Method for enhancing performance of methane synthesized by CO2 microbial electrochemical conversion based on quorum sensing

Abstract

The invention discloses a method for enhancing the performance of methane synthesis through CO2 microbial electrochemical conversion based on quorum sensing, which comprises the following steps: adding an exogenous quorum sensing signal molecule octanoyl-L-homoserine lactone C8-HSL into a cathode chamber of a microbial electrolysis cell MEC, firstly inoculating an aqueous solution containing anaerobic microorganisms into the cathode chamber, and domesticating; forming a cathode biological membrane on the cathode electrode as a biological cathode; and then under the conditions that the cathode liquid in the cathode chamber is subjected to aeration of high-purity CO2 and quorum sensing signal molecules are added, a direct-current power supply provides external voltage to carry out a reaction for synthesizing methane by electrochemical conversion of CO2. According to the method for improving the performance of synthesizing methane from CO2 by adding the exogenous quorum sensing signal molecules into the culture medium of the microbial electrosynthesis system, the addition of the signal molecules not only can promote the growth of a biological membrane, improve the stability of the biological membrane and shorten the starting time of a reactor system, but also can directionally regulate and control florae and improve the abundance of the florae; meanwhile, the methane yield of the system is improved.

Description

Technical Field

[0001] The present invention belongs to the field of microbial electrochemistry, and specifically relates to a method for enhancing CO 2 Methods for synthesizing methane through electrochemical conversion of microorganisms. Background Art

[0002] Currently achieving CO 2 The main methods of resource utilization include the following: biological fixation conversion, electrochemical reduction, photocatalytic conversion and catalytic hydrogenation reduction.

[0003] Microbial electrolysis cells (MECs) can effectively utilize microorganisms adsorbed on electrodes to catalyze CO 2 The electrons and H generated by the MEC anode through oxidation are converted into energy substances or chemicals. + , are transferred to the cathode through the external circuit and the proton membrane, where the carbon dioxide reduction reaction occurs, consuming electrons and H + , and produce valuable organic substances such as formic acid, glycerol, acetic acid, butyric acid and methane.

[0004] Chinese patent CN110284150A discloses a method for promoting microbial electrochemical conversion of carbon dioxide to produce methane, 1) constructing a microbial electrolysis cell comprising a cathode pool and an anode pool, wherein a graphite felt electrode or a carbon cloth electrode and an Ag / AgCl electrode are provided in the cathode pool as a reference electrode, and a platinum counter electrode is provided in the anode pool, and the reactor is separated by a proton membrane; 2) methanogenic bacteria culture medium is added to both the cathode pool and the anode pool; 3) redox substances are added to the cathode pool; 4) a voltage of -0.6V to -1.0V (vs SHE) is applied to the cathode pool. The methane yield is promoted by adding redox substances to the cathode solution, and the methane yield can reach up to 0.824μmol / h. CN116641072A discloses a method for strengthening microbial electrosynthesis to realize carbon dioxide resource utilization. The yield of methane is also promoted by redox substances in a double-chamber reaction tank. However, unlike the former, this invention mainly improves the generation rate of methane and other substances by modifying redox substances on ordinary electrodes. The methane production rate of carbon felt biocathode modified with neutral red can reach 5.8 μmol / h, and the methane production rate of carbon felt biocathode modified with anthraquinone sulfonic acid can reach 3.5 μmol / h. It can be seen from the above two patents that the current microbial electrochemical conversion of carbon dioxide to methane still has the problem of low yield, which is a major factor limiting the industrial development of microbial electrochemical conversion of carbon dioxide to methane.

[0005] Quorum sensing (QS) is a form of communication between microorganisms. Studies have shown that QS may change their behavior through "communication" between cells through signal molecules. When the signal molecule reaches a certain value, it induces the expression of specific genes, activates related population behaviors, and can also change the community structure of microorganisms, thereby improving the performance of biofilms. Among them, N-acyl homoserine lactone compounds are typical signal molecules that can be secreted by Gram-negative bacteria. For example, octanoyl-L-homoserine lactone can often be detected in anaerobic ammonia oxidation systems. Summary of the invention

[0006] The current microbial electrochemical conversion of CO 2 The purpose of the present invention is to provide a quorum sensing signal molecule N-acyl homoserine lactone to enhance CO production. 2 A method for the electrochemical conversion of microorganisms to synthesize methane. The signal molecule octanoyl-L-homoserine lactone (C8-HSL) can promote the growth of biofilms, improve the stability of biofilms, shorten the startup time of the reactor system, and can also directionally regulate the bacterial community, improve the abundance of the bacterial community, and at the same time increase the methane yield of the system.

[0007] In order to achieve the above-mentioned invention object, the technical solution adopted by this technology is: A quorum sensing-based CO 2 The method for synthesizing methane by electrochemical conversion of microorganisms comprises the following steps: 1) Acclimation and start-up of biocathode The microbial electrolysis cell MEC, which is divided into a cathode chamber and an anode chamber by a proton exchange membrane, is used for domestication. The cathode liquid added to the cathode chamber includes a nutrient medium, which is mainly an inorganic salt medium, wherein trace vitamins and trace minerals are added to meet the basic conditions for the growth of cathode microorganisms. An aqueous solution containing anaerobic microorganisms and a quorum sensing signal molecule N-acyl homoserine lactone are added to the nutrient medium in the cathode chamber. High-purity CO is added to the cathode liquid. 2 Aeration is performed; the anolyte added to the anode chamber is an inorganic salt culture medium; The cathode chamber uses a hydrophilic carbon cloth as an electrode, and the anode chamber uses a conductive material as an electrode and is connected to a DC power supply through a wire. The DC power supply provides an applied voltage to start the microbial electrolysis cell for domestication, so that a cathode biofilm is formed on the cathode electrode as a biological cathode; 2) Electrochemical reaction operation of microbial electrolysis cell MEC Step 1) After the biocathode is tamed, the cathode liquid added to the cathode chamber is aerated high-purity CO 2A nutrient medium containing the quorum sensing signal molecule N-acyl homoserine lactone is added, and the anode liquid added to the anode chamber is an inorganic salt medium. A DC power supply is used to provide an external voltage for electrochemical conversion of CO 2 The reaction of synthesizing methane.

[0008] Furthermore, the quorum sensing signal molecule N-acyl homoserine lactone is octanoyl-L-homoserine lactone C8-HSL; in step 1) or step 2), the final concentration of C8-HSL added to the cathode liquid is 5-20 μM, preferably 10-15 μM.

[0009] Furthermore, the electrode in the anode chamber in step 1) is a graphite sheet, and a silver-silver chloride reference electrode is set in the cathode liquid of the microbial electrolysis cell MEC; the external voltage provided by the power supply in step 1) or step 2) is -0.5~-1.5V, preferably -0.8~-1.2V.

[0010] Furthermore, the formula of the inorganic salt culture medium is: 0.31g / L NH 4 Cl, 0.13 g / L KCl, 2.77 g / L NaH 2 PO 4 ·2H 2 O, 11.54 g / L Na 2 HPO 4 12H 2 O, the solvent is water.

[0011] Furthermore, the trace minerals added to the nutrient medium include the following components: 1.5 g / L nitrilotriacetic acid, 3.0 g / L MgSO 4 、0.5g / L MnSO 4 ·H 2 O, 1.0 g / L NaCl, 0.1 g / L FeSO 4 7H 2 O, 0.1g / LCaCl 2 ·2H 2 O, 0.13g / L ZnCl 2 、0.1g / L CoCl 2 6H 2 O, 0.01g / L CuSO 4 ·5H 2 O, 0.01g / L AlK (SO 4 ) 2 12H 2 O, 0.01g / LH 3 BO 3 , 0.025g / L Na 2 MO4 , 0.024g / L NiCl 2 6H 2 O and 0.025 g / L Na 2 WO 4 ·2H 2 O.

[0012] Furthermore, the trace vitamins added to the nutrient medium include the following components: 2 mg / L vitamin H, 2 mg / L vitamin B 9 , 10mg / L pyridoxine hydrochloride, 5mg / L vitamin B 2 , 5mg / L thiamine, 5mg / L niacin, 5mg / L DL-calcium pantothenate, 0.1mg / L vitamin B 12 , 5mg / L p-aminobenzoic acid and 5mg / L lipoic acid.

[0013] Further, in step 1) or step 2), the cathode liquid is subjected to CO 2 The specific process of aeration is: 2 As a carbon source, high-purity CO 2 Aeration is performed to make the cathode liquid CO 2 After saturation is achieved, the reactor is sealed.

[0014] Furthermore, in step 1) or step 2), the microbial electrolysis cell MEC is operated at a constant temperature in a water bath at 35±2°C.

[0015] Furthermore, the source of the aqueous solution containing anaerobic microorganisms in step 1) is the effluent from the anaerobic treatment tank of a sewage treatment plant, and the volume ratio of the effluent from the anaerobic treatment tank of the sewage treatment plant to the nutrient culture medium in the cathode chamber is 1:0.8-1.2.

[0016] Furthermore, in step 1), when an external voltage is provided by a DC power supply to start the microbial electrolytic cell for domestication, a cycle is formed every 4-6 days, and a cycle ends when the methane production decreases. After each cycle, the solutions in the two chambers are replaced. The anode chamber replaces all the inorganic salt culture medium, and the cathode chamber discharges 1 / 3 to 1 / 2 of the original solution, and then aeration high-purity CO is added. 2 A nutrient medium containing the quorum sensing signal molecule N-acyl homoserine lactone is added, and after multiple cycles of batch acclimation, a cathode biofilm is fully formed on the cathode electrode, indicating that the initiation is complete. The acclimation cycle in step 1) is 2-4 cycles.

[0017] Furthermore, when the electrochemical reaction is carried out in step 2), a cycle is terminated when the methane production decreases. After each cycle, the cathode liquid and the anode liquid are completely replaced, and then the next cycle of electrochemical reaction is carried out.

[0018] The first object of the present invention is to provide a quorum sensing signal molecule as a regulatory factor for strengthening MEC biofilm.

[0019] The second object of the present invention is to provide the above-mentioned biofilm to improve CO 2 Yield of methane synthesized by microbial electrochemical conversion.

[0020] The third object of the present invention is to provide C8-HSL, which can regulate CO 2 Abundance of microorganisms that synthesize methane via microbial electrochemical conversion.

[0021] Compared with the prior art, the present invention has the following advantages: The present invention adds C8-HSL signal molecules exogenously to reduce CO 2 The natural acclimation time of the biofilm of the microbial electrochemical transformation methanogenesis system was measured. The mature biofilm was scanned by laser confocal electron microscopy. The results showed that the quorum sensing signal molecules induced the formation of a more uniform and dense biofilm and the proportion of highly active microorganisms on the biofilm was higher.

[0022] The present invention adds C8-HSL signal molecules exogenously to improve the electrosynthesis of CO by microorganisms 2 is the production and yield of methane.

[0023] The present invention adds C8-HSL signal molecules exogenously to make CO 2 The abundance of the dominant bacterial species synthesizing methane through microbial electrochemical conversion was further significantly improved, thereby promoting the CO 2 conversion rate, providing an effective technology for the enrichment of methanogenic dominant bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a graph of methane production under different culture conditions in Example 1 of the present invention; Figure 2 This is a graph showing the effect of signal molecule regulation on the abundance of microbial species in a reactor in Example 1 of the present invention. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto. Example 1

[0026] A quorum sensing-based CO 2 The method for synthesizing methane by electrochemical conversion of microorganisms comprises the following steps: 1) Quorum sensing signal molecules (C8-HSL) promote biofilm domestication and initiation: The MEC system of the microbial electrolysis cell is constructed by a cathode chamber and an anode chamber. The cathode chamber and the anode chamber are separated by a N117 proton membrane. The cathode of the cathode chamber is a hydrophilic carbon cloth (2 cm × 3 cm, HCP330N), with a reference electrode (Ag vs AgCl) inside, and the anode is a graphite sheet (2 cm × 3 cm × 0.2 cm). The volume of the cathode chamber and the anode chamber is 100 mL. The anolyte in the anode chamber is 75 mL of inorganic salt culture medium and 25 mL of headspace volume.

[0027] The nutrient medium is mainly an inorganic salt medium, to which trace vitamins and trace minerals are added to meet the basic conditions for the growth of cathode microorganisms. The components and contents of trace minerals in the nutrient medium are shown in Table 1, and the components and contents of vitamins are shown in Table 2.

[0028] The formula of inorganic salt culture medium is: 0.31g / L NH 4 Cl, 0.13g / L KCl, 2.77g / L NaH 2 PO 4 ·2H 2 O, 11.54 g / L Na 2 HPO 4 12H 2 O, the solvent is water.

[0029] Table 1 Trace mineral solution formula ; Table 2 Vitamin solution formula ; In this embodiment, the microorganisms to be inoculated in the cathode chamber of the microbial electrolysis cell MEC are firstly from the effluent of the anaerobic treatment tank of a sewage plant, the pH value of the effluent of the anaerobic treatment tank is between 6.5 and 8.5, and the COD value is about 200 mg / L. The effluent of the anaerobic treatment tank of the sewage plant is mixed with the nutrient medium in a volume ratio of 1:1 to obtain the cathode liquid, 75 mL of the cathode liquid is added to the cathode chamber, and aeration is carried out for 1 h CO 2 As a carbon source, CO 2 After reaching saturation, the reactor is sealed. The reactor needs to be operated in a water bath at a constant temperature of 35±2°C under closed anaerobic conditions, and a voltage of -1.05 V is applied to all reactors to acclimate the bacteria so that biofilms can form on the cathode.

[0030] In this Example 1, two groups of reaction devices were constructed for experimental comparison: ① In the experimental group, typical N-acyl homoserine lactones (AHLs), i.e., octanoyl-L-homoserine lactone C8-HSL, were added to 75 mL of cathode liquid in the cathode chamber at a final concentration of 10 μM; ② C8-HSL was not added to the control group, which served as a blank control group.

[0031] This experiment used 3 cycles as the start-up acclimatization period, with one cycle lasting 5 days. The end of one cycle was when the methane production decreased, and the raw materials needed to be replaced. The replacement method was as follows: 1 / 3~1 / 2 of the original solution of the reactor was discharged from the cathode chamber of the two groups of reaction devices, and the experimental group ① was supplemented with pure nutrient medium, in which C8-HSL with a final concentration of 10 μM was pre-added and aerated for 1h CO 2 As a carbon source, CO 2 When saturation is reached, the anode chamber is completely replaced with an inorganic salt medium. ② The control group is supplemented with a pure nutrient medium, in which aeration with CO 2 As a carbon source, CO 2 When saturation is reached, all the inorganic salt culture medium in the anode chamber is replaced.

[0032] When the acclimation treatment was carried out for the experimental group ① and the control group ② with 3 cycles as the starting acclimation period, the cathode liquid needed to be stirred at a speed of 500 rpm, and the experiment was run for 3 cycles to allow the bacteria to form biofilm on the cathode.

[0033] The experimental group ① and the control group ② followed the above experimental process, with 3 cycles as the start-up acclimatization period, one cycle was 5 days, and the methane production was tested every day. The comparison results of methane production in 3 cycles totaling 15 days are shown in Figure 1 during the domestication period. Figure 1 In the figure, ① the methanogenesis results of the experimental group correspond to the C8-HSL dotted line group, and ② the methanogenesis results of the control group correspond to the Blank group.

[0034] 2) Electrochemical reaction operation of microbial electrolysis cell MEC After the three cycles of MEC startup acclimation period in step 1) are completed, electrochemical reactions are performed respectively: ① The experimental process of the electrochemical reaction of the experimental group is as follows: the cathode liquid added to the cathode chamber is a pure nutrient medium, to which C8-HSL with a final concentration of 10 μM is pre-added and aerated for 1 h CO 2 As a carbon source, CO 2 The anolyte added to the anode chamber is an inorganic salt culture medium, and an external voltage is provided by a DC power supply to generate CO 2 The electrochemical conversion reaction to synthesize methane was operated at a constant temperature of 35±2°C in a water bath, and a voltage of -1.05 V was applied to all reactors.

[0035] ② The experimental process of the electrochemical reaction of the control group is as follows: the cathode liquid added to the cathode chamber is a pure nutrient medium, which is aerated with CO for 1 h. 2 As a carbon source, CO 2The anolyte added to the anode chamber is an inorganic salt medium, and an external voltage is provided by a DC power supply to electrochemically convert CO 2 The reaction for synthesizing methane was operated at a constant temperature of 35±2°C in a water bath, and a voltage of -1.05 V was applied to all reactors.

[0036] The electrochemical reaction processes of the above experimental group ① and control group ② were all based on 4 cycles, with one cycle being 5 days. After each cycle, the cathode liquid and the anode liquid were completely replaced, and then the next cycle of electrochemical reaction was carried out.

[0037] The experimental group ① and the control group ② followed the above experimental process, with 4 cycles as the experimental period, one cycle was 5 days, and the methane production was detected every day. The comparison results of methane production in 4 cycles totaling 20 days are shown in Figure 1 During the experimental period. Figure 1 In the figure, ① the methanogenesis results of the experimental group correspond to the C8-HSL dotted line group, and ② the methanogenesis results of the control group correspond to the Blank group.

[0038] In this implementation case, two groups of reactors have been built and domesticated according to Example 1. The methane concentration in the reactor is detected every 24 hours (i.e., every day) with a cycle of 5 days, and the methane production of each cycle is calculated (e.g. Figure 1 ). After the methane production in each experimental cycle is relatively stable, the methane production of the experimental group can reach 0.62±0.02mmol.

[0039] In this implementation case, the change in methane yield was also calculated. The methane yield of the experimental group was higher than that of the control group. The highest yield of the experimental group was on the 1st and 2nd day of each cycle. The yield may have decreased due to changes in the substrate concentration or experimental conditions in the subsequent reactor. The maximum daily methane yield of the experimental group was 11.94 μmol / h, and the maximum Faraday efficiency was 62.31%, while the maximum daily methane yield of the control group was 0.07 μmol / h, and the maximum Faraday efficiency was 1.67%. The addition of signal molecules increased the rate of methane production in the reactor and also increased the electron utilization rate.

[0040] Example 1 Step 2) After the electrochemical reaction with 4 cycles as the experimental period was completed, the ① experimental group and ② control group were tested according to the following operations: After the reaction was completed, the carbon cloth cathode was taken out, and a small piece (0.5 cm×1 cm) of carbon cloth with a biofilm structure was gently cut along the edge. The carbon cloth was placed in a 2 mL centrifuge tube, 1 mL of pH=7 was added, and the carbon cloth was sent out at low temperature for microbial 16S rRNA gene sequencing and identification. PCR primer synthesis and DNA extraction were completed by Shanghai Meiji Biomedical Technology Co., Ltd. The determination method was as follows: the DNA of the microorganism was extracted by EZNA®Soil DNA Kit (OmegaBio-Tek, USA), and the extraction quality was detected and extracted using 1% agarose gel electrophoresis. The concentration and purity of DNA were determined by NanoDrop (Thermo, USA). The extracted DNA was used as a template, and the PCR amplification experiment used bacterial universal primers 338F: (ACTCCTACGGGAGGCAGCAG) and 806R: (GGACTACHVGGGTWTCTAAT) to amplify the V3-V4 region of 16S rRNA.

[0041] Example 1 Comparison of the abundance of microbial species that form biofilms under the culture conditions of ① experimental group and ② control group Figure 2 middle, Figure 2 The changes in the abundance of microbial species in the experimental group ① correspond to the C8-HSL group, and the changes in the abundance of microbial species in the control group ② correspond to the Blank group. Figure 2 As shown in the experimental group microbial system added with C8-HSL detection, at the genus level, Paracoccus ( Paracoccus ) accounted for 33.47%, and the proportion of Paracoccus in the control group was 2.10%. According to the study, there is a species in the Paracoccus genus that can utilize H 2 and CO 2 The dominant genus in the control group was Acetobacter ( Acetobacterium )、Desulfurobacterium spp. Desulfomicrobium ), accounting for 36.98% and 19.47% respectively. This may be because the original dominant bacteria in the inoculated sewage were these two types. After adding signal molecules, the microbial system was regulated to be conducive to methane production. Example 2

[0042] Example 1 Step 2) After the electrochemical reaction with 4 cycles as the experimental period is completed, both the experimental group ① and the control group ② are tested according to the following operations: Take out the carbon cloth of the cathode, and gently cut a small piece of carbon cloth with a biofilm structure along the edge. Put the carbon cloth into a 2mL centrifuge tube, add 1mL PBS buffer solution with pH=7 to ensure that the carbon cloth is completely immersed, and use the Live / DeadBacLight Bacterial Viability KL-7007 (Molecular Probes Corporation, Canada) kit for staining, which contains two dyes, SYTO-9 and propidium iodide. Live bacteria can emit green fluorescence under the action of SYTO-9, and dead bacteria can emit red fluorescence under the action of propidium iodide. The dyed carbon cloth was placed on a glass slide, and a laser confocal electron scanning microscope (CLSM) was used to visually characterize the biofilm morphology. In Example 1, laser confocal imaging of biofilms formed under the culture conditions of the ① experimental group and the ② control group showed that the biofilms in the ① experimental group had a significant thickness, and the amount of green bacteria was significantly greater than the amount of red bacteria; the biofilms in the ② control group had a small amount of biomass, and the amount of green bacteria was equivalent to the amount of red bacteria. It can be concluded that the biofilms in the experimental group were thicker than those in the control group, and the proportion of live cells in the biofilms was higher. The addition of signal molecules facilitated the attachment of microorganisms and the formation of biofilms, and enhanced the activity of biofilms.

Claims

1. A method to enhance CO based on quorum sensing 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The process includes: 1) Acclimation and start-up of biocathode The microbial electrolysis cell MEC, which is divided into a cathode chamber and an anode chamber by a proton exchange membrane, is used for domestication. The cathode liquid added to the cathode chamber includes a nutrient medium, which is mainly an inorganic salt medium, wherein trace vitamins and trace minerals are added to meet the basic conditions for the growth of cathode microorganisms. An aqueous solution containing anaerobic microorganisms and a quorum sensing signal molecule N-acyl homoserine lactone are added to the nutrient medium in the cathode chamber. High-purity CO is added to the cathode liquid. 2 Aeration is performed; the anolyte added to the anode chamber is an inorganic salt culture medium; The cathode chamber uses a hydrophilic carbon cloth as an electrode, and the anode chamber uses a conductive material as an electrode and is connected to a DC power supply through a wire. The DC power supply provides an applied voltage to start the microbial electrolysis cell for domestication, so that a cathode biofilm is formed on the cathode electrode as a biological cathode; 2) Electrochemical reaction operation of microbial electrolysis cell MEC Step 1) After the biocathode is tamed, the cathode liquid added to the cathode chamber is aerated high-purity CO 2 A nutrient medium containing the quorum sensing signal molecule N-acyl homoserine lactone is added, and the anode liquid added to the anode chamber is an inorganic salt medium. A DC power supply is used to provide an external voltage for electrochemical conversion of CO 2 The reaction of synthesizing methane.

2. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The quorum sensing signal molecule N-acyl homoserine lactone is octanoyl-L-homoserine lactone C8-HSL; in step 1) or step 2), the final concentration of C8-HSL added to the cathode liquid is 5-20 μM.

3. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The electrode of the anode chamber in step 1) is a graphite sheet, and a silver-silver chloride reference electrode is set in the cathode liquid of the microbial electrolysis cell MEC; the external voltage provided by the power supply in step 1) or step 2) is -0.5~-1.5V.

4. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The formula of the inorganic salt culture medium is: 0.31g / L NH 4 Cl, 0.13 g / L KCl, 2.77 g / L NaH 2 PO 4 ·2H 2 O, 11.54 g / L Na 2 HPO 4 12H 2 O, the solvent is water.

5. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The trace minerals added to the nutrient medium include the following components: 1.5 g / L nitrilotriacetic acid, 3.0 g / L MgSO 4 、0.5g / L MnSO 4 ·H 2 O, 1.0 g / L NaCl, 0.1 g / L FeSO 4 7H 2 O, 0.1 g / L CaCl 2 ·2H 2 O, 0.13g / L ZnCl 2 、0.1g / L CoCl 2 6H 2 O, 0.01g / L CuSO 4 ·5H 2 O, 0.01g / L AlK (SO 4 ) 2 12H 2 O, 0.01g / LH 3 BO 3 , 0.025g / L Na 2 MO 4 , 0.024g / L NiCl 2 6H 2 O and 0.025 g / L Na 2 WO 4 ·2H 2 O; The trace vitamins added to the nutrient medium include the following components: 2 mg / L vitamin H, 2 mg / L vitamin B 9 , 10mg / L pyridoxine hydrochloride, 5mg / L vitamin B 2 , 5mg / L thiamine, 5mg / L niacin, 5mg / L DL-calcium pantothenate, 0.1mg / L vitamin B 12 , 5mg / L p-aminobenzoic acid and 5mg / L lipoic acid.

6. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features In step 1) or step 2), the cathode liquid is subjected to CO 2 The specific process of aeration is: 2 As a carbon source, high-purity CO 2 Aeration is performed to make the cathode liquid CO 2 After saturation is achieved, the reactor is sealed.

7. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features In step 1) or step 2), the microbial electrolysis cell MEC is operated at a constant temperature in a water bath at 35±2°C.

8. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The source of the aqueous solution containing anaerobic microorganisms in step 1) is the effluent from the anaerobic treatment tank of the sewage treatment plant, and the volume ratio of the effluent from the anaerobic treatment tank of the sewage treatment plant to the nutrient culture medium in the cathode chamber is 1:0.8-1.2; in step 1), when the DC power supply provides an applied voltage to start the microbial electrolysis cell for domestication, a cycle is formed every 4-6 days, and a cycle ends when the methane production decreases. After each cycle, the solutions in the two chambers are replaced, the anode chamber replaces all the inorganic salt culture medium, and the cathode chamber discharges 1 / 3~1 / 2 of the original solution, and then aeration high-purity CO is supplemented. 2 A nutrient culture medium containing a quorum sensing signal molecule, N-acyl homoserine lactone, is added, and after multiple cycles of batch acclimation, a cathode biofilm is fully formed on the cathode electrode, indicating that the startup is complete.

9. A method for enhancing CO based on quorum sensing as claimed in claim 8 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features The acclimatization period in step 1) is 2-4 cycles.

10. A method for enhancing CO based on quorum sensing as claimed in claim 1 2 Method for synthesizing methane by electrochemical conversion of microorganisms, Features Step 2) When the electrochemical reaction is carried out, a cycle ends when the methane production decreases. After each cycle, the cathode liquid and the anode liquid are completely replaced, and then the next cycle of electrochemical reaction is carried out.

Images