Nucleic acid construct and application method thereof

Abstract

The invention provides a nucleic acid construct for improving the display efficiency of ribosomes, the nucleic acid construct comprises a coding sequence of a leader peptide, a target molecule sequence, a spacer sequence, a polyamino acid sequence, a stem-loop structure sequence and other structures, and the nucleic acid construct can enable mRNA on the ribosomes to stop in time during translation, thereby improving the display efficiency of the ribosomes. The stability of the'mRNA-ribosome-protein 'ternary complex is enhanced, the enrichment effect of the target protein or gene is improved, and the overall screening efficiency of the ribosome display technology is improved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a nucleic acid construct for improving ribosome display efficiency, a plasmid and a genetically engineered cell containing the nucleic acid construct, and a method for performing ribosome display using the nucleic acid construct. Background Art

[0002] Functional proteins, as active proteins that can recognize and specifically bind to other molecules, play a very important role in the treatment of diseases, especially some major diseases such as immune diseases and cancer, and are attracting more and more attention in the field of medicine. At present, common functional proteins include antibodies, peptides, enzymes, etc. Antibody drugs have good targeting, significant therapeutic effects, and few side effects, and the demand is increasing. Therefore, one of the key technologies in the preparation of antibody drugs, antibody screening technology, has become increasingly important. Currently, the more commonly used antibody screening technologies include hybridoma technology, antibody library screening technology, nanoantibody technology, and transgenic mouse antibody screening technology. Among them, antibody library screening is divided into phage display screening technology, yeast surface display technology, ribosome display technology, and mRNA display screening technology.

[0003] Ribosome Display Technology (RDT) is a new technology that uses functional protein interactions for screening. It combines correctly folded proteins and their mRNAs on ribosomes to form a ternary complex of "mRNA-ribosome-protein", linking the genotype and phenotype of the target protein. The target functional protein is then screened out by a specific method. Since the ternary complex is combined together, the nucleotide sequence corresponding to the target protein can be directly obtained, and then cDNA is obtained through RT-PCR (RT-PCR) technology. After multiple rounds of enrichment, high-affinity antibodies and their corresponding genes can be obtained.

[0004] The main steps of ribosome display technology are: construction of the gene library to be screened, transcription and translation, affinity screening and separation, reverse transcription to obtain cDNA, etc. Among them, transcription and translation can be carried out in vivo or in vitro synthesis system. The in vitro translation system (also known as in vitro cell-free protein synthesis system, referred to as D2P technology) has the advantages of large library capacity, short screening cycle, simple operation, and high production efficiency. At present, the commonly used in vitro transcription and translation systems include Escherichia coli, rabbit reticulocytes, wheat germ, insects, and human systems. Among them, Escherichia coli lysate is a relatively complete prokaryotic CFPS system that can achieve high-throughput expression of proteins, but it has certain limitations in the post-translational modification of functional proteins. However, in the eukaryotic system, the rabbit reticulocyte lysate system needs to be supplemented with micrococcal nuclease to achieve the expression of functional proteins; the wheat germ system lacks post-translational modification methods such as glycosylation; in general, the cultivation of eukaryotic cells is difficult and expensive, and the preparation process of their cell extracts is cumbersome.

[0005] In addition, although the current ribosome display technology is relatively mature, in actual operation, the "mRNA-ribosome-protein" ternary complex is easily decomposed or separated by enzymes, and the target protein also has problems such as being unable to form an active spatial structure, thus affecting subsequent separation, enrichment and other steps. Therefore, how to form a stable "mRNA-ribosome-protein" ternary complex and display the target protein on the ribosome in the correct spatial conformation is a key issue of this technology.

[0006] In order to solve the stability problem of the ternary complex, the prior art has proposed many improvement methods, such as removing the stop codon at the 3′ end of mRNA, adding a stem-loop structure (such as US20200332280A1, CN1289668C) at the end of mRNA, delaying translation codons and enhancers (such as US6733970B2), or adding components of a stable ternary complex to the transcription and translation system (such as US9896685B2), etc., but the overall screening efficiency is still low, and usually multiple rounds of screening are required to effectively separate the target gene or protein, and the current transcription and translation application is mainly the Escherichia coli system, which has a certain limitation on the function and activity of the protein. There is no specific implementation method for applying the yeast in vitro translation system to the ribosome display process, and there is no research on how to improve the stability and screening efficiency of the "mRNA-ribosome-protein" ternary complex in the yeast cell-free system. Summary of the invention

[0007] The purpose of the present invention is to provide a nucleic acid construct for improving the efficiency of ribosome display, which can be used to quickly display ribosomes in vitro and efficiently achieve screening. Specifically, the yeast D2P technology platform is used to promote the formation of a stable "mRNA-ribosome-protein" ternary complex by designing and constructing a specific nucleotide sequence, and the specific adsorption of the screening tag is used to improve the screening and enrichment effect, thereby improving the screening efficiency of the target protein or gene.

[0008] The first aspect of the present invention provides a nucleic acid construct, which is used to transform a gene to be screened, thereby obtaining a transformed gene fragment, so that the "mRNA-ribosome-protein" ternary complex obtained by transcription and translation is more stable. The nucleic acid construct comprises a leader peptide sequence, a tag protein sequence, a spacer sequence, a polyamino acid sequence, a stem-loop structure sequence and other structures.

[0009] The nucleic acid construct has the structure of formula (I) from 5' to 3':

[0010] Z1-Z2-Z3-Z4-Z5(I)

[0011] In the formula,

[0012] Z1-Z5 are elements used to constitute the construct respectively;

[0013] Each "-" is independently a bond or a nucleotide linking sequence;

[0014] Z1 is the coding sequence of the leader peptide;

[0015] Z2 is a target molecule; the target molecule is a coding sequence of an exogenous protein or a coding sequence of an exogenous protein connected to a tag protein.

[0016] The tag protein is selected from the group consisting of 6His tag, 8His tag, streptavidin STN and any combination thereof;

[0017] Z3 is a spacer sequence, and the spacer sequence is selected from the group consisting of a partial amino acid sequence encoded by the III region of bacteriophage M13 gene (M13 gene III), the TonB sequence of Escherichia coli E.coli, the TO1A sequence of Escherichia coli E.coli, and a combination thereof;

[0018] Z4 is a polyamino acid sequence, wherein the polyamino acid is selected from polyarginine, polylysine and a combination thereof;

[0019] Z5 is a stem loop sequence.

[0020] In the present invention, the sources of the Z1, Z2, Z3, Z4, and Z5 elements are not particularly limited.

[0021] In a preferred example, the leading peptide sequence has a sequence as shown in SEQ NO.1, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.1 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0022] In a preferred example, the tag protein is an 8His tag or a 6His tag. The 8His tag has a sequence as shown in SEQ NO.2, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.2 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as 98% or more, 99% or more. The 6His tag has a sequence as shown in SEQ NO.3, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.3 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as 98% or more, 99% or more.

[0023] In another preferred embodiment, the tag protein is 8His tag.

[0024] In another preferred embodiment, the exogenous protein is an active protein with certain functionality to be screened, and its coding sequence comes from prokaryotes or eukaryotes.

[0025] In another preferred embodiment, the coding sequence of the exogenous protein comes from animals, plants, or pathogens.

[0026] In another preferred embodiment, the coding sequence of the exogenous protein is from mammals, preferably primates, rodents, including humans, mice, and rats.

[0027] In another preferred embodiment, the exogenous protein is selected from the following group: luciferin, or luciferase, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody (scFV), thyroxine transporter, tyrosinase, xylanase, etc., or a combination of any of the above proteins.

[0028] In a specific embodiment, the exogenous protein is green fluorescent protein, and its coding sequence has a sequence as shown in SEQ NO.4, or a sequence with ≥80% identity to the amino acid sequence shown in SEQ NO.4 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0029] In another preferred example, the spacer sequence is a partial amino acid sequence encoded by region III of the bacteriophage M13 gene (M13geneⅢ), and the partial amino acid sequence encoded by region III of the bacteriophage M13 gene has a sequence as shown in SEQ NO.5, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.5 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0030] In another preferred embodiment, the polyamino acid sequence is a polyarginine sequence, and the polyarginine has a sequence as shown in SEQ NO.6, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.6 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0031] In another preferred example, the stem-loop structure sequence has a sequence as shown in SEQ NO.7, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.7 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0032] In another preferred embodiment, a linker sequence is included between the tag protein sequence and the coding sequence of the exogenous protein, and the linker sequence has a sequence that is not easy to form a secondary structure (such as an AT-rich sequence, no hairpin structure, no G-quadruplex, etc.) and is not rich in rare codons.

[0033] In another preferred example, the connecting sequence between the tag protein sequence and the coding sequence of the exogenous protein is Linker 1, and the Linker 1 has a sequence as shown in SEQ NO.8.

[0034] In another preferred embodiment, the 5' end upstream of the nucleic acid construct further includes a promoter, and the promoter is located at the 5' end of the nucleic acid construct.

[0035] In another preferred embodiment, the promoter is selected from the following group: T7 promoter, T3 promoter, SP6 promoter, or a combination thereof.

[0036] In another preferred embodiment, the promoter is a T7 promoter, and the T7 promoter has a sequence as shown in SEQ NO.9, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.9 and having the same activity.

[0037] In another preferred embodiment, a 5'UTR sequence is further included between the promoter and the leader peptide, and the sequence preferably has a sequence as shown in SEQ NO.10, or a sequence having ≥80% identity with the amino acid sequence shown in SEQ NO.10 and having the same activity, preferably, ≥85% identity, preferably ≥90% identity; more preferably ≥95% identity; most preferably, ≥97% identity, such as above 98%, above 99%.

[0038] In another preferred embodiment, the nucleic acid construct further comprises a start codon, which is located after the 5'UTR sequence and before the leader peptide, and its sequence is ATG.

[0039] The second aspect of the present invention provides a vector or a vector combination, wherein the vector or the vector combination contains the nucleic acid construct described in the first aspect.

[0040] In another preferred embodiment, the vector is selected from: bacterial plasmid, bacteriophage, yeast plasmid, etc. The specific vector type can be selected from: expression vector, cloning vector or shuttle vector, etc. The method for preparing the recombinant vector is well known to those of ordinary skill in the art. As long as it can stably replicate and express, any plasmid and vector can be used.

[0041] Those skilled in the art can use well-known methods to construct expression vectors containing the promoter and / or target gene sequence of the present invention, including in vitro recombinant DNA technology, artificial DNA synthesis technology, in vivo recombination technology, etc.

[0042] The third aspect of the present invention provides a genetically engineered cell, wherein one or more sites of the genome of the genetically engineered cell are integrated with the nucleic acid construct described in the first aspect of the present invention, or the genetically engineered cell contains the vector or vector combination described in the second aspect of the present invention.

[0043] In a preferred embodiment, the genetically engineered cells are eukaryotic cells.

[0044] In another preferred embodiment, the genetically engineered cells are yeast cells.

[0045] In another preferred embodiment, the yeast cell is selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces yeast, Pichia pastoris, or a combination thereof.

[0046] In another preferred embodiment, the yeast of the genus Kluyveromyces is selected from the group consisting of Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobsonii, or any combination thereof; more preferably Kluyveromyces lactis.

[0047] A fourth aspect of the present invention provides a kit for ribosome display technology, characterized in that the reagents contained in the kit are selected from one or more of the following groups:

[0048] (a) the construct according to the first aspect of the present invention;

[0049] (b) the vector or vector combination according to the second aspect of the present invention; and

[0050] (c) The genetically engineered cell according to the third aspect of the present invention.

[0051] In another preferred embodiment, the kit further comprises (d) a eukaryotic in vitro biosynthesis system (such as a eukaryotic in vitro protein synthesis system), preferably a yeast in vitro biosynthesis system (such as a yeast in vitro protein synthesis system).

[0052] In another preferred embodiment, the yeast in vitro biosynthesis system is a Kluyveromyces in vitro biosynthesis system, such as a Kluyveromyces in vitro protein synthesis system, preferably a Kluyveromyces lactis in vitro biosynthesis system, such as a Kluyveromyces lactis in vitro protein synthesis system.

[0053] The fifth aspect of the present invention provides a use of the construct as described in the first aspect of the present invention, the vector or vector combination as described in the second aspect of the present invention, the genetically engineered cell as described in the third aspect of the present invention, or the kit as described in the fourth aspect of the present invention for nucleic acid display to enrich and screen target genes or proteins.

[0054] The sixth aspect of the present invention provides a method for rapidly performing ribosome display in vitro using a D2P (DNA to Protein, i.e., an in vitro protein synthesis system) platform, comprising the steps of:

[0055] (1) Constructing a screening template: synthesizing the aforementioned nucleic acid construct, then using PCR technology to construct a plasmid containing the nucleic acid construct, and performing PCR amplification on the plasmid containing the nucleic acid construct to obtain a DNA library for screening.

[0056] (2) In vitro transcription and translation: The DNA library to be screened obtained in the previous step is added to the D2P system for reaction.

[0057] (3) In vitro screening to enrich and screen the reaction products.

[0058] (4) Reverse transcription to obtain cDNA The product obtained from the previous step is used to obtain cDNA through RT-PCR.

[0059] In another preferred embodiment, the method further comprises: (5) recycling the cDNA obtained in step (4) for one, two or more rounds of screening in steps (1)-(4) to enrich more target genes or proteins.

[0060] In another preferred embodiment, the method further includes: (6) adding a detection step after step (4) or step (5).

[0061] In another preferred embodiment, the plasmid containing the nucleic acid construct is prepared by conventional gene synthesis technology, such as artificial synthesis or PCR technology.

[0062] In another preferred embodiment, the amplification of the plasmid containing the nucleic acid construct is carried out using primers.

[0063] In another preferred embodiment, the in vitro transcription and translation are carried out in a yeast in vitro protein synthesis system, preferably a Kluyveromyces in vitro protein synthesis system, and more preferably a Kluyveromyces lactis in vitro biosynthesis system.

[0064] In another preferred embodiment, the in vitro transcription and translation are carried out at room temperature, and the reaction time is 40-120 min; preferably, the reaction is carried out at 25-30°C for 60 min.

[0065] In another preferred embodiment, the in vitro screening is performed using adsorption magnetic beads, preferably His beads, and is preferably incubated at 2-6°C for 0.5-2h, more preferably at 4°C for 1h.

[0066] In another preferred embodiment, the in vitro screening is repeated 2 times, 3 times or more times.

[0067] In another preferred embodiment, the content (molar ratio) of the target molecule or target gene in the gene library to be screened is ≥ 1:10 6 , preferably ≥ 1:10 5 ; More preferably ≥1:10 3 .

[0068] In another preferred embodiment, the in vitro screening is performed after adsorption with adsorption magnetic beads, followed by thorough washing with ultrapure water, and then DNaseI (Takara) is added to digest and remove the DNA bound to the beads. Preferably, the adsorption magnetic beads are His Beats.

[0069] In another preferred embodiment, the process of adding DNaseI (Takara) digestion is carried out in a digestion system, and the digestion system includes one or more of the following components: 10X buffer, DEPC H2O, and DNase I.

[0070] In another preferred embodiment, the digestion is carried out at 30-40°C, more preferably at 37°C for 30 min.

[0071] In another preferred embodiment, the reverse transcription is performed in a reverse transcription system, which includes at least one of the following components: RNA (mixed with beads), Primer (10 μM), 5X buffer, 10 mM dNTP, and reverse transcriptase MMLV 2.

[0072] In another preferred embodiment, after the in vitro screening is performed using adsorption magnetic beads, DNaseI (Takara) is directly added to digest and remove the DNA bound to the beads.

[0073] In another preferred embodiment, the reverse transcription is followed by a heat denaturation reaction.

[0074] Beneficial Effects of the Invention

[0075] 1) The present invention develops a new nucleic acid construct for improving the efficiency of ribosome display screening for the first time. The nucleic acid construct comprises specific structures such as a leader peptide sequence, a target molecule sequence, a spacer sequence, a polyamino acid sequence, and a stem-loop structure sequence. By designing a nucleic acid sequence with a specific structure, a target molecule containing a target gene is inserted into the nucleic acid sequence, which can stop the translation of mRNA on the ribosome in time and prevent RNA degradation, thereby ensuring the stability of the "mRNA-ribosome-protein" ternary complex, which is conducive to the completion of ribosome display.

[0076] 2) When a tagged protein is added to the constructed target molecule, in the subsequent screening process, the screening tag has a specific adsorption effect, which greatly improves the enrichment effect of the target protein or gene and improves the overall screening efficiency of the ribosome display technology. When a tagged protein is added to the constructed target molecule, it can be used as a test to verify the screening effect of the nucleic acid construct in the ribosome display technology.

[0077] 3) The present invention also provides a series of products or methods related to the above-mentioned nucleic acid constructs that can be used for ribosome display, such as kits, ribosome display methods, etc., which facilitate the use of the nucleic acid constructs and the operation of ribosome display, can greatly save the screening time of ribosome display technology, and improve the screening efficiency of functional proteins such as monoclonal antibodies, enzymes, etc.

[0078] 4) In addition, the present invention adopts an in vitro translation system, specifically a yeast in vitro translation system. As the in vitro translation system that the applicant has been committed to studying, the yeast system, especially the Kluyveromyces system, has outstanding advantages. It overcomes the limitations of the Escherichia coli system in post-translational modification of proteins and the high culture cost of the rabbit reticulocyte lysate system and the wheat germ system. It is more conducive to large-scale experiments or production, and the capacity of constructing a ribosome screening library is greatly improved and the process cycle is shortened.

[0079] 5) The nucleic acid construct of the present invention can be used to more efficiently enrich the target gene, even if the target gene accounts for a low proportion in the screening library (e.g., 1 / 10 of the total molar number of the gene library). 5 , or lower), it can also be effectively enriched and displayed, which shows that it plays an important role in achieving efficient ribosome screening.

[0080] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 The schematic diagrams of the structures of various nucleic acid constructs described in the present invention are shown. Figure 1 a is PC, Figure 1 b and 1c are control examples NC and PC2, respectively.

[0082] Figure 2 The DNA agarose gel electrophoresis images of the target sequence amplification products of PC and NC are shown.

[0083] Figure 3 The agarose gel electrophoresis of the DNA recovered after screening of PC, NC and PC and NC mixed in a molar ratio of 1:1 is shown, which are marked as PC, NC, PC:NC=1:1 respectively. In the PCR detection, the primer pair 2F and 2R are used to amplify the cDNA.

[0084] Figure 4 The figure shows the agarose gel electrophoresis of DNA recovered after the same amount of PC2 and PC were used for ribosome display.

[0085] Figure 5 It shows that PC and NC are 1:10, 1:10 3 , 1:10 5 The agarose gel electrophoresis diagram of the DNA recovered after screening with a molar ratio of , wherein the primer pair 2F and 2R was used to amplify cDNA in PCR detection.

[0087] Figure 6 Shows PC and NC at 1:10 5 , 1:10 6 , 1:10 7 The agarose gel electrophoresis diagram of the DNA recovered after screening with a molar ratio of , which are marked as 5, 6, and 7 respectively, wherein the primer pair 3F and 2R are used to amplify cDNA in PCR detection. DETAILED DESCRIPTION

[0088] After extensive and in-depth research, as well as a large amount of screening and exploration, the applicant unexpectedly discovered for the first time a nucleic acid construct for ribosome display. The nucleic acid construct of the present invention comprises a T7 promoter, a 5'UTR, a start codon, a coding sequence of a leader peptide, a target molecule sequence, a spacer sequence, a polyamino acid sequence, a stem-loop structure sequence and other structural compositions, and is used after an optional 5' end.

[0089] Experiments have shown that the use of the nucleic acid construct of the present invention to modify the target gene and then perform ribosome display can improve the stability of the "mRNA-ribosome-protein" ternary complex and increase the enrichment level of the target gene or protein, thereby improving the screening efficiency of ribosome display. Even if the proportion of the target gene in the screening library is low (e.g., 1 / 10 of the total gene library), 5 , or lower), it can also effectively enrich and display it.

[0090] The present invention is further illustrated below in conjunction with specific implementation methods and examples. For the specific methods or materials used in the examples, those skilled in the art can make conventional replacement selections based on the technical ideas of the present invention and according to existing technologies, and are not limited to the specific description of the embodiments of the present invention.

[0091] Terminology

[0092] The "ribosome display technology" (RDT or RD) in the present invention refers to a technology for simultaneously obtaining target proteins and genes through ribosome transcription and translation processes. The main steps of the ribosome display technology are: construction of a gene library to be screened (or modification of gene fragments), transcription and translation, affinity screening and separation, reverse transcription to obtain cDNA, etc. In the transcription and translation process, it is necessary to obtain a "mRNA-ribosome-protein" ternary complex to achieve the coexistence of genotype and phenotype.

[0093] The "mRNA-ribosome-protein" ternary complex of the present invention refers to the protein obtained after translation into protein due to the lack of mRNA termination codon during ribosome translation, which cannot be separated from mRNA and ribosome, and the three remain connected together, thus forming a ternary complex. Since RNA is easily degraded by RNase, how to ensure the stability of the ternary complex has an important impact on the effect of ribosome display.

[0094] The "in vitro translation system" in the present invention has the same meaning as the expressions "in vitro cell-free protein synthesis system", "in vitro expression system", "in vitro protein synthesis system", "in vitro protein synthesis reaction system", "cell-free protein synthesis system", etc., and can be described as protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), in vitro transcription and translation system (IVTT system), D2P system, D-to-P system, D_to_P system, DNA-to-Protein system, etc.

[0095] In the in vitro translation system (D2P system) of the present invention, the D2P system, template, plasmid, target protein, in vitro protein synthesis reaction (incubation reaction), various preparation methods, various detection methods and other technical elements can also be independently selected from the following documents. Suitable implementation methods or implementation methods include but are not limited to CN111484998A, CN106978349A, CN108535489A, CN108690139A, CN108949801 A, CN108642076A, CN109022478A, CN109423496A, CN109423497A, CN109423509A, CN109837293A, CN109971783A, CN109988801A, CN109971775A, CN110093284A, CN110408635A, CN110408636A, CN110551745A, CN110551700A, CN110551785A, CN110819647A, CN110845622A, CN110938649A, CN110964736A and other documents. Unless otherwise inconsistent with the purpose of the present invention, these documents and the documents cited are cited in their entirety and for all purposes.

[0096] The yeast in the present invention has the advantages of simple cultivation, efficient protein folding, and post-translational modification. At present, Saccharomyces cerevisiae and Pichia pastoris are commonly used model organisms for expressing complex eukaryotic proteins and membrane proteins. Yeast can also be used as a raw material for preparing an in vitro translation system, that is, yeast extract can be used for in vitro protein translation expression, and the yeast commonly used for in vitro protein expression is also Pichia pastoris or Saccharomyces cerevisiae. Kluyveromyces is an ascospore yeast, among which Kluyveromyces marxianus and Kluyveromyces lactis are widely used yeasts in industry. Compared with other yeasts, Kluyveromyces lactis has many advantages, such as super strong secretion ability, better large-scale fermentation characteristics, food safety level, and the ability of protein post-translational modification at the same time, and has great application potential. In a preferred embodiment of the present invention, an in vitro protein expression system of Kluyveromyces lactis is used.

[0097] In the present invention, the in vitro protein synthesis system comprises: a yeast cell extract and an optional solvent, wherein the solvent is water or an aqueous solvent.

[0098] In a particularly preferred embodiment, the D2P system provided by the present invention also includes: 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, a nucleoside triphosphate mixture, an amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, an RNase inhibitor, luciferin, luciferase DNA, and RNA polymerase.

[0099] In the present invention, the RNA polymerase can be selected from one or more RNA polymerases, and the commonly used RNA polymerase is T7 RNA polymerase.

[0100] In the present invention, the yeast cell extract accounts for 20-70% of the in vitro protein synthesis system, preferably 30-60%, and more preferably 40-50%.

[0101] In the present invention, the yeast cell extract does not contain intact cells. A typical yeast cell extract includes ribosomes, transfer RNA, aminoacyl tRNA synthetase, initiation factors and elongation factors required for protein synthesis, and termination release factors. In addition, the yeast extract also contains some other proteins derived from the cytoplasm of yeast cells, especially soluble proteins.

[0102] In the present invention, the protein content of the yeast cell extract is 10-100 mg / mL, preferably 20-80 mg / mL. The method for determining the protein content is the Coomassie Brilliant Blue determination method.

[0103] The "leader peptide sequence" (Leader Peptide, or Leading peptide, abbreviated as LP) in the present invention refers to a type of signal peptide, which is located at the N-terminus of the mature protein, guides the protein to penetrate the membrane, and is subsequently cleaved off. Generally, the leader peptide contains more basic amino acids and hydroxyl amino acids, and is easy to form an α-helical structure, which is convenient for penetrating the membrane. In the present invention, a leader peptide sequence with 51 nucleotides is designed, and the specific sequence is shown in SEQ NO.1.

[0104] The "tag protein sequence" in the present invention refers to a sequence encoding a specific protein, which is used in the ribosome display system. During purification, an affinity adsorbent that can form a reversible bond with the tag protein molecule can be selected, and other proteins and impurities are not adsorbed, and only the fusion protein containing the tag protein is adsorbed on the affinity material. In this way, the part containing the target protein to be separated is purified using an appropriate buffer. The tag protein in the present invention includes but is not limited to hexahistidine (6His, His6 or 6His tag and other equivalent expressions), octahistidine (8His, His8 or 8His tag and other equivalent expressions), thioredoxin, calmodulin-binding protein, glutathione S-transferase, and α-factor, etc. The histidine tag can react specifically with a variety of metal ions, such as Ca2+, Mg2+, Ni2+, Co2+, etc. Therefore, during screening, the target substance containing the histidine tag can be separated by using magnetic beads (Beats, or His beats) containing metal ions for specific adsorption. The present invention preferably uses 6His tag and / or 8His tag, and the most preferred is 8His tag, and the specific sequence is shown in SEQ NO.2.

[0105] The "coding sequence of exogenous protein" in the present invention, also known as "exogenous DNA", "target gene sequence", "target protein coding sequence", etc., refers to an exogenous DNA molecule used to guide protein synthesis. Usually, the DNA molecule is linear or circular. The DNA molecule contains a sequence encoding an exogenous protein.

[0106] In the present invention, examples of sequences encoding foreign proteins include, but are not limited to, genomic sequences and cDNA sequences. The sequences encoding foreign proteins also include promoter sequences, 5' untranslated sequences, 3' untranslated sequences, and the like.

[0107] In the present invention, the exogenous DNA varies based on actual needs and is not particularly limited. Typically, the exogenous DNA encodes a protein selected from the following group: luciferin, luciferase (such as firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, antibody or its variable region, luciferase mutant, or any combination thereof.

[0108] The exogenous DNA may also encode a protein selected from the group consisting of α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody (scFV), transthyretin, tyrosinase, xylanase, or any combination thereof.

[0109] In a preferred embodiment, the exogenous DNA encodes a protein selected from the group consisting of enhanced GFP (eGFP or EGFP), yellow fluorescent protein (YFP), Escherichia coli β-galactosidase (LacZ), human lysine-tRNA synthetase, human leucine-tRNA synthetase, Arabidopsis glyceraldehyde 3-phosphate dehydrogenase, mouse catalase, or a combination thereof. The subsequent examples use a green fluorescent protein (enhanced GFP, eGFP or EGFP) coding sequence having a sequence as shown in SEQ NO.4.

[0110] The "spacer" in the present invention, also known as the spacer sequence, spacer sequence, etc., refers to a non-coding DNA sequence of unknown function existing between genes in the genome. It exists in eukaryotic cells and certain viral genomes, and usually contains highly repetitive DNA. The spacer sequence is selected from the partial amino acid sequence encoded by the III region of the bacteriophage M13 gene (M13geneⅢ), the TonB sequence of Escherichia coli E.coli, the TO1A sequence of Escherichia coli E.coli and a combination thereof. Preferably, M13geneⅢ is used, which has a sequence as shown in SEQ NO.5.

[0111] The "polyamino acid sequence" in the present invention refers to a gene sequence that can repeatedly encode the same amino acid. Unlike the aforementioned tag protein sequence, the polyamino acid sequence mainly plays a role in inducing translation stop in mRNA translation. The polyamino acid used in the present invention is selected from polyarginine, polylysine and a combination thereof; preferably, polyarginine (Poly Arg) is used, which has a sequence as shown in SEQ NO.6. The polyamino acid sequence is an important sequence in the present invention. Its use in combination with the stem-loop structure can ensure the effective stop of translation and greatly enhance the stability of the "mRNA-ribosome-protein" ternary complex.

[0112] The "stem loop structure sequence" (Stem loop) in the present invention, also known as stem loop sequence, stem loop, refers to the inverted repeat sequence present in the single-stranded RNA molecule. Due to the hydrogen bond pairing between complementary bases, the long chain segment can be folded back to form a secondary structure. In ribosome display technology, a stem loop structure is often added to the 5' end and 3' end of the gene fragment to prevent the degradation of mRNA, thereby promoting the stability of the "mRNA-ribosome-protein" ternary complex. The stem loop structure sequence used in the present invention has a structure as shown in SEQ NO.7.

[0113] The "promoter" in the present invention refers to a DNA sequence upstream of the 5' end of the structural gene, which can activate RNA polymerase, enable it to accurately bind to the template DNA and have the specificity of transcription initiation. The promoter is like a "switch" that determines the activity of the gene. The promoter of the present invention is selected from the following group: T7 promoter, T3 promoter, SP6 promoter, or a combination thereof; preferably T7 promoter. Among them, T7 promoter (T7 promoter) is a strong promoter from T7 bacteriophage that can specifically respond to T7 RNA polymerase. It is a sequence that initiates the transcription of T7 bacteriophage genes, is commonly used in various commercial plasmid vectors, and can be expressed in both prokaryotic and eukaryotic systems. The T7 promoter used in the present invention has a structure as shown in SEQ NO.9.

[0114] The "5'UTR" in the present invention refers to the region of mature mRNA located upstream of the coding region (CDS) and downstream of the 5' end cap that is not translated into protein, i.e., the 5' untranslated region. Generally, the 5'UTR has a translational regulatory function, plays an important role in maintaining the stability of mRNA and localization in cells, and also promotes or inhibits the translation process. The 5'UTR designed in the present invention is derived from yeast cells and contains 143 bases, and its specific sequence is shown in SEQ NO.10.

[0115] The "initiation codon" in the present invention refers to a codon that specifies the starting site of protein synthesis. The most common initiation codon is a methionine or valine codon. The initiation codon used in the embodiments of the present invention is ATG.

[0116] "Reverse transcription" in the present invention is the process of synthesizing DNA using RNA as a template, that is, DNA synthesis under the guidance of RNA. In this process, the nucleic acid synthesis and transcription (DNA to RNA) process is opposite to the flow direction of genetic information (RNA to DNA), so it is called reverse transcription. Reverse transcription usually uses reverse transcription PCR (reverse transcription PCR) or reverse transcription-PCR (RT-PCR), which is a widely used variation of polymerase chain reaction (PCR). In RT-PCR, an RNA chain is reverse transcribed into complementary DNA, and then used as a template for DNA amplification by PCR. After screening and obtaining mRNA, the present invention obtains the corresponding cDNA by reverse transcription RT-PCR to facilitate subsequent detection or continue the next round of ribosome display.

[0117] The present invention is further described below in conjunction with the accompanying drawings and specific examples. In the examples, green fluorescent protein is specifically selected as an example of the target gene for demonstration. In order to achieve the purpose, a label protein is connected in the examples for screening and enrichment. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples where the conditions are not specified are usually carried out according to conventional conditions, such as the experimental conditions described in Sambrook et al. Molecular Cloning Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), "Cell-free Protein Synthesis Laboratory Manual" "Edited by Alexander S. Spirin and James R. Swartz. Cell-free protein synthesis: methods and protocols [M]. 2008", etc., or according to the conditions recommended by the manufacturer. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0118] Example 1: Using the nucleic acid construct of the present invention to construct a target gene (taking EGFP as an example)

[0119] 1. Gene synthesis: Use artificial synthesis or PCR and other gene synthesis methods to connect T7, 5'UTR, ATG, LP, Histag, green fluorescent protein coding sequence (EGFP antibody), M13 geneⅢ, poly Arg, Stem loop and other sequences in series to obtain a nucleic acid construct, which is referred to as PC for the convenience of recording. The main structure of the nucleic acid construct is as follows Figure 1 As shown in a, its base length is 1016bp.

[0120] 2. Construction of plasmid: The target plasmid, i.e., the plasmid containing PC, is obtained by connecting the nucleic acid construct to the plasmid through gene synthesis or PCR technology. The vector plasmid used is a plasmid obtained by the applicant after several rounds of iterative transformation. For the specific sequence, see Table 1 of the specification.

[0121] 3. To verify the screening effect of the nucleic acid construct of the present invention, different nucleic acid constructs were used for comparative experiments. The main expression protein fragments in the nucleic acid construct were set to different lengths, which was conducive to directly judging the enrichment of the target gene by comparing the size of the recovered DNA. Specifically, the EGFP antibody was replaced with EGFP antibody-N-480-EGFP antibody-C, and the His tag was replaced with the Flag tag. The nucleic acid construct NC (Negitive control) was obtained by the whole gene synthesis method. The structure is as follows Figure 1 b, and its base length is 1217 bp. Then, a plasmid for control was constructed, i.e., a plasmid containing NC. The sequence of EGFP antibody-N-480-EGFP antibody-C is shown in SEQ NO.11.

[0122] In addition, a control nucleic acid construct was constructed that was identical to the PC sequence except that the poly Arg was omitted, and was named PC2. Figure 1 c, and the corresponding plasmid, i.e., the plasmid containing PC2, was constructed for control experiments.

[0123] Example 2 Screening of target genes using the nucleic acid construct of the present invention

[0124] 1. Target gene amplification Use the following primers to perform PCR amplification on the target plasmid and the control plasmid to obtain the screening template DNA sequences PC and NC for expression.

[0125] Primer name sequence used

[0126] 1F CGCGAAATTAATACGACTCACTATAGGGAA

[0127] 1R CCGCACACCAGTAAGGTGTG

[0128] The PCR reaction system is as follows:

[0129] 2xbuffer 25μl

[0130] dNTP (10 μM) 1 μl

[0131] Max Super-Fidelity DNA Polymerase 1μl

[0132] Primer 1F (10 μM) 2 μl

[0133] Primer 1R (10 μM) 2 μl

[0134] DNA 0.2 μl

[0135] Make up to 50 μl with DEPC H2O.

[0136] The specific conditions of PCR reaction are:

[0137]

[0138] The obtained product bands were then analyzed by agarose gel. Figure 2 As shown. Figure 2 It can be seen that after the above steps, the desired target gene and control group gene were successfully obtained, and gene sequencing was performed to determine that the sequence of the nucleic acid construct was correct, providing a gene library for transcription and translation.

[0139] 2. Transcription and Translation The screening template DNA sequences PC, NC, and PC:NC obtained above were mixed in a 1:1 molar ratio to verify the enrichment effect.

[0140] Take 33 μl of the above DNA of the same molar concentration and add it to 1 ml of yeast system D2P reaction solution, react at 30° C. for 60 min to perform transcription and translation.

[0141] 3. Screening and enrichment: Add 1 ml of pre-cooled PBSTM (Contains 1×PBS, 10 mMmagnesium acetate, 0.05% (w / v) Tween20, treated with DEPC) solution and His beads to the reaction solution in the previous step, and incubate at 4°C for 1 hour. Use a magnetic stand to adsorb the beads, remove the upper solution, add 500 μl of pre-cooled PBSTM solution to wash thoroughly, remove the upper liquid, and repeat this process 3 times. Use DEPC H2O (ultrapure water treated with 2% diethyl pyrocarbonate and sterilized by high temperature and high pressure) to dissolve, then add RNase free DNaseI (Takara) for digestion, and digest the reaction at 37°C for 30 minutes to remove the DNA bound to the beads to prevent it from interfering with RNA recovery. The digestion system used during digestion is as follows:

[0142] Beads

[0143] 10×buffer 5μl

[0144] DNase I 2 μl

[0145] Make up to 50 μl with DEPC H2O.

[0146] After digestion, wash twice with 500 μl pre-cooled PBSTM solution, quickly wash once with 500 μl pre-cooled DEPC H2O, and add 30 μl H2O. The product is stored at -80°C.

[0147] Pipette the water-soluble complex and perform reverse transcription to obtain cDNA. The reverse transcription system and method are as follows:

[0148] RT Primer:AGAACTAACAGTAACTTGAGTACCT

[0149] RNA (mixed with beads) 12.5μl

[0150] RT Primer (10 μM) 0.5 μl

[0151] 65℃5min, place on ice for 2-5min

[0152] join in

[0153] 5X buffer 4μl

[0154] 10mM dNTP 1μl

[0155] Reverse transcriptase MMLV 2 2μl

[0156] 50℃, 90min; 85℃, 5min reaction;

[0157] The product was stored at -20°C.

[0158] 4. Detection PCR reaction using cDNA:

[0159] Primer name sequence used

[0160] 2F:GCTCAAGTTCAGTTGGTTGAATCTGG

[0161] 2R:AGAACTAACAGTAACTTGAGTACCTTGACC

[0162] The PCR reaction system is as follows:

[0163] 2xbuffer: 12.5μl;

[0164] dNTP (10 μM): 0.5 μl;

[0165] Max Super-Fidelity DNA Polymerase: 0.5μl;

[0166] Primer 2F (10 μM): 1 μl;

[0167] Primer 2R (10 μM): 1 μl;

[0168] cDNA: 0.8 μl;

[0169] Make up to 25 μl with DEPC H2O.

[0170] The specific reaction conditions were as described above for target gene amplification, with the annealing temperature changed to 58°C, extension at 72°C for 40s, and 25 cycles.

[0171] The obtained product bands were then analyzed by electrophoresis, and the results were as follows: Figure 3 As shown. Figure 3 As can be seen from the figure, when PC and NC are screened at a ratio of 1:1, the band of PC (348 bp) is more obvious than that of NC (549 bp). Due to the non-specific adsorption of beads, only adding NC can also recover some genes, so NC also has bands, but when PC and NC are added at the same molar number, PC can be effectively enriched. It can be seen that the nucleic acid construct constructed in the embodiment can effectively screen and separate the target gene.

[0172] Example 3 verifies the stabilizing effect of poly Arg on the "mRNA-ribosome-protein" ternary complex;

[0173] According to the construction method in Example 1, the corresponding nucleic acid construct and plasmid were constructed, and the construction was verified to be successful. After that, the PC gene sequence for translation and expression and the PC2 gene sequence without poly Arg were added to two groups of the same yeast D2P system with the same number of moles of nucleic acid, and the transcription, translation and subsequent screening, enrichment and detection operations were performed according to the method described in Example 2, and then the obtained product bands were analyzed by electrophoresis. The primers used in the detection step were also the same as those in Example 2.

[0174] Structure Figure 4 As shown, the band marked with PC refers to the detection result of the PC gene, and the band marked with PC2 refers to the detection result corresponding to PC2. From the brightness comparison of the bands, it can be seen that the gene PC containing poly Arg is easier to be screened out than the PC2 without it, which shows that the poly Arg sequence in the nucleic acid construct of the present application is very important for maintaining the stability of the "mRNA-ribosome-protein" ternary complex.

[0175] Example 4 PC and NC were mixed at a ratio of 1:10 and 1:10 respectively. 3 , 1:10 5 The molar ratio was screened.

[0176] The corresponding nucleic acid construct and plasmid were constructed according to the construction method in Example 1. To further verify the stability and enrichment effect of the target nucleic acid construct in forming the "mRNA-ribosome-protein" ternary complex, the PC and NC gene sequences used for translation and expression were mixed at a ratio of 1:10 and 1:10. 3 , 1:10 5 The molar ratio was added to the yeast D2P system for screening.

[0177]

[0178] Transcription, translation, and subsequent screening, enrichment, and detection operations were performed according to the method described in Example 2, and then the obtained product bands were analyzed by electrophoresis. The primers used in the detection step were also the same as those in Example 2.

[0179] Structure Figure 5 As shown. PC and NC are 1:10 and 1:10 respectively. 3 , 1:10 5When the ratio of PC is screened, it can be effectively enriched. It can be seen that the nucleic acid construct constructed in the embodiment can improve the stability of the "mRNA-ribosome-protein" ternary complex during protein translation, thereby effectively screening and separating the target gene. Because PC contains a his tag, the adsorption capacity of PC during screening can be improved, so that PC can be more enriched, and even if the content of PC in the mixed gene library is low, it can still achieve a good enrichment and separation effect.

[0180] Example 5 PC and NC are mixed in a ratio of 1:10 5 , 1:10 6 , 1:10 7 (named 5, 6, 7 respectively) were screened by the molar ratio

[0181] According to the DNA sequences of PC and NC in Example 2, the ratio of 1:10 5 , 1:10 6 , 1:10 7 The molar ratio of 1000 μg / mL was added to the yeast D2P system for transcription, translation, and subsequent screening, enrichment, and detection operations, and then the obtained product bands were analyzed by electrophoresis. Primers 3F / 2R were used for cDNA amplification.

[0182] 3F: GGGAAAAAAGAAATCTCTCAAGCTGAAATTAAACCAAAAC

[0183] 2R:AGAACTAACAGTAACTTGAGTACCTTGACC

[0184] The results are as follows Figure 6 As shown. PC and NC are 1:10 5 , 1:10 6 , 1:10 7 The results of screening showed that PC and NC were 1:10. 5 and 1:10 6 When the ratio was mixed and screened, PC (605 bp) was still enriched, but the 1:10 6 When the ratio or NC content is higher, the separation effect is not significant.

[0185] In summary, the use of the original nucleic acid construct of the present invention can effectively improve the screening efficiency of ribosome display, provide more favorable support for the research of functional proteins, and has broad application prospects.

[0186] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0187] Table 1 Related nucleic acid sequences

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

Claims

1. A nucleic acid construct for ribosome display, characterized in that: The nucleic acid construct has the structure of formula (I) from 5' to 3': Z1-Z2-Z3-Z4-Z5(I) In the formula, Z1-Z5 are elements used to constitute the construct respectively; Each "-" is independently a bond or a nucleotide linking sequence; Z1 is the coding sequence of the leader peptide; Z2 is the coding sequence of the target molecule; Z3 is a spacer sequence; Z4 is a polyamino acid sequence; Z5 is a stem-loop structure sequence; Wherein, the target molecule is an exogenous protein or an exogenous protein connected with a tag protein.

2. The nucleic acid construct for ribosome display according to claim 1, wherein the tag protein is selected from the group consisting of any one or more combinations of 6His, 8His and streptavidin STN; preferably, the tag protein is 8His or 6His; And / or, the spacer sequence is selected from any one or more combinations of a partial amino acid sequence encoded by the bacteriophage M13 gene III region (M13geneIII), the TonB sequence of E. coli and the TO1A sequence of E. coli; And / or, the polyamino acid is selected from any one of polyarginine and polylysine or a combination of the two.

3. The nucleic acid construct for ribosome display according to claim 1, wherein the leader peptide sequence has a sequence as shown in SEQ NO.1, or has an identity of ≥80% with the amino acid sequence shown in SEQ NO.1 and has the same activity as the sequence shown in SEQ NO.1; And / or, the tag protein is selected as 8His, which has the sequence shown in SEQ NO.2, or has an identity of ≥80% with the amino acid sequence shown in SEQ NO.2 and has the same activity as the sequence shown in SEQ NO.2; And / or, the spacer sequence is a partial amino acid sequence encoded by region III of the bacteriophage M13 gene, and the partial amino acid sequence encoded by region III of the bacteriophage M13 gene has a sequence as shown in SEQ NO.5, or has a homology of ≥80% with the amino acid sequence shown in SEQ NO.5 and has the same activity as the sequence shown in SEQ NO.5; And / or, the polyamino acid sequence is a polyarginine sequence, and the polyarginine has a sequence as shown in SEQ NO.6, or has a homology of ≥80% with the amino acid sequence shown in SEQ NO.6 and has the same activity as the sequence shown in SEQ NO.6; And / or, the stem-loop structure sequence has a sequence as shown in SEQ NO.7, or has a consistency of ≥80% with the amino acid sequence shown in SEQ NO.7 and has the same activity as the sequence shown in SEQ NO.

7.

4. The nucleic acid construct for ribosome display according to claim 1, wherein the exogenous protein is from an animal, a plant, a pathogen, preferably from a mammal; more preferably, the coding sequence of the exogenous protein is from a primate or a rodent, including a human, a mouse, or a rat.

5. The nucleic acid construct for ribosome display according to claim 1 or 4, wherein the exogenous protein is a functional protein determined according to actual screening requirements, including but not limited to any one or more combinations of the following: luciferin protein, or luciferase, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody, thyroxine transporter, tyrosinase, xylanase.

6. The nucleic acid construct for ribosome display according to any one of claims 1 to 4, wherein a linker sequence Linker 1 is included between the tag protein sequence and the coding sequence of the exogenous protein; preferably, the Linker 1 has a sequence as shown in SEQ NO.

8.

7. The nucleic acid construct for ribosome display according to any one of claims 1 to 4 or claim 6, wherein the nucleic acid construct further optionally comprises the following fragments or a combination thereof: a promoter, a 5'UTR sequence, a start codon; Preferably, the promoter is selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, or a combination thereof; and / or, the 5'UTR sequence has a sequence as shown in SEQ NO.

10.

8. A vector or a vector combination, wherein the vector or the vector combination comprises the nucleic acid construct according to any one of claims 1 to 7.

9. A genetically engineered cell, characterized in that: The nucleic acid construct according to any one of claims 1 to 7 is integrated into one or more sites of the genome of the genetically engineered cell, or the genetically engineered cell contains the vector or vector combination according to claim 8.

10. A kit for ribosome display technology, characterized in that: The reagents contained in the kit include one or more of the following groups: (a) the construct of any one of claims 1 to 7; (b) the vector or vector combination according to claim 8; (c) The genetically engineered cell according to claim 9.

11. The kit for ribosome display technology according to claim 10, further comprising (d) a eukaryotic in vitro biosynthesis system; the eukaryotic in vitro biosynthesis system is preferably a yeast in vitro biosynthesis system; preferably a Kluyveromyces in vitro biosynthesis system; more preferably a Kluyveromyces lactis in vitro biosynthesis system; another preferred embodiment is that the eukaryotic in vitro biosynthesis system is an in vitro transcription-translation coupling system.

12. A use of the construct according to any one of claims 1 to 7, the vector or vector combination according to claim 8, the genetically engineered cell according to claim 9, or the kit according to claim 10 or 11, characterized in that: Used for nucleic acid display to enrich and screen to obtain the target molecule and / or the coding sequence of the target molecule.

13. A method for performing ribosome display in vitro, characterized in that Includes steps: (1) constructing a screening DNA library: synthesizing the nucleic acid construct according to any one of claims 1 to 7, then constructing a plasmid containing the nucleic acid construct using PCR technology, and amplifying the plasmid containing the nucleic acid construct by PCR to obtain a DNA library to be screened; (2) In vitro transcription and translation: The DNA library to be screened obtained in the previous step is transcribed and translated in vitro; (3) In vitro screening: Enrichment screening of the reaction products obtained in (2); Furthermore, the method also includes (4) Reverse transcription to obtain cDNA: The product obtained by screening in (3) is used to obtain cDNA through RT-PCR.

14. The method according to claim 13, wherein the in vitro transcription and translation are carried out in an in vitro transcription-translation coupling system, and the reaction conditions are: at room temperature, the reaction time is 40-120 min, preferably at 25-30°C for 60 min; And / or, the in vitro screening is performed using adsorption magnetic beads, preferably His Beads, and is preferably incubated at 2-6°C for 0.5-2h, more preferably at 4°C for 1h; And / or, the molar ratio of the target molecule DNA in the DNA library to be screened is ≥ 1:10 6 , preferably ≥ 1:10 5 ; More preferably ≥1:10 3 .

Images