Screening method for improving yield of ergothioneine and mutant strain

Abstract

The invention discloses a screening method for improving the yield of ergothioneine and a mutant strain, and belongs to the technical field of microorganisms and microfluidics. In the step of generating the liquid drops, the EGT sensor is introduced into the escherichia coli, so that the micro-injection process is reduced, the screening time is greatly shortened, and the result is more accurate. And moreover, single bacteria are encapsulated in liquid drops by using a liquid drop micro-fluidic technology, so that mutual interference among traditional flow type strains can be eliminated. In addition, a riboswitch is combined with a fluorescent droplet microfluidic technology, so that high-throughput sorting of the sgRNA library can be realized according to the level of fluorescence. After the gene obtained through screening is knocked out, the yield of ergothioneine can be increased by 48.8%.

Description

Technical Field

[0001] The invention relates to a screening method for improving ergothioneine yield and a mutant strain, and belongs to the technical field of microorganisms and microfluidics. Background Art

[0002] Ergothioneine (EGT), also known as 2-sulfenyl-L-histidine trimethyl salt, is a rare natural chiral histidine-derived thiol compound, first isolated from Claviceps purpurea by Tamcet in 1909. Ergothioneine (L-ergothioneine, EGT, ERGO) is a natural rare chiral amino acid strong antioxidant, an important physiologically active substance in the body, involved in regulating intracellular redox reactions, scavenging free radicals, preventing ultraviolet radiation damage, regulating intracellular energy metabolism, anti-fatigue, protecting the cornea and other functions. Due to the biological and pharmacological properties of ergothioneine and its safety, stability and other advantages, it has shown good application prospects in the fields of cosmetics, functional foods, pharmaceuticals and biomedicine. There is almost no high-throughput screening method for ergothioneine reported at present, mainly because there is no suitable sensor and the throughput is not high.

[0003] Since ergothioneine is a substance secreted outside the cell, the use of traditional flow screening may cause interference between strains, affecting the screening results. In addition, in order to obtain high-yield strains that meet commercial relevance, traditional methods rely on the domestication of microorganisms or the deletion of specific non-essential competitive genes. The rapid development of genome editing technology has created opportunities for the rational transformation of microbial hosts, which has also spawned a series of studies aimed at increasing production by eliminating cellular bottlenecks in polypeptide formation, protein folding, modification, and transmembrane transport. Studies have shown that some components on the genome, including chaperones, disulfide bond forming enzymes, Sec / Tat translocases, etc., have a direct contribution to production and have been considered as targets for functional enhancement of recombinant protein production. However, the understanding of the synthesis pathways and structures of recombinant proteins, especially their interactions with other cellular processes, remains incomplete, which hinders the engineering design of bacterial hosts and limits the production potential of candidate microorganisms.

[0004] Programmable synthetic biology toolkits have been developed to accelerate genome-scale perturbations of metabolic fluxes, such as synthetic DNA oligonucleotides and CRISPR-mediated multiplexed genome engineering, among which CRISPRi has been widely used in systems metabolic engineering due to its programmability and multiplexity, strong activity, and host flexibility. Recent studies have successfully applied CRISPRi screening methods to optimize bacteria for industrial uses, such as overproduction of free fatty acids, however, the lack of high-throughput phenotypic analysis is a key limiting factor for industrial phenotypic genetic screening.

[0005] Therefore, it is urgent to construct a highly sensitive and accurate high-throughput screening method in order to obtain strain mutants that increase ergothioneine production. Summary of the invention

[0006] In view of the deficiencies in the prior art, the present invention provides a method for high-throughput screening of high-yield thioneine mutant strains in combination with CRISPRi technology, as well as the high-yield thioneine mutant strains screened, recombinant engineering bacteria obtained by the mutant strains and applications, the purpose is to select sgRNA library as screening object, screening is carried out in a manner combined with droplet microfluidics technology and riboswitch, and finally genes that affect yield are screened out on the genome, which can be used for the research on thioneine-producing chassis strains.

[0007] The first technical solution provided by the present invention is a screening method for high-throughput screening of ergothioneine high-yield strains based on fluorescent droplet microfluidics. The method comprises the following steps: transferring an sgRNA library constructed based on the genome of an EGT chassis strain and an EGT sensor carrying an EGT riboswitch into an EGT chassis strain whose genome is integrated with an egt1 gene and an egt2 gene, and then performing fermentation culture. The expression content level of EGT in the fermentation broth is characterized by the fluorescence intensity of the fermentation broth, and a negative factor gene affecting the expression of EGT is screened out.

[0008] In one embodiment, the method comprises the steps of:

[0009] S1, construction of sgRNA library based on the genome of EGT chassis strain;

[0010] S2, preparation of bacterial suspension, after transferring the sgRNA library and EGT sensor of S1 into the EGT chassis strain with the egt1 gene and egt2 gene integrated in the genome, collecting the bacteria after spreading culture and diluting to obtain bacterial suspension;

[0011] S3, droplet generation, using the bacterial suspension in S2 to generate droplets using a droplet microfluidic cell sorting system and a droplet generation chip;

[0012] S4, droplet sorting, after the droplet culture in S3 is completed, the droplets with higher fluorescence are sorted using a droplet microfluidic cell sorting system and a droplet sorting chip, which are positive droplets;

[0013] S5, plate culture and verification, the positive droplets of S4 are demulsified and plated, the monoclonal clones obtained by culture are verified for yield, and the ones with high yield are screened;

[0014] S6, sequencing, sequencing the high-yield N20 screened in S5 to obtain the targeted gene;

[0015] S7, knockout verification, knockout verification of the targeted gene of S7.

[0016] In one embodiment, in S1, a library is constructed for the EGT chassis strain (Escherichia coli BW25113). The genome of BW25113 contains 4,400 genes, and 10 N20s are designed for each gene.

[0017] In one embodiment, in S1, the sgRNA library is ligated to the pCasi plasmid.

[0018] In one embodiment, in S1, the pCasi plasmid is a plasmid in which the aspartic acid D at the 10th position of the Cas9 protein in the pCas plasmid is mutated to alanine A, that is, the Cas9 in the pCas plasmid is obtained by point mutation to obtain dCas9, and the histidine at the 840th position is mutated to alanine A. Under the action of dCas9, the transcription of the targeted gene can be inhibited but it does not have cutting activity, wherein the nucleotide sequence of the gene encoding dCas9 is shown in SEQ ID NO:4.

[0019] In one embodiment, the EGT chassis strain described in S2 is BW25113, and egt1 and egt2 are targeted to the genome using cas9 technology.

[0020] In one embodiment, in S2, the EGT sensor is a pET21a-Apt-GFP plasmid, which is obtained by connecting the promoter J23119, the EGT riboswitch sequence, the GFP gene and the linearized vector pET21a, and the nucleotide sequence of the EGT riboswitch is shown in SEQ ID NO:1.

[0021] In one embodiment, in S2, the sgRNA concentration of the sgRNA library is 1.3 μg / μl, 1 μl is transferred each time to build the library, 10 plates are coated, and 10 4 clones, a total of 10 5 A clone.

[0022] In one embodiment, in S2, the sgRNA library is transfected with 10 μl in total and sorted 10 times in total to complete the sorting of the library.

[0023] In one embodiment, in S2, the OD of the bacterial suspension is 0.01-0.05, preferably, the OD of the bacterial suspension is 0.05.

[0024] In one embodiment, in S2, the coated culture medium is EGT fermentation medium, wherein the glycerol content is 5 g / L or 10 g / L, wherein 10 g / L has the best effect.

[0025] In one embodiment, in S3, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600 psi, the pressure of channel 2 is set to 400 psi, the generation speed is set to 1000 / sec, and the generation diameter is set to 25 μm.

[0026] In one embodiment, in S3, the generated droplets are cultured for 18-48 hours, with 48 hours being the best, and the incubation temperature is 30°C.

[0027] In one embodiment, in S4, channel 1 is connected to the droplet generation oil, channel 2 is connected to the droplet, the pressure of channel 1 is 600psi, the pressure of channel 2 is 450psi, and the sorting is performed at a speed of 300 pieces / second. The laser power is set to 100mW, the PMT value is 0.45, the electric field strength is 45, and the sorting time is 220μs.

[0028] In one embodiment, in S4, the positive droplets screened are the top 1% high fluorescence droplets.

[0029] In one embodiment, in S5, the demulsification method is to add 100 μL of 1H,1H,2H,2H-perfluoro-1-octanol and 100 μL of culture medium to the droplets obtained by sorting, flick with a finger for 3 minutes, let stand for about 5 minutes, and aspirate the aqueous phase off the coating plate.

[0030] In one embodiment, in S5, the plate culture is incubated at 30° C. for 24 hours.

[0031] In one embodiment, in S5, the yield verification includes well plate verification and shake flask verification.

[0032] In one embodiment, the well plate verification is to inoculate a single clone into a deep well plate and ferment and culture it at 30° C. for 24 hours. The deep well plate is a 2.2 mL 96-well square well plate.

[0033] In one embodiment, the shake flask validation is to inoculate the strain obtained by the well plate validation into a shake flask and ferment and culture it at 30° C. for 72 hours.

[0034] The second technical solution provided by the present invention is an EGT sensor, wherein the EGT sensor is a pET21a-Apt-GFP plasmid, wherein the pET21a-Apt-GFP plasmid is obtained by connecting a promoter J23119, an EGT riboswitch sequence, a GFP gene and a linearized vector pET21a, wherein the nucleotide sequence of the EGT riboswitch is shown in SEQ ID NO:1, the nucleotide sequence of the promoter J23119 is shown in SEQ ID NO:5, and the nucleotide sequence of the GFP gene is shown in SEQ ID NO:6.

[0035] The third technical solution provided by the present invention is an Escherichia coli mutant with improved thioneine production ability, wherein the mutant is an Escherichia coli in which yccM gene, agn43 gene and / or xylF gene are suppressed to be expressed, and the Escherichia coli is also overexpressed with egt1 gene and egt2 gene, the nucleotide sequence of the egt1 gene is as shown in SEQ ID NO:2, and the nucleotide sequence of the egt2 gene is as shown in SEQ ID NO:3.

[0036] In one embodiment, the Escherichia coli is Escherichia coli BW25113.

[0037] In one embodiment, the mutant strain is Escherichia coli in which the yccM gene, agn43 gene and / or xylF gene are knocked out; alternatively, the mutant strain is Escherichia coli in which the yccM gene and the xylF gene are knocked out.

[0038] In some embodiments, the accession number of the yccM gene is ID: 946295, the accession number of the agn43 gene is ID: 946540, and the accession number of the xylF gene is ID: 948090.

[0039] The fourth technical solution provided by the present invention is the use of the method described in the first technical solution, or the sensor described in the second technical solution, or the mutant strain described in the third technical solution in the preparation of ergothioneine or a product containing ergothioneine.

[0040] The fifth technical scheme provided by the present invention is the application of yccM gene, agn43 gene or xylF gene in improving the ability of Escherichia coli to produce ergothioneine, wherein the application is to knock out one or more genes in the yccM gene, agn43 gene or xylF gene of Escherichia coli, and the Escherichia coli is also overexpressed with egt1 gene and egt2 gene, the nucleotide sequence of the egt1 gene is shown in SEQ ID NO:2, and the nucleotide sequence of the egt2 gene is shown in SEQ ID NO:3.

[0041] In some embodiments, the Escherichia coli is Escherichia coli BW25113.

[0042] In some embodiments, the accession number of the yccM gene is ID: 946295, the accession number of the agn43 gene is ID: 946540, and the accession number of the xylF gene is ID: 948090.

[0043] The technical effects of the present invention are as follows:

[0044] 1. The present invention introduces the sensor into E. coli during the step of generating droplets, which reduces the microinjection process, greatly shortens the screening time and makes the results more accurate. It shortens at least 16 hours.

[0045] 2. The present invention uses droplet microfluidics technology to encapsulate single bacteria in droplets, which can eliminate the mutual interference between traditional flow cytometry strains.

[0046] 3. The present invention combines riboswitches with fluorescent droplet microfluidics technology to achieve high-throughput sorting of sgRNA libraries based on fluorescence levels.

[0047] 4. The dCas9 used in the present invention can screen the sgRNA library without knocking out the gene.

[0048] 5. After the gene knockout screened by the present invention, the yield of ergothioneine can be increased by 48.8%. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 These are the pET28a-egt1-egt2 plasmid map, the pET21a-Apt-GFP plasmid map, and the pCasi-sgRNA plasmid map.

[0050] Figure 2 The fluorescence images are corresponding to the different yield strains after 48h of fermentation.

[0051] Figure 3 The figure shows the verification of the inhibitory effect of dCas9 and the growth of the strain in droplets.

[0052] Figure 4 The above figure shows the screening results for different culture times.

[0053] Figure 5 This is a graph showing the screening results of different glycerol concentrations.

[0054] Figure 6 This is the result diagram without microinjection.

[0055] Figure 7 This is a picture of the microinjection results.

[0056] Figure 8 The figure is a flowchart of the screening.

[0057] Fig. 9 Figures of droplet generation (a) and droplet fluorescence sorting (b).

[0058] Fig.10 This is the result diagram of the orifice plate verification.

[0059] Fig.11 This is a graph of shake flask verification results.

[0060] Fig.12The figure shows the sequencing results.

[0061] Fig.13 This is a diagram of the knockout validation results. DETAILED DESCRIPTION

[0062] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0063] The culture medium used in the embodiment is:

[0064] 1. LB liquid medium: 5 g / L yeast extract, 10 g / L NaCl, 10 g / L peptone, adjust pH to 7.0 with NaOH, and sterilize by high pressure at 121°C for 20 min.

[0065] 2. EGT fermentation medium: 4 g / L (NH4)2HPO4, 13.3 g / L KH2PO4, 1.7 g / L citric acid, 1% trace salt solution, 1.2 g / L MgSO4, 0.5 g / L glucose, 10 g / L glycerol, 1 g / L methionine, 1 g / L arabinose, adjust the pH to 7.0 with NaOH, and sterilize by high pressure at 121°C for 20 min.

[0066] 3. Inorganic salt medium: 4g / L (NH4)2HPO4, 13.3g / L KH2PO4, 1.7g / L citric acid, 1% trace salt solution, 1.2g / L MgSO4, 0.5g / L glucose, 10g / L glycerol, NaOH to adjust pH to 7.0, 121°C, 20min autoclave. Plasmids and strains used in the examples:

[0067] 1. The vector pET21a was purchased from Yunzhou Biotechnology.

[0068] 2. The vector pET28a was purchased from Yunzhou Biotechnology.

[0069] 3. Escherichia coli BW25113 was purchased from Mingzhou Biotechnology.

[0070] 4. pCas plasmid was purchased from CoMiao Biotechnology.

[0071] Example 1 Ergothioneine Riboswitch

[0072] The ergothioneine (EGT) sensor was constructed based on the ergothioneine (EGT) riboswitch screened from CN116656669A. The riboswitch sequence used is TAATACGACTCACTATAGGGACGACGATGACCATACGCCGATATA CGCCGATCACATGACCAGCTATTACAAGAAGAT (SEQ ID NO: 1), using the homologous recombination method (refer to the method in the following literature: Gibson DG, Young L, Chuang RY, et al. 2009b. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods [J], 6: 343-345). The EGT riboswitch connected to the promoter J23119 (nucleotide sequence as shown in SEQ ID NO: 5) and the GFP gene (nucleotide sequence as shown in SEQ ID NO: 6) were connected to the linearized vector pET21a ( Figure 1 ) to obtain the pET21a-Apt-GFP plasmid, which is the EGT sensor.

[0073] The egt1 gene (SEQ ID NO: 2) and the egt2 gene (SEQ ID NO: 3) were connected to the linearized vector pET28a by homologous recombination to obtain the pET28a-egt1-egt2 plasmid.

[0074] The CRISPR-Cas9 technology (refer to the method in the following literature: KOMOR AC, KIM YB, PACKER MS, ZURIS JA, LIU DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage [J]. Nature, 2016, 533(7603): 420-424.) was used to target the egt1 gene (SEQ ID NO: 2) and the egt2 gene (SEQ ID NO: 3) in the genome of Escherichia coli BW25113. NO:3) strain BW25113-egt1-egt2 was obtained, and pET28a-egt1-egt2 plasmids were introduced into two chassis cells of BW25113-egt1-egt2 and BW25113, respectively, to obtain high-yield strain NC and low-yield strain GRA, and then pET21a-Apt-GFP plasmid was transferred into high-yield strain NC and low-yield strain GRA, and fluorescence was detected after culturing in EGT fermentation medium for 48h. It was found that ergothioneine yield and fluorescence were positively correlated.

[0075] Example 2 Library Construction

[0076] The Cas9 protein in pCas was subjected to point mutation, with mutation sites at D10A and H840A. After mutation, dCas9 protein (SEQ ID NO: 4) was obtained. The plasmid was named pCasi, and Escherichia coli BW25113 was selected for library construction. The genome of Escherichia coli BW25113 (accession number ID: 83333) has a total of 4400 genes, and 10 sgRNAs are designed for each gene, so there are theoretically 44,000 sgRNAs. A total of 479,375 sgRNAs were derived, with mitSpecScore and cfdSpecScore screening conditions of 100 points, offtargetCount screening condition of 0, GrafEtAlStatus of GrafOK, and the top 10 Out-of-Frame-Score scores were selected. A total of 39,190 sgRNAs were screened. The designed sgRNAs were loaded on the pCasi plasmid (synthesized by Diying Bio).

[0077] Two sgRNAs targeting metA gene (accession number: 948513) were selected to construct pCasi-sgRNA plasmids, which were transformed into E. coli BW25113 strains. Single clones were selected and cultured in LB and inorganic salt medium, where the inorganic salt medium was divided into two types: with and without inducers. At the same time, droplets were generated on DREM cells, and the growth of the strains in the droplets was observed overnight.

[0078] The metA gene was used to verify the inhibitory effect of dCas9. Figure 3 It can be seen that it cannot grow in inorganic salt medium, but can grow normally in LB and medium without arabinose, indicating that dCas9 has an inhibitory effect but no cutting activity. At the same time, the growth of the strain in the droplet was observed. After culturing at 30°C for 16 hours, the single cell was able to divide and grow normally, indicating that the pCasi-sgRNA plasmid strain can grow normally in the droplet.

[0079] Example 3: Exploration of droplet microfluidics machine conditions

[0080] (1) Optimization of culture time

[0081] The pET21a-Apt-GFP plasmid (EGT sensor) was transferred into the high-yield strain NC and the low-yield strain GRA, and cultured overnight in LB medium at 37°C and 200 rpm. The bacterial solution was taken to measure its OD 600And centrifuge and resuspend twice with EGT fermentation medium, dilute to about 0.05. The EGT high-yield strain NC bacterial solution containing the pET21a-Apt-GFP plasmid and the low-yield strain GRA bacterial solution were mixed in a volume ratio of 1:1. Using the droplet microfluidic cell sorting system and droplet generation chip, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600psi and the pressure of channel 2 is set to 400psi on the control software. Droplets with a diameter of 25μm are generated at a speed of 1000 / second and collected in a Teflon pipe. After collecting the droplets, they are sealed with mineral oil and cultured at 30°C for 18h, 24h and 48h. After the culture is completed, the droplet microfluidic cell sorting system and droplet sorting chip are used, channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplet, and the pressure of channel 1 is adjusted to 600psi and the pressure of channel 2 is adjusted to 450psi on the control software, and sorting is performed at a speed of 300 / second. The laser power was set to 100mW, the PMT value to 0.45, the electric field strength to 45, and the sorting time to 220μs. The screening threshold was adjusted to screen out the 1% droplets with the strongest fluorescence intensity. The droplets collected and screened at the channel outlet close to the electrode were positive droplets, and the channel outlet far from the electrode were negative droplets. After the culture was completed, the droplets were sorted using a sorting chip, and the collected droplets were observed under a microscope. At the same time, the plate was plated to pick clones and the well plate yield was verified.

[0082] like Figure 4 As shown, 2w droplets were screened out in the 18h, 24h and 48h positive channels, but less than 10 single clones grew on the plate in the end at 18h, no single clones at 24h, and clones at 48h, but after the droplets were placed, the single clones were selected for verification, and it was found that the negative and positive were not separated, and the average yield was basically the same, and even the negative was higher. However, the growth of the 48h strain was better, so the culture time was selected for 48h.

[0083] (2) Culture medium optimization

[0084] The EGT high-producing strain NC and the low-producing strain GRA were cultured in LB medium at 37°C and 200 rpm overnight. The bacterial culture was taken to measure the OD 600And resuspend twice with EGT fermentation medium by centrifugation, add 5g / L and 10g / L glycerol to EGT fermentation medium respectively, dilute to about 0.05. Mix the bacterial solution in a ratio of 1:1. Using the droplet microfluidic cell sorting system and droplet generation chip, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600psi and the pressure of channel 2 is set to 400psi on the control software. Droplets with a diameter of 25μm are generated at a rate of 1000 / second and collected in a Teflon pipe. After collecting the droplets, they are sealed with mineral oil and cultured at 30℃ for 48h. After the culture is completed, the droplet microfluidic cell sorting system and droplet sorting chip are used, channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplet, and the pressure of channel 1 is adjusted to 600psi and the pressure of channel 2 is adjusted to 450psi on the control software, and the sorting is performed at a rate of 300 / second. The laser power was set to 100 mW, the PMT value to 0.45, the electric field strength to 45, and the sorting time to 220 μs. The screening threshold was adjusted to screen out the droplet with the strongest fluorescence intensity. The droplets collected and screened at the outlet of the channel close to the electrode were positive droplets, and the outlet of the channel far from the electrode were negative droplets. After the culture was completed, the droplets were sorted using a sorting chip, and the collected droplets were observed under a microscope. At the same time, the plate was plated to pick clones and the well plate yield was verified.

[0085] like Figure 5 As shown, 2w droplets were screened out in both 5g and 10g positive channels, and the results of plate-smearing and single clone verification showed that under the condition of 5g / L glycerol, the negative and positive were not separated, and under the condition of 10g / L glycerol, the average yield of the positive channel was 88.47mg / L, and the average yield of the negative channel was 46.47mg / L. Basically, the positive strain NC with high ergothioneine production and the negative strain GRA with low ergothioneine production can be separated.

[0086] (3) Selection of sensor usage method

[0087] The EGT sensor in Example 1 was transferred into the EGT high-yielding strain NC and the low-yielding strain GRA, respectively, and cultured overnight in LB medium at 37°C and 200 rpm. The bacterial solution was taken to measure its OD 600And centrifuge and resuspend twice with EGT fermentation medium, dilute to about 0.05. Mix the bacterial solution in a ratio of 1:1. Using the droplet microfluidic cell sorting system and droplet generation chip, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600psi and channel 2 is set to 400psi on the control software. Droplets with a diameter of 25μm are generated at a rate of 1000 / second and collected in a Teflon pipe. After collecting the droplets, they are sealed with mineral oil and cultured at 30°C for 48h. After the culture is completed, the droplet microfluidic cell sorting system and droplet sorting chip are used, channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplet, and the pressure of channel 1 is adjusted to 600psi and the pressure of channel 2 is adjusted to 450psi on the control software, and sorting is performed at a rate of 300 / second.

[0088] The EGT high-producing strain NC and the low-producing strain GRA were cultured in LB medium at 37°C and 200 rpm overnight. The bacterial solution was taken to measure its OD 600 Centrifuge and resuspend twice with EGT fermentation medium, dilute to about 0.05. Mix the bacterial solution in a ratio of 1:1. Using the droplet microfluidic cell sorting system and droplet generation chip, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600psi and channel 2 to 400psi on the control software. Droplets with a diameter of 25μm are generated at a rate of 1000 / second and collected in a Teflon pipe. After the droplets are collected, they are sealed with mineral oil and cultured at 30°C for 48h. After the culture is completed, the sensor is implanted into the droplet using a droplet microfluidic cell sorting system and a droplet microinjection chip. Channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplet, and channel 3 is connected to the sensor to be injected. The pressure of channel 1, channel 2, and channel 3 are adjusted to 350 psi, 350 psi, and 480 psi on the control software. Sorting is performed at a rate of 350 cells / second. After sorting, the reaction is carried out at 30°C for 12 hours. Then, using a droplet microfluidic cell sorting system and a droplet sorting chip, channel 1 is connected to the droplet sorting oil, and channel 2 is connected to the droplet. The pressure of channel 1 is adjusted to 600 psi, and the pressure of channel 2 is adjusted to 450 psi on the control software. Sorting is performed at a rate of 300 cells / second.

[0089] result( Figure 6 and Figure 7 ) found that transferring the sensor into the strain to be tested when generating droplets can shorten the screening time by at least 16 hours, and the results are more accurate because of the possible errors in the microinjection process and the reduction of possible interference between strains in co-culture.

[0090] Example 4 Droplet microfluidics screening experiment of high-yield ergothioneine strains

[0091] The entire screening process is as follows Figure 8 As shown, the following steps are included:

[0092] (1) Preparation of bacterial suspension:

[0093] The concentration of the obtained pCasi-sgRNA plasmid was 1.3 μg / μl. 1 μl was transferred each time to build the library. Ten plates were coated with 10 4 clones, a total of 10 5 clones, sorted once, each time with a throughput of 10 5 A total of 10 μl was transferred and sorted 10 times to complete the sorting of the library. The EGT sensor and sgRNA library of Example 1 were introduced into BW25113-egt1-egt2, coated on plates, a total of 10 plates, cultured at 30°C overnight, washed with EGT fermentation medium, and the OD 600 Then dilute it to about 0.05 with EGT fermentation medium.

[0094] (2) Droplet generation:

[0095] Using droplet microfluidic cell sorting system and droplet generation chip ( Fig. 9 a), channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, the pressure of channel 1 is set to 600 psi, the pressure of channel 2 is set to 400 psi on the control software, and droplets with a diameter of 25 μm are generated at a rate of 1000 / sec and collected in a Teflon pipe. After the droplets are collected, they are sealed with MMC oil.

[0096] (3) Droplet sorting:

[0097] After the culture, the droplet microfluidic cell sorting system and droplet sorting chip ( Fig. 9 b), Channel 1 is connected to the droplet sorting oil, and Channel 2 is connected to the droplets. The pressure of Channel 1 is adjusted to 600psi and the pressure of Channel 2 is adjusted to 450psi on the control software, and the sorting is performed at a rate of 300 per second. Set the laser power to 100mW, the PMT value to 0.45, the electric field strength to 45, the sorting time to 220μs, and adjust the screening threshold to screen out the droplet with the strongest fluorescence intensity. The droplets collected and screened at the channel outlet close to the electrode are positive droplets, and the channel outlet away from the electrode is negative droplets. After the sorting is completed, turn off the droplet phase pressure, maintain the oil pressure, use oil to flush the droplets into the collection bottle, pull out the collection tube, and turn the mouth upwards so that the liquid phase inside flows into the collection bottle due to gravity.

[0098] (4) Plate culture:

[0099] Add 100 μl of 1H,1H,2H,2H-perfluoro-1-octanol and 100 μl of culture medium to the droplets obtained by sorting, flick with a finger for 3 minutes, and let stand for about 5 minutes to see two phases, the lower layer is transparent oil, and the upper layer is water. Pipette out the water phase and coat the plate. Place the coated LB plate in a 30°C incubator and culture for 24 hours.

[0100] (5) Orifice plate verification:

[0101] The monoclone obtained after the positive droplet was demulsified and plated was activated with LB medium in a 96-deep-well plate, with each well containing 300 μL of medium. The culture was carried out at 30°C and 800 rpm for 6 h to obtain the seed medium. Then 60 μL of the seed medium bacterial suspension was added to a 96-deep-well plate containing 540 μL of fermentation medium. After culturing at 30°C and 800 rpm for 24 h, the OD and EGT yield of each well were detected. In each round, the 10 strains with the highest EGT yield / OD were selected for shake flask verification.

[0102] Figure 7 The 10 strains with the highest EGT yield / OD in each round of screening, a total of 100 strains, were selected, and the top 10 strains, 8-3, 5-1, 6-3, 9-4, 4-7, 10-5, 7-10, 7-3, 4-10, and 6-2, which were 38.8%, 36.8%, 36.8%, 35.3%, 33%, 33%, 32.5%, 30.9%, 30.7%, and 30.6% higher than those of the control group, respectively, were used for shake flask verification.

[0103] (8) Shake bottle verification:

[0104] The selected strain was activated with 3 mL of system EGT fermentation medium in a shaking tube at 30°C and 220 rpm overnight, 200 μL was inoculated into a 100 mL conical flask containing 20 mL of EGT fermentation medium, and 1 g / L of histidine, methionine and cysteine ​​were added after shaking culture at 30°C and 220 rpm for 24 h. The fermentation broth was obtained after shaking culture at 30°C and 220 rpm for 24 h and 48 h, and the yield of ergothioneine in the fermentation broth was detected.

[0105] Shake flask validation results ( Fig.11 ) It was found that the 10 selected strains were basically consistent with the well plate verification results, and the yield was more than 20% higher than that of the control group.

[0106] (9) Sequencing:

[0107] The plasmids of strains with yields in both the well plate and the shake flask that were 20% higher than those in the control group were sent for testing, and the sequence of N20 was detected, and its corresponding gene was found. Fig. 9As shown, the N20 sequences of 8-3, 5-1, 6-3, and 9-4 were different, but they targeted the yccM gene at the same time. The average yield of the four groups was 38.7% higher than that of the control group. The N20 sequences of 54-7, 10-5, and 6-2 were different, but they targeted the agn43 gene at the same time. The average yield of the three groups was 24% higher than that of the control group. The N20 sequences of 7-10 and 7-3 were the same, and they targeted the xylF gene at the same time as 4-10. The average yield of the three groups was 20.7% higher than that of the control group.

[0108] (10) Knockout verification:

[0109] The selected genes were knocked out in the BW25113-egt1-egt2 genome (refer to the method in the following literature: KOMOR AC, KIM YB, PACKER MS, ZURIS JA, LIU DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage [J]. Nature, 2016, 533 (7603): 420-424.), and the knockout strains BW25113-egt1-egt2△yccM, BW25113-egt1-egt2△xylF, BW25113-egt1-egt2△agn43, BW25113-egt1-egt2△yccM△xylF, BW25113-egt1-egt2△agn43, BW25113-egt1-egt2△yccM△xylF, BW25113-egt1-egt2△ 2△yccM△agn43, BW25113-egt1-egt2△agn43△xylF and BW25113-egt1-egt2△yccM△agn43△xylF were shake flask verified. The verification results showed that the silencing effect of dcas9 was consistent after single gene knockout. After double gene knockout, the yield of the △yccM△xylF combination was increased, which was 48.8% higher than that of the control group. The yield after three gene knockout was consistent with the effect of single knockout.

[0110] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A screening method for thioneine high-yield strains, characterized in that, The method comprises the following steps: transferring an sgRNA library constructed based on the genome of an EGT chassis strain and an EGT sensor carrying an EGT riboswitch into an EGT chassis strain whose genome is integrated with egt1 gene and egt2 gene, and then performing fermentation culture, characterizing the expression level of EGT in the fermentation broth by the fluorescence intensity of the fermentation broth, and screening out negative factor genes affecting EGT expression.

2. The method according to claim 1, characterized in that The method comprises the following steps: S1, construction of sgRNA library based on the genome of EGT chassis strain; S2, preparation of bacterial suspension, after transferring the sgRNA library and EGT sensor of S1 into the EGT chassis strain with the egt1 gene and egt2 gene integrated in the genome, collecting the bacteria after spreading culture and diluting to obtain bacterial suspension; S3, droplet generation, using the bacterial suspension in S2 to generate droplets using a droplet microfluidic cell sorting system and a droplet generation chip; S4, droplet sorting, after the droplet culture in S3 is completed, the droplets with higher fluorescence are sorted using a droplet microfluidic cell sorting system and a droplet sorting chip, which are positive droplets; S5, plate culture and verification, the positive droplets of S4 are demulsified and plated, the monoclonal clones obtained by culture are verified for yield, and the ones with high yield are screened; S6, sequencing, sequencing the high-yield N20 screened out in S5, and the obtained targeted gene is the negative factor gene that affects EGT expression; S7, knockout verification, knockout verification of the targeted gene of S7.

3. The method according to claim 1 or 2, characterized in that: The EGT chassis strain is Escherichia coli BW25113.

4. The method according to claim 1 or 2, characterized in that: The sgRNA library was constructed using the pCasi plasmid, in which the aspartic acid D at position 10 of the Cas9 protein in the pCas plasmid was mutated to alanine A, and the histidine at position 840 was mutated to alanine A.

5. The method according to claim 1 or 2, characterized in that: The EGT sensor is a pET21a-Apt-GFP plasmid, which is obtained by connecting the promoter J23119, the EGT riboswitch sequence, the GFP gene and the linearized vector pET21a. The nucleotide sequence of the EGT riboswitch is shown in SEQ ID NO: 1; The egt1 gene and the egt2 gene are targeted on the EGT chassis strain genome by cas9 technology. The nucleotide sequence of the egt1 gene is shown in SEQ ID NO:2, and the nucleotide sequence of the egt2 gene is shown in SEQ ID NO:

3.

6. The method according to claim 2, characterized in that In S2, the OD of the bacterial suspension is 0.01-0.05; the glycerol content in the coated culture medium is 5 g / L or 10 g / L; In S3, the culture time of the generated droplets was 18–48 h; In S5, the demulsification method is to add 100 μL 1H,1H,2H,2H-perfluoro-1-octanol and 100 μL culture medium to the droplets obtained by sorting, flick with fingers for 3 minutes, let stand for about 5 minutes, and suck the water phase out of the coating plate.

7. An Escherichia coli mutant having improved thioneine production ability, characterized in that: The mutant strain is an Escherichia coli in which the expression of yccM gene, agn43 gene and / or xylF gene is inhibited, and the Escherichia coli also overexpresses egt1 gene and egt2 gene. The nucleotide sequence of the egt1 gene is shown in SEQ ID NO:2, and the nucleotide sequence of the egt2 gene is shown in SEQ ID NO:

3.

8. The Escherichia coli mutant according to claim 7, characterized in that: The mutant strain is Escherichia coli in which the yccM gene, the agn43 gene and / or the xylF gene are knocked out; optionally, the mutant strain is Escherichia coli in which the yccM gene and the xylF gene are knocked out.

9. Use of the method according to any one of claims 1 to 6, or the mutant strain according to claim 7 or 8 in the preparation of ergothioneine or a product containing ergothioneine.

10. Application of yccM gene, agn43 gene or xylF gene in improving the ability of Escherichia coli to produce ergothioneine, wherein one or more of the yccM gene, agn43 gene or xylF gene of Escherichia coli are knocked out, and the Escherichia coli also overexpresses egt1 gene and egt2 gene at the same time, the nucleotide sequence of the egt1 gene is shown in SEQ ID NO: 2, and the nucleotide sequence of the egt2 gene is shown in SEQ ID NO: 3.

Images