Kit for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography and preparation method thereof

Abstract

The present invention relates to a reagent for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography and a preparation method thereof, and belongs to the field of biological detection technology. The reagent comprises an immunochromatographic test paper and a magnetic nanoparticle capture reagent, which are composed of a sample pad, a glass fiber pad, a nitrocellulose detection membrane and a water-absorbing pad overlapped in sequence and attached to a bottom lining card, wherein the nitrocellulose detection membrane is coated with a quality control line of rabbit anti-E1 protein polyclonal antibody and a detection line of Eastern equine encephalitis virus E1 protein, and the magnetic nanoparticle capture reagent is a ferroferric oxide magnetic nanoparticle labeled with Eastern equine encephalitis virus E1 protein. The reagent provided by the present invention is prepared using the prepared Eastern equine encephalitis virus E1 protein antigen, can be effectively used to detect Eastern equine encephalitis virus antibodies, has high sensitivity and strong specificity, is reliable and stable in detection results, can be judged by naked eye observation, and can be judged without the need for an instrument, and is easy to use.

Description

Technical Field

[0001] The invention relates to a detection kit for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography and a preparation method thereof, belonging to the technical field of biological detection. Background Art

[0002] Eastern equine encephalitis (EEE) is a typical zoonotic viral disease. The virus belongs to the genus Alphavirus of the family Togaviridae of group A arboviruses and contains single-stranded RNA. It was named because the virus was first isolated from the brain tissue of sick horses. The same virus was subsequently isolated from the brain tissue of patients. The symptoms of human encephalitis caused by it are very critical and dangerous. Its clinical manifestations are very similar to those of Japanese encephalitis, and the mortality rate is about 35%. The typical manifestations of the disease are rapid onset of flu-like symptoms, such as headache and fever, and even convulsions, impaired consciousness and meningeal irritation. If left untreated, it is accompanied by damage to the central nervous system and poor prognosis, which may lead to death in 35% of cases. The prognosis of Eastern equine encephalitis is related to the scope of the lesion and the severity of the disease. When the brain lesions are more limited and do not invade the "life center", the prognosis is often good when the disease is mild. If the coma lasts for a long time or there are frequent convulsions, brain hypoxia and pathological changes will worsen, the prognosis will be poor, and neurological and psychiatric sequelae will easily remain.

[0003] Eastern equine encephalitis virus (EEEV) is transmitted from horses to humans through the bites of infected mosquitoes; the incubation period is approximately between May and 15. The main transmission chain is between birds and mosquitoes. There are a certain number of patients with encephalopathy in Fujian Province from the turn of summer to the end of autumn and the beginning of winter. The cause is unknown, and laboratory diagnosis is not yet widely available, which causes great difficulties in clinical practice, especially in neurology, and misdiagnosis and mistreatment are also common. How to develop a rapid and effective Eastern equine encephalitis virus antibody detection reagent is imminent. Summary of the invention

[0004] 1. Technical issues to be resolved

[0005] In order to solve the above problems in the prior art, the present invention provides a kit for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography and a preparation method thereof.

[0006] (II) Technical solution

[0007] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0008] A kit for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography comprises an immunochromatography test paper and a magnetic nanoparticle capture reagent, wherein a sample pad, a glass fiber pad, a nitrocellulose detection membrane and a water-absorbing pad are overlapped in sequence and attached to a bottom liner card, wherein the nitrocellulose detection membrane is coated with a quality control line of rabbit anti-E1 protein polyclonal antibody and a detection line of Eastern equine encephalitis virus E1 protein, and the magnetic nanoparticle capture reagent is ferroferric oxide magnetic nanoparticles labeled with Eastern equine encephalitis virus E1 protein.

[0009] In the kit as described above, preferably, the amino acid sequence of the Eastern equine encephalitis virus E1 protein is as shown in SEQ ID NO.1.

[0010] In the kit as described above, preferably, the expression of the Eastern equine encephalitis virus E1 protein is carried out using the gene sequence shown in SEQ ID NO.2.

[0011] In the above-mentioned kit, preferably, the sample pad is a glass fiber membrane soaked in a treatment solution containing Tween-80.

[0012] In the above-mentioned kit, preferably, the glass fiber mat is a glass fiber membrane soaked in a solution containing 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100.

[0013] When the glass fiber pad in the immunochromatographic test paper is not treated, a few test strips will show false positives when the diluent of the sample to be tested is added. A large number of experiments have verified that when the glass fiber pad is soaked in a solution of 0.1% Tris base, 1.5% BSA and 2% Triton X-100, the occurrence of false positives is effectively avoided.

[0014] A method for preparing a reagent for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography, comprising the following steps:

[0015] S1, after carboxylation of ferroferric oxide magnetic nanoparticles, adding Eastern equine encephalitis virus E1 protein for labeling, to obtain Eastern equine encephalitis virus E1 protein labeled ferroferric oxide magnetic nanoparticle capture reagent;

[0016] S2, soaking the glass fiber membrane in the heavy suspension and drying it to obtain a glass fiber mat;

[0017] S3. A quality control line and a detection line are provided on the nitrocellulose membrane, the quality control line is coated with rabbit anti-E1 protein polyclonal antibody, and the detection line is coated with Eastern equine encephalitis virus E1 protein, to obtain a nitrocellulose detection membrane;

[0018] S4, immersing the glass fiber membrane in a treatment solution containing Tween-80, taking it out and drying it to obtain a sample pad;

[0019] S5. Overlap the sample pad, glass fiber pad, nitrocellulose test membrane, and absorbent pad in sequence and stick them on the backing card. Cover the absorbent pad on one end of the nitrocellulose test membrane close to the quality control line, and cover the glass fiber pad on the other end close to the test line.

[0020] In the preparation method as described above, preferably, in step S1, the particle size of the ferroferric oxide magnetic nanoparticles is 20 nm, and the carboxylation is performed using a glutaraldehyde solution with a mass fraction of 30%.

[0021] The preparation method as described above, preferably, in step S1, the concentration of the Eastern equine encephalitis virus E1 protein label is 1.8 mg / mL, the reaction time during labeling is 2.5 h, the solution is discarded after magnetic adsorption, and then a 0.75% BSA solution is added, and the mixture is shaken and sealed for 30 minutes; the solution is discarded after magnetic adsorption, and PBS containing 0.05% Tween-20 at a concentration of 0.01 mol / L is added for washing; and a resuspension is added to obtain an E1 protein-labeled ferroferric oxide magnetic nanoparticle capture reagent solution, wherein the resuspension contains a solution of 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100.

[0022] A large number of experiments have shown that if a solution containing 0.75% BSA is not used for blocking, non-specific bands will appear, resulting in false positive results.

[0023] In the preparation method as described above, preferably, the Eastern equine encephalitis virus E1 protein is obtained by expressing a gene sequence such as SEQ ID NO.2.

[0024] In the preparation method as described above, preferably, in step S2, the resuspension solution is a solution containing 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100.

[0025] In the preparation method as described above, preferably, in step S3, the coating concentration of the rabbit anti-E1 protein polyclonal antibody is 2.2 mg / mL and the coating concentration of the Eastern equine encephalitis virus E1 protein is 1.8 mg / mL.

[0026] The present invention obtains a reagent for rapid detection of Eastern equine encephalitis virus antibodies by wet immunochromatography through a large number of experimental verifications. A magnetic nanoparticle capture reagent is used as a ferroferric oxide magnetic nanoparticle labeled with Eastern equine encephalitis virus E1 protein, and the adsorption of a magnet plays an enrichment role. The serum to be tested is added to the magnetic nanoparticle capture reagent. If there are antibodies produced by infected Eastern equine encephalitis virus in the serum to be tested, the antibodies will bind to the Eastern equine encephalitis virus E1 protein, and the Eastern equine encephalitis virus E1 protein is coated on the ferroferric oxide magnetic nanoparticles. Through the effect of magnetic adsorption of a magnetic frame, the complex of antibody-Eastern equine encephalitis virus E1 protein-ferroferric oxide magnetic nanoparticles will be adsorbed, and the serum is discarded at this time to achieve the purpose of enriching antibodies. The complex is then redissolved in 100 μL buffer, added to the sample addition hole of the above-prepared immunochromatographic test paper, and the detection sensitivity is effectively improved by magnet adsorption enrichment. The present invention also treats the sample pad, and through a large number of experiments, it is found that the sample pad treated with 0.05 mol / L PBS containing 3% Tween-80 can effectively avoid the occurrence of false negatives. When an untreated sample pad is used for serum detection, incomplete binding with the antigen on the strip will occur, resulting in the occurrence of false negatives.

[0027] The present invention has found through a large number of experimental studies that when the magnetic nanoparticle capture reagent adopts a resuspension solution with a weight percentage of 0.1% Tris base, 1.5% BSA and 2% Triton X-100, the optimal magnetic particle dispersion is obtained by using the resuspension solution with this ratio, and the appearance of non-specific bands can be effectively avoided, thereby avoiding false positives.

[0028] (III) Beneficial effects

[0029] The beneficial effects of the present invention are:

[0030] The present invention provides an Eastern equine encephalitis virus E1 protein, which can be used as an antigen for preparing an Eastern equine encephalitis virus antibody immune reagent. The Eastern equine encephalitis virus E1 protein-prepared magnetic nanoparticle immunochromatography reagent for rapid Eastern equine encephalitis virus antibody detection has high detection sensitivity and specificity, and can be effectively used for the detection of positive antibodies produced after infection with Eastern equine encephalitis virus.

[0031] The magnetic nanoparticle immunochromatography kit for rapid detection of Eastern equine encephalitis virus antibodies provided by the present invention is prepared by using the prepared Eastern equine encephalitis virus E1 protein antigen. The immunochromatography reagent is used for detecting Eastern equine encephalitis virus antibodies.

[0032] The magnetic nanoparticle immunochromatographic reagent for detecting Eastern equine encephalitis virus antibodies provided by the present invention can capture more test objects in the system through magnetic adsorption enrichment, and improve the detection sensitivity through enrichment. The reagent cost is low, the detection reagent solution is stable, the specificity is strong, the sensitivity is high, and the sensitivity is 10 times higher than that of the colloidal gold detection result. The detection result is accurate and reliable, the operation is simple, and strong professional skills are not required for operation. The detection result can be judged by naked eye observation, and it can be judged without instruments, and it is easy to use. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The electrophoresis results of induced bacterial solution and uninduced bacterial solution;

[0034] Figure 2 This is the electrophoresis result of purified recombinant E1 antigen protein;

[0035] Figure 3 The results of testing positive samples using the magnetic nanoparticle immunochromatographic rapid detection reagent for Eastern equine encephalitis virus antibodies prepared by the present invention;

[0036] Figure 4 This is the result of testing positive samples using colloidal gold chromatography test paper. DETAILED DESCRIPTION

[0037] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation modes in conjunction with the accompanying drawings. If not particularly explained in the following embodiments, conventional technical methods in the art are adopted.

[0038] Example 1 Preparation of recombinant Eastern equine encephalitis virus E1 protein antigen

[0039] (1) Construction of recombinant plasmid

[0040] The nucleotide sequence of Eastern equine encephalitis virus E1 protein (GNnBank sequence number: AAF04801.1) was selected, and the gene sequence was modified according to the preferred codons of Escherichia coli O127:H6. After a large number of experimental studies, a higher expression efficiency was obtained, and the exogenous protein expression efficiency reached more than 75%. The secondary structure of the recombinant protein was screened by bioinformatics, and the optimized gene sequence was obtained as shown in SEQ ID NO.2, and its corresponding amino acid sequence was shown in SEQ ID NO.1. Shanghai Shenggong Company was commissioned to synthesize the optimized gene sequence (SEQ ID NO.2), and the gene was cloned into the expression vector pNT30a to obtain the recombinant plasmid. Experimental studies have shown that if the unoptimized gene sequence is used for recombinant expression, the recombinant protein cannot be obtained.

[0041] SEQ ID NO.1: YGHEVYNYDFPEYGTGKAGSFGDLQSRTPTSNDLYANTNLKLQRPQPGVVHTPYTQAPSGFERWKKDRGAPLNDIAPFGCTIALDPLRAENCAVGNIPLSIDIPDAAFTRIAETPTVSDLECKVTECTYASDFGGIATISYKASKSGNCPIHSPSGIAVIKENDVTLVDSGAFTFHFSTASIHPAFKMQVCTSVVTCKGDCKPPKDHIVDYPAQHTETYTSAVS

[0042] SEQ ID NO.2: TATGGTCACGAGGTGTACAATTATGACTTTCCAGAATACGGCACTGGCAAAGCCGGTTCCTTTGGTGATCTGCAATCCCGTACTCCGACCAGCAACGACTTGTACGCCAATACTAACCTGAAGTTGCAACGTCCACAACCAGGTGTCGTCCATACGCCTTATACCCAGGCGCCATCCGGCTTCGAACGCTGGAAGAAAGACCGTGGCGCTCCATTGAATGACATCGCTCCATTTGGCTGCACGATTGCTCTCGACCCTCTGCGTGCGGAGAACTGCGCTGTGGGCAACATCCCACTTTCTATCGACATCCCGGATGCCGCATTTACCCGCATCGCAGAGACGCCGACTGTGTCCGACCTGGAATGCAAGGTTACTGAGTGCACCTACGCATCCGACTTCGGTGGTATTGCCACCATCAGCTATAAGGCAAGCAAATCTGGTAACTGCCCGATTCACTCGCCGTCTGGCATTGCAGTAATCAAAGAAAACGATGTTACTCTGGTAGACAGCGGTGCCTTCACGTTTCACTTCTCTACTGCCAGCATCCACCCGGCATTCAAGATGCAGGTGTGTACTAGCGTAGTTACCTGCAAAGGTGACTGTAAGCCACCAAAGGATCACATTGTCGATTACCCGGCTCAACACACTGAAACGTACACGTCCGCAGTATCC。

[0043] (2) Expression and identification of recombinant protein

[0044] The recombinant plasmid with correct sequencing was transformed into Escherichia coli BL21, and the single colony with correct identification was inoculated into LB liquid culture medium containing ampicillin at a concentration of 10 μg / mL, and cultured at 37°C overnight. The next day, it was inoculated into a new LB liquid culture medium containing ampicillin at a ratio of 1:100 and cultured with shaking until OD600 reached 0.75, then the bacterial solution temperature was cooled to 23°C, IPTG was added to make its final concentration 0.75 mmol / L, and induced expression was performed at 23°C; and 1 mL of bacterial solution was aspirated after 6 hours, ultrasonically lysed, the bacterial solution was collected, boiled in a water bath for 10 minutes, centrifuged at 4°C and 12000r / min for 3 minutes, placed on ice, and the supernatant and precipitate were aspirated for 12% SDS-PAGN electrophoresis detection; after the electrophoresis, the gel was stained with Coomassie Brilliant Blue for 90 minutes, and then decolorized for 2 hours to observe the protein induced expression. The results are as follows Figure 1 As shown, from left to right in the figure, the first band M is Mark, the second band is the band of bacterial solution precipitation after induction, and the third band is the band of bacterial solution precipitation without induction. The results show that the target protein appears in the precipitate, which is about 25KD in size.

[0045] 1.3 Purification of recombinant protein

[0046] 2 mL of induced expression bacterial solution was taken and centrifuged at 4°C, 12000 r / min for 30 minutes, the cell pellet was collected, washed three times with 0.01M pH7.4 PBS, suspended in pH8.0 lysis buffer (Tris-NaCl), sonicated, and the precipitate after centrifugation was suspended in pH8.0 urea with a concentration of 7 mol / L, placed on ice and shaken for 2 hours to dissolve the inclusion bodies, centrifuged at 12000 r / min for 30 minutes, the supernatant was filtered through a 0.22 μm filter membrane and purified using a His Trap TMHP (histidine) affinity adsorption column purification system, and the purity was identified by SDS-PAGN. Finally, the purified protein was dialyzed into 0.01 mol / L, pH7.4 PBS, concentrated by PNG-20000, and a purified recombinant protein with a molecular weight of about 25 KD was obtained. The results are as follows: Figure 2 As shown, from left to right in the figure, the purified recombinant protein is marked as 54, and M is Mark. 2 mg of the purified recombinant protein was taken to prepare polyclonal antibodies, and rabbits were immunized by conventional methods to obtain positive rabbit serum, which was purified to obtain rabbit anti-E1 protein polyclonal antibodies.

[0047] Example 2 Preparation of a reagent for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography

[0048] S1. Magnetic nanoparticle capture reagent: Take 200 μL of ferroferric oxide magnetic nanoparticle solution with a particle size of 20 nm and a concentration of 2.5 mg / mL, and use 150 μL of 30% glutaraldehyde solution to carboxylate the ferroferric oxide magnetic nanoparticles for 1.5 h; then wash it with PBS solution for 3 times, discard the supernatant solution after magnetic adsorption, add 500 μL of Eastern equine encephalitis virus E1 protein prepared in Example 1 with a concentration of 1.8 mg / mL to the ferroferric oxide magnetic nanoparticles, and shake and incubate for 2.5 h; after magnetic adsorption, discard the solution, add 800 μL of 0.75% BSA, shake and incubate for 30 min, and block; after magnetic adsorption, discard the solution, add PBS containing 0.05% Tween-20 with a concentration of 0.01 mol / L 1 mL, wash 3 times; add 1 mL of resuspension solution to obtain E1 protein labeled iron oxide magnetic nanoparticle capture reagent solution, wherein the resuspension solution contains 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100 solution, mix well and store at 4°C.

[0049] S2. Preparation of glass fiber mat: soak the glass fiber in a heavy suspension containing 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100 for 30 minutes, take it out, dry it in an oven at 37°C for 3 hours, and then set it aside for use.

[0050] S3. Preparation of nitrocellulose test membrane: 2.2 mg / mL rabbit anti-E1 protein polyclonal antibody and 1.8 mg / mL Eastern equine encephalitis virus E1 protein prepared in Example 1 were diluted with coating buffer to prepare the quality control line coating solution (C) and the test line coating solution (T). The quality control line and the test line working solution were streaked onto the nitrocellulose membrane using a coating machine, and dried in a drying oven at 37°C and stored dry. The coating buffer was PBS with a pH of 7.4 and 0.01M.

[0051] S4. Sample pad treatment: The glass fiber was immersed in a 0.05 mol / L PBS treatment solution containing 3% Tween-80 for 1 hour, and then dried at 37°C for 2.5 hours to obtain a sample pad.

[0052] S5. Assemble into detection reagents:

[0053] The sample pad, glass fiber pad, nitrocellulose test membrane, and absorbent pad are sequentially pasted on the PVC base plate, wherein the end of the nitrocellulose test membrane close to the quality control line is covered with the absorbent pad, and the other end close to the test line is covered with the glass fiber pad. The immunochromatographic test paper with a width of 4 mm is cut and finally the immunochromatographic test paper is loaded into the card shell to obtain the test reagent card. The absorbent pad is absorbent paper or pure cotton lint filter paper.

[0054] When testing Eastern equine encephalitis virus antibodies, take 800 μL of the serum sample to be tested and add 20 μL of magnetic nanoparticle capture reagent, mix well, and place on the magnetic stand after 5 minutes. After 1 minute, the magnetic beads are enriched near the magnetic field, and the liquid is discarded. Then 100 μL of 0.01M PBS is added to resuspend the magnetic nanoparticle capture reagent, and then all are dripped on the sample pad. Then 100 μL of TMB application solution (containing a solution with a TMB content of 5 mg / ml and a molar concentration of hydrogen peroxide of 0.8 m mol / L) is dripped on the sample pad, and the result is judged after 8 minutes. If only the quality control band appears brown-yellow, the result is negative, indicating that the serum sample to be tested does not contain Eastern equine encephalitis virus antibodies; if both the quality control band and the test band appear brown-yellow, the result is positive, indicating that the serum sample to be tested contains Eastern equine encephalitis virus antibodies; if neither of the two bands is colored or only the test band is colored, it means that the detection reagent has expired and the result is invalid.

[0055] The invention discloses a magnetic ferroferric oxide nanoparticle capture reagent labeled with Eastern equine encephalitis virus E1 protein, and a detection reagent strip with rabbit anti-E1 protein polyclonal antibody as a quality control line and Eastern equine encephalitis virus E1 protein as a detection line for detecting Eastern equine encephalitis virus antibodies.

[0056] Example 3 Sensitivity Detection

[0057] The Eastern equine encephalitis virus E1 protein-labeled ferroferric oxide magnetic nanoparticle capture reagent prepared in Example 2, a detection reagent strip with rabbit anti-E1 protein polyclonal antibody as the quality control line and Eastern equine encephalitis virus E1 protein as the detection line, was used to detect a positive serum sample of Eastern equine encephalitis virus antibody. The sample was diluted 10 times with PBS solution, and the sample volume was 100 μL. The ferroferric oxide magnetic nanoparticle capture reagent labeled with Eastern equine encephalitis virus E1 protein was directly added to perform detection. The detection results showed that 10 -1 -10 -7 The results of the gradient dilution samples were all positive, 10 -8 The sample diluted 100 times is negative, see Figure 3 In the figure shown, 1-8 are 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 Serial dilution of samples.

[0058] At the same time, as a comparison: the colloidal gold chromatography test paper was prepared using the Eastern equine encephalitis virus E1 protein prepared in Example 1, which was prepared using a conventional method, and the colloidal gold particles were labeled with SPA. The detection band on the nitrocellulose membrane was coated with the Eastern equine encephalitis virus E1 protein antigen, and the quality control band was coated with goat anti-mouse IgG; the obtained colloidal gold immunochromatographic test paper was used to detect the positive samples of Eastern equine encephalitis disease after being diluted 10 times with PBS solution, and the sample volume was 50 μL. The test results showed that 10 -1 -10 -6 The results of the gradient dilution of the positive sample are shown in Figure 4 As shown, 1-8 in the figure are 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 Gradient dilution of samples. Under the same conditions, the test results show that the magnetic nanoparticle immunochromatographic rapid detection of Eastern equine encephalitis virus antibodies of the present invention has a higher sensitivity than the colloidal gold chromatography test paper, and the sensitivity is increased by 10 times.

[0059] Example 4 Specificity Detection

[0060] The ferroferric oxide magnetic nanoparticle capture reagent labeled with the Eastern equine encephalitis virus E1 protein prepared by the method of Example 2, the detection reagent strip with rabbit anti-E1 protein polyclonal antibody as the quality control line and Eastern equine encephalitis virus E1 protein as the detection line and the commercialized American Focus company arbovirus immunofluorescence slide were used to simultaneously detect 30 normal human sera, and the detection results of the two methods were all negative (-) results; at the same time, specific samples: Chikungunya fever positive serum, plague positive serum, influenza A virus positive serum, yellow fever virus positive serum, dengue virus positive serum and Japanese encephalitis positive serum (the above positive sera were provided by the Health Quarantine Laboratory of the China Customs Science and Technology Research Center) were detected, and the detection results of the two methods were all negative (-) results, indicating that the magnetic nanoparticle immunochromatography rapid detection of Eastern equine encephalitis virus antibodies prepared by the present invention has accurate results and strong specificity.

[0061] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any person skilled in the art can use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A kit for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography, characterized in that: The invention comprises an immunochromatographic test paper and a magnetic nanoparticle capture reagent, which are composed of a sample pad, a glass fiber pad, a nitrocellulose detection membrane and a water-absorbing pad overlapped in sequence and attached to a bottom lining card, wherein the nitrocellulose detection membrane is coated with a quality control line of a rabbit anti-E1 protein polyclonal antibody and a detection line of the Eastern equine encephalitis virus E1 protein, and the magnetic nanoparticle capture reagent is ferroferric oxide magnetic nanoparticles marked with the Eastern equine encephalitis virus E1 protein; the expression of the Eastern equine encephalitis virus E1 protein is carried out by using a gene sequence as shown in SEQ ID NO.2; The amino acid sequence of the Eastern equine encephalitis virus E1 protein is shown in SEQ ID NO.1; The sample pad is a glass fiber membrane that has been soaked in a treatment solution containing Tween-80; The glass fiber mat is a glass fiber membrane soaked in a solution containing 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100.

2. A method for preparing a reagent for rapid detection of Eastern equine encephalitis virus antibodies by magnetic nanoparticle immunochromatography, characterized in that: It includes the following steps: S1. After carboxylation of ferroferric oxide magnetic nanoparticles, Eastern equine encephalitis virus E1 protein was added for labeling, wherein the concentration of Eastern equine encephalitis virus E1 protein labeling was 1.8 mg / mL, and the reaction time during labeling was 2.5 h. After magnetic adsorption, the solution was discarded, and a 0.75% BSA solution was added, and the mixture was shaken and sealed for 30 minutes; after magnetic adsorption, the solution was discarded, and PBS containing 0.05% Tween-20 at a concentration of 0.01 mol / L was added for washing; a resuspension solution was added to obtain a ferroferric oxide magnetic nanoparticle capture reagent labeled with Eastern equine encephalitis virus E1 protein; The resuspension solution is a solution containing 0.1% by weight of Tris base, 1.5% by weight of BSA and 2% by weight of Triton X-100; The Eastern equine encephalitis virus E1 protein is obtained by expressing and preparing the gene sequence such as SEQ ID NO.2; S2, soaking the glass fiber membrane in the heavy suspension and drying it to obtain a glass fiber mat; S3. A quality control line and a detection line are provided on the nitrocellulose membrane, the quality control line is coated with rabbit anti-E1 protein polyclonal antibody, and the detection line is coated with Eastern equine encephalitis virus E1 protein, to obtain a nitrocellulose detection membrane; S4, immersing the glass fiber membrane in a treatment solution containing Tween-80, taking it out and drying it to obtain a sample pad; S5. Overlap the sample pad, glass fiber pad, nitrocellulose test membrane, and absorbent pad in sequence and stick them on the backing card. Cover the absorbent pad on one end of the nitrocellulose test membrane close to the quality control line, and cover the glass fiber pad on the other end close to the test line. In step S1, the particle size of the ferroferric oxide magnetic nanoparticles is 20 nm, and the carboxylation is carried out using a glutaraldehyde solution with a mass fraction of 30%; In step S3, the coating concentration of the rabbit anti-E1 protein polyclonal antibody is 2.2 mg / mL, and the coating concentration of the Eastern equine encephalitis virus E1 protein is 1.8 mg / mL.

Images