ile Asn Arg Leu Met Ala Ile Leu 65 70 75 80 Gln Lys Gin Gly Cys Arg Gly Val Val Gly Ile Gly Gly Gly Lys Thr 85 90 95 Leu Asp Thr Ala Lys Ala Ile Gly Tyr Tyr Gin Lys Leu Pro Val Val 100 105 110 Val Ile Pro Thr Ile Ala Ser Thr Asp Ala Pro Thr Ser Ala Leu Ser 115 120 125 Val Ile Tyr Thr Glu Ala Gly Glu Phe Glu Glu Tyr Leu Ile Tyr Pro 130 135 140 Lys Asn Pro Asp Met Val Val Met Asp Thr Ala Ile Ile Ala Lys Ala 145 150 155 160 Pro Val Arg Leu Leu Val Ser Gly Met Gly Asp Ala Leu Ser Thr Trp 165 170 175 Phe Glu Ala Lys Ala Cys Tyr Asp Ala Arg Ala Thr Ser Met Ala Gly 180 185 190 Gly Gln Ser Thr Glu Ala Ala Leu Ser Leu Ala Arg Leu Cys Tyr Asp 195 200 205 Thr Leu Leu Ala Glu Gly Glu Lys Ala Arg Leu Ala Ala Gln Ala Gly 210 215 220 Val Val Thr Glu Ala Leu Glu Arg Ile Ile Glu Ala Asn Thr Tyr Leu 225 230 235 240 Ser Gly Ile Gly Gln Glu Ser Ser Gly Leu Ala Ala Ala His Ala Ile 245 250 255 His Asn Gly Phe Thr Ile Leu Glu Glu Cys His His Leu Tyr His Gly 260 265 270 Glu Lys Val Ala Phe Gly Thr Leu Ala Gln Leu Val Leu Gln Asn Ser 275 280 285 Pro Met Asp Glu Ile Glu Thr Val Leu Gly Phe Cys Gln Arg Val Gly 290 295 300 Leu Pro Val Thr Leu Ala Gin Met Gly Val Lys Glu Gly He Asp Glu 305 310 315 320 Lys He Ala Ala Val Ala Lys Ala Thr Cys Ala Glu Gly Glu Thr He 325 330 335 His Asn Met Pro Phe Ala Val Thr Pro Glu Ser Val His Ala Ala He 340 345 350 Leu Thr Ala Asp Leu Leu Gly Gin Gin Trp Leu Ala Arg 355 360 365 <210> 2 <211> 1095 <212> DNA <213> (Artificial Sequence) <400> 2 atgctaaaag ttattcaatc tccagccaaa tatcttcagg gtcctgatgc tgctgttctg 60 ttcggtcaat atgccaaaaa cctggcggag agcttcttcg tcatcgccga cgatttcgta 120 atgaagctgg cgggagagaa agtggtgaat ggcctgcaga gccacgatat tcgctgccat 180 gcggaacggt ttaacggcga atgcagccat gcggaaatca accgtctgat ggcgattttg 240 caaaaacagg gctgccgcgg cgtggtcggg atcggcggtg gtaaaaccct cgataccgcg 300 aaggcgatcg gttactacca gaagctgccg gtggtggtga tcccgaccat cgcctcgacc 360 GATGCGCCAA CCAGCGCGCT GTCG GTGATC TACACC G AAGCGGGCGAGTTTGAAGAGTAT 420 CTGATCTATC CGAAAAACC CGGTAT GGTGGTGATGGACACGGCGATTA TC GCCAAAGCG 480 CCGGTACGCCT GCTGGTCTCC GGC ATGGGCGATGC GCTCTCCACCT GGTTCGAGGCC AAA 540 GCTT GCTACG ATGC GCGCGCC ACCAGCATGGCCGGAGGACAGTCCACCGAGGCGCGCTG 600 AGCCTCGCCC GCCTGTGCTA TGATACGCTGCTGGCGGAGGCGAAAAGGCCCGTCTGGCG 660 GC GC AGCCGGGGTAGT GACCGAAGCGCTGGAGCGCATCATCGAGGCGAACACCTATCTC 720 AGCGGC AT TGCC AGGAAAGC AGTGGCCTG GCCGCTGCCACGCAATCCACAACGGTTTC 780 ACC ATTC TTG AAGAGTGC ATCACCT GTATCACGGTGAGAAAGTGGCCTTCGGTACCC 840 GC GC AGCTGGTGCTGC AGCACCCCGATGGACGAGAT GAAACGGTGCTGGGCTTCTGC 900 CAGCGCGTCGGCCTGCCGGTGACGCTCGCGCAGATGGGCGTCAAAGAGGGGATCGACGAG 960 AAAATCGCCGCGGTGGCGAAAGCCACCTGCGCGGAAGGGGAAACCATCATAATATGCCG 1020 TTT GC GGTGACCCCGGAGAGCGTCC ATGC CGCTATCCTCACCGCCGATCTGTTAGGCC AG 1080 cagtggctgg cgcgt 1095 <210> 3 <211> 1095 <212> DNA <213> Klebsiella pneumoniae <400> 3 atgctaaaag ttattcaatc tccagccaaa tatcttcagg gtcctgatgc tgctgttctg 60 ttcggtcaat atgccaaaaa cctggcggag agcttcttcg tcatcgccga cgatttcgta 120 atgaagctgg cgggagagaa agtggtgaat ggcctgcaga gccacgatat tcgctgccat 180 gcggaacggt ttaacggcga atgcagccat gcggaaatca accgtctgat ggcgattttg 240 caaaaacagg gctgccgcgg cgtggtcggg atcggcggtg gtaaaaccct cgataccgcg 300 aaggcgatcg gttactacca gaagctgccg gtggtggtga tcccgaccat cgcctcgacc 360 gatgcgccaa ccagcgcgct gtcggtgatc tacaccgaag cgggcgagtt tgaagagtat 420 ctgatctatc cgaaaaaccc ggatatggtg gtgatggaca cggcgattat cgccaaagcg 480 ccggtacgcc tgctggtctc cggcatgggc gatgcgctct ccacctggtt cgaggccaaa 540 gcttgctacg atgcgcgcgc caccagcatg gccggaggac agtccaccga ggcggcgctg 600 agcctcgccc gcctgtgcta tgatacgctg ctggcggagg gcgaaaaggc ccgtctggcg 660 gcgcaggccg gggtagtgac cgaagcgctg gagcgcatca tcgaggcgaa cacttatctc 720 agcggcattg gctttgaaag cagtggcctg gccgctgccc acgcaatcca caacggtttc 780 accattcttg aagagtgcca tcacctgtat cacggtgaga aagtggcctt cggtaccctg 840 gcgcagctgg tgctgcagaa cagcccgatg gacgagattg aaacggtgct gggcttctgc 900 cagcgcgtcg gcctgccggt gacgctcgcg cagatgggcg tcaaagaggg gatcgacgag 960 aaaatcgccg cggtggcgaa agccacctgc gcggaagggg aaaccatcca taatatgccg 1020 tttgcggtga ccccggagag cgtccatgcc gctatcctca ccgccgatct gttaggccag 1080 cagtggctgg cgcgt 1095 <210> 4 <211> 59 <212> DNA <213> (Artificial Sequence) <400> 4 gctctagaag tttgataact ttaaggaggt tgaatactag tacagtgatc gcactgctc 59 <210> 5 <211> 28 <212> DNA <213> (Artificial Sequence) <400> 5 atctcagcgg cattggccag gaaagcag 28 <210> 6 <211> 18 <212> DNA <213> (Artificial sequence) <400> 6 gccaatgccg ctgagata 18 <210> 7 <211> 29 <212> DNA <213> (Artificial sequence) <400> 7 cccaagcttg cgttgtacca tagagaacc 29

Claims

1. A glycerol dehydrogenase mutant F245Q / GDH, characterized in that... Its amino acid sequence is shown in SEQ ID No.

1.

2. The application of the glycerol dehydrogenase mutant as described in claim 1 in the production of 1,3-propanediol, characterized in that, Introducing the glycerol dehydrogenase mutant into glycerol dehydrogenase-deficient Klebsiella pneumoniae can increase the yield of 1,3-propanediol from glycerol conversion while reducing the production of the byproduct 2,3-butanediol.

Images