Hemicyanine photosensitizer as well as preparation method and application thereof

Abstract

The invention provides a hemicyanine photosensitizer as well as a preparation method and application thereof, and belongs to the field of biological medicines. A hemicyanine dye-based molecule with a D-pi-A structure is developed through donor substitution engineering, and the structure of the hemicyanine dye-based molecule is shown as a formula I in the specification. The hemicyanine dye-based molecule has excellent spectral performance. The PLH1100 nano assembly further constructed on the basis of the hemicyanine dye-based molecule has excellent brain targeting property, tumor enrichment property, light stability and biocompatibility as well as excellent photothermal conversion efficiency and NIR-II tumor imaging capability, and is suitable for photothermal immunotherapy of glioblastoma. In addition, the invention also finds that the PLH1100 can significantly enhance the curative effect of a bispecific T cell adapter (Fn14 * CD3BiTE) aiming at an Fn14 target spot, the combination of the PLH1100 and the Fn14 * CD3BiTE adapter plays a synergistic role in photothermal immunotherapy, a new way is opened up for clinical treatment of glioblastoma, and the PLH1100 and the Fn14 * CD3BiTE have significant clinical application potential. # imgabs0 #

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a semi-cyanine photosensitizer and a preparation method and application thereof. Background Art

[0002] Glioblastoma (GBM) is a highly malignant intracranial tumor. Despite certain advances in surgery, radiotherapy, and chemotherapy, there are limited effective treatment options available. In recent years, bispecific T cell engagers (BiTEs) have been explored for the treatment of GBM, and related clinical trials are underway. However, insufficient T cell activation due to the acidic and immunosuppressive microenvironment (TME) severely limits the success of BiTEs. Photothermal immunotherapy (PTI) can not only dissolve tumors through photothermal effects, but also activate innate and adaptive immune responses, making it an ideal partner for BiTEs strategies. Hemicyanine dyes (Hcy) are organic dyes with a donor-π-acceptor (D-π-A) structure, including a nitrogen heterocyclic electron acceptor, a conjugated chain, and an aromatic donor with various functional ends. By adjusting the molecular structure, the charge transfer between the donor and the acceptor can be finely tuned to induce the Stokes shift of the spectrum of Hcy-based photosensitizers to meet the requirements of long-wavelength absorption performance.

[0003] However, the application of PTI to treat GBM still faces many challenges: on the one hand, GBM is usually located deep in the brain tissue, requiring the use of a light source with a longer wavelength and greater penetration for PTI, but photosensitizers with good biocompatibility and degradability are limited; on the other hand, the acidic and immunosuppressive microenvironment within GBM significantly hinders the ability of PTI to induce immunogenic cell death (ICD).

[0004] The document (DOI: 10.1002 / smll.202204851) discloses a heavy atom-free NIR hemicyanidin photosensitizer (BHcy), and discloses that BHcy can be used for 808nm light-mediated synergistic photodynamic therapy / photothermal therapy (PDT / PTT) for anti-cancer treatment through a receptor engineering strategy, but BHcy exhibits NIR absorption / emission at 770 / 915nm and has NIR-II tail emission at 1200nm. BHcy is assembled with DSPE-PEG2000 to form nanoparticles (BHcy-NPs) with a photothermal conversion efficiency of 55.1%, and its photophysical properties need to be improved.

[0005] Therefore, it is of great significance to explore photosensitizers with better photophysical properties and develop new treatments to treat glioblastoma. Summary of the invention

[0006] In order to solve the defects of the prior art, the object of the present invention is to provide a semi-cyanine photosensitizer and a preparation method and application thereof.

[0007] The present invention provides a semi-cyanine dye-based molecule, the structure of which is shown in Formula I:

[0008]

[0009] Wherein R1 is selected from hydrogen, C 1-3 Alkyl, R2 is selected from hydrogen, C 1-3 alkyl.

[0010] Furthermore, its structure is as follows:

[0011]

[0012] The present invention also provides a nanoparticle, which is a product obtained by the reaction of the above-mentioned semi-cyanine dye-based molecule, liposome, ligand-modified liposome and biocatalyst.

[0013] Further, the biocatalyst is lactate oxidase;

[0014] The ligand is a ligand targeting low-density lipoprotein receptor-related protein-1;

[0015] Preferably, the amino acid sequence of the ligand is as shown in SEQ ID No. 1; the method for preparing the ligand-modified liposome comprises the following steps: reacting the thiolated ligand with the maleimide-containing liposome to obtain the ligand-modified liposome;

[0016] More preferably, the liposome is DSPE-PEG2000.

[0017] Furthermore, the mass ratio of the thiolated ligand to the maleimide-containing liposome is 2-4:1; the reaction is carried out in a nitrogen environment, the temperature is 30-45° C., and the time is 10-15 hours.

[0018] Furthermore, the mass ratio of the thiolated ligand to the maleimide-containing liposome is 3:1; the reaction is carried out in a nitrogen environment, at a temperature of 37° C., and for 12 hours.

[0019] The present invention also provides a method for preparing the above nanoparticles, which comprises the following steps: heating the semi-cyanine dye-based molecules, liposomes and ligand-modified liposomes to obtain a mixture, and reacting the mixture with a biocatalyst again to obtain the nanoparticles.

[0020] Furthermore, the mass ratio of the semi-cyanine dye-based molecules, liposomes, ligand-modified liposomes and biocatalysts is 1:1-3:0.5-2:1-3; the solvent for the heating reaction is an inorganic solvent; the temperature of the heating reaction is 60-80°C, and the time is 20-40 minutes; the temperature of the secondary reaction is 10-40°C, and the time is 1-3 hours.

[0021] Furthermore, the mass ratio of the semi-cyanine dye-based molecules, liposomes, ligand-modified liposomes and biocatalysts is 1:2:1:2; the solvent for the heating reaction is chloroform; the reaction temperature is 70°C and the time is 30 minutes; the secondary reaction temperature is 20-30°C and the time is 2 hours.

[0022] Furthermore, after the reaction is completed, the following purification step is further included: the reaction solution is ultrafiltered through a membrane with a molecular weight cutoff of 100,000 Da at 3,700 rpm for 20 minutes to obtain.

[0023] The present invention also provides the use of the semi-cyanine dye-based molecules or nanoparticles in preparing photosensitizers.

[0024] Furthermore, the photosensitizer is a drug for preventing and / or treating glioblastoma.

[0025] The present invention also provides a combined drug, which contains the above-mentioned nanoparticles and bispecific T cell engagers in the same or different specifications of unit preparations for simultaneous or separate administration, and a pharmaceutically acceptable carrier;

[0026] Preferably, the bispecific T cell engager is a bispecific T cell engager targeting Fn14;

[0027] The mass ratio of the nanoparticles to the bispecific T cell engager is 4-6:0.05-0.15, preferably 5:0.1.

[0028] The present invention also provides the use of the above-mentioned combined drug and light-emitting device in the preparation of a device for treating glioblastoma; preferably, the wavelength of the light source in the light-emitting device is 950-1000nm, and the irradiance is 0.3-0.7W / cm 2 , the irradiation time is 5-15 minutes; more preferably, the wavelength of the light source in the light emitting device is 980nm, and the irradiance is 0.5W / cm 2 , the irradiation time is 10 minutes.

[0029] Compared with the BHcy photosensitizer and BHcy-NPs nanoparticles in the literature (DOI: 10.1002 / smll.202204851), the present invention achieves the following beneficial effects:

[0030] (1) The NIR-II Hcy1100 of the present invention has more excellent photophysical properties, showing a maximum absorption wavelength of more than 1000 nm and a strongest emission wavelength of 1100 nm, but BHcy only shows NIR absorption / emission at 770 / 915 nm and only weak NIR-II emission at 1100 nm;

[0031] (2) The components including NIR-II Hcy1100 and DSPE-PEG2000 of the present invention are assembled to form nanoparticles (PLH1100), and the photothermal conversion efficiency is higher (58.7%), while BHcy is assembled with DSPE-PEG2000 to form nanoparticles (BHcy-NPs), and the photothermal conversion efficiency is 55.1%.

[0032] In addition, the PLH1100 nanoassembly prepared based on NIR-II Hcy1100 has excellent brain targeting, tumor enrichment, photostability and biocompatibility, as well as outstanding photothermal conversion efficiency and NIR-II tumor imaging capability, and is suitable for photothermal immunotherapy of glioblastoma.

[0033] The present invention also found that PLH1100 can significantly enhance the efficacy of the bispecific T cell engager targeting the Fn14 target. The combination of PLH1100 and the bispecific T cell engager played a synergistic role in photothermal immunotherapy, opening up a new path for the clinical treatment of glioblastoma and having significant clinical application potential.

[0034] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0035] The above contents of the present invention are further described in detail below through specific implementation methods in the form of examples. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1Schematic diagram of optimized geometry, DFT calculation, MEP diagram and fluorescence spectrum. (A) Molecular view of NIR Hcy800, NIRHcy970 and NIR-II Hcy1100; (B) HOMO–LUMO distribution, energy level and energy gap data of NIR Hcy800, NIR Hcy970 and NIR-II Hcy1100 calculated by B3LYP / 6-311G(d,p); (C) MEP diagram of NIR Hcy800, NIR Hcy970 and NIR-II Hcy1100 under calculated structure; (D) Absorption and normalized fluorescence spectra of NIRHcy800, NIR Hcy970 and NIR-II Hcy1100 in PBS (5μg / mL, pH=7.4).

[0037] Figure 2 In vitro characterization of PLH1100. (A) Normalized absorption spectra of NIR-II Hcy1100 and PLH1100 in PBS buffer; (B) Transmission electron microscopy (TEM) image of PLH1100. Scale bar: 200 nm; (C) Dynamic light scattering (DLS) data of PLH1100; (D) ζ potential of PH1100, PLH1100 and LOX; (E) Infrared thermal images of PBS and PLH1100 (15 μg / mL) under irradiation with 980 nm light (0.5 w / cm2); (F) Photothermal heating curves of PLH1100 at different concentrations; (G) Heating-cooling curves of PLH1100 (15 μg / mL, 0.5 w / cm2); (H) Linear fitting of cooling time and -ln(θ); (I) Photothermal stability of PLH1100 under 980 nm laser irradiation (0.5 W / cm2) for four heating-cooling cycles.

[0038] Figure 3 (A) Fluorescence emission spectrum of PLH1100 in PBS (5 μg / mL); (B) Standard curve of NIR-II Hcy1100 in methanol; (C) Standard curve of BCA protein detection kit; (D) Stability of PLH1100 (red line indicates hydrodynamic size, blue line indicates PDI value); (E) Photograph of PLH1100 for 7 days; (F) Photothermal conversion of PLH1100 (10 μg / mL) under 980 nm laser irradiation at different exposure intensities (0.1, 0.3, 0.5, 0.7 W / cm2).

[0039] Figure 4Evaluation of the enzymatic ability and cytotoxicity of PLH1100. (A) In vitro consumption of lactate by PLH1100; (B) Generation of hydrogen peroxide and consumption of oxygen in lactate solution; (C) PLH1100 was dispersed in 5 mM lactate solution and HPLC analysis was performed every 20, 40, 60, 80 and 100 min at 37°C; (D) Quantitative ratio results of HPLC integrated area; (E) Flow cytometric analysis of necrosis of GL261 cells under different treatment conditions and (F) the percentage of late apoptotic or necrotic GL261 cells (PI+, Annexin V+); (G) Addition of lactate to explore the killing effect of endogenous H2O2 on GL261 cells; (H) Cytotoxicity of lactate on GL261 and U87 cells; (I) Detection of H2O2 generation induced by LOX in GL261 cells. Scale bar: 20 μm; (J) Flow cytometric analysis of necrosis of U87 cells after different treatments (left). The right side shows the percentage of cells with late apoptosis or necrosis (PI + , Annexin V + ); (K) Cytotoxicity of PLH1100 to U87 cells with or without lactate under light (980 nm, 0.5 W / cm2, 10 min) or dark conditions; (L) Determination of H2O2 levels in U87 cells induced by LOX. Scale bar: 20 μm.

[0040] Figure 5In vitro study of the detection of DAMPs and the synergistic effect of PLH1100 combined with mBiTE. (A, B) Confocal laser scanning microscopy (CLSM) images of HMGB1 exposure in GL261 and U87 cells under different treatments; Scale bar: 20 μm; (C) Analysis of HMGB1 signal intensity in GL261 and U87 cells after treatment; (D) Flow cytometric analysis of CRT expression on the surface of GL261 and U87 cells under different treatments; (E, F) ATP secretion levels of GL261 and U87 cells were detected by chemiluminescence; (G, H) Schematic diagram and SDS-PAGE analysis of Fn14×CD3 mBiTE; (I) Representative images of each treatment group: PLH1100+light, PLH1100+light+mBiTE, PLH1100+light+mT cells, mBiTE+mT cells, PLH1100+light+mBiTE+mT cells. Blue arrows indicate ruptured GL261-hFn14 / luc cells, yellow arrows show mT cells aggregated around tumor cells, and dashed circles highlight mT cells lysing GL261-hFn14 / luc cells; effector cell to target cell ratio (E:T): 8:1; incubation time: 4 h; mBiTE concentration: 0.1 μg / mL; scale bar: 50 μm; (J) Percentage of tumor lysis at 4, 8, and 12 h after treatment; E:T ratio: 8:1; hBiTE concentration: 0.1 μg / mL; (K) CytoTell TM Flow cytometric analysis of mT cells labeled with Red, with decreased signals indicating increased levels of cell proliferation; (L) MTT cytotoxicity assay showing specific lysis of GL261-hFn14 / luc cells by mouse T cells and mBiTE. E:T ratio 8:1; incubation time 4h; mBiTE, 0.1μg / mL; (M) Specific lysis of GL261-hFn14 / luc cells varies with mBiTE concentration. E:T ratio 8:1; incubation time 4h; (N) Representative images of different treatment groups: PLH1100+light, PLH1100+light+hBiTE, PLH1100-light+hT cells, hBiTE+hT cells, and PLH1100+5light+hBiTE+hT cells. Blue arrows indicate wrinkled lytic U87 cells, yellow arrows indicate hT cells aggregated around U87 cells, and dashed circles highlight hT cells lysing U87 cells; E:T ratio 8:1; incubation time 4h; BiTE, 0.1μg / mL; (O) U87 cell lysis percentage 4, 8 and 12h after treatment; E:T ratio 8:1; hBiTE, 0.1μg / mL; (P) hT cell proliferation was assessed by detecting CytoTellTM Red signal intensity. Scale bar: 50μm.

[0041] Figure 6 The in vivo imaging and photothermal antitumor effects of BALB / c-nu mice are shown. (A) Schematic diagram of the coronal and axial views of GBM in the mouse brain and the actual MRI images (indicated by the red dotted circle); (B) In vitro fluorescence imaging of brain tumors and major organs at 0, 3, 6, 9, 12, and 24 hours after injection of Cy5.5 and Ang-2 modified PLH1100; (C) In vivo NIR-II fluorescence imaging of mice at 0, 3, 6, 9, 12, and 24 hours after intravenous injection of Ang-2 modified PLH1100; (D, E) In vivo photothermal imaging and temperature changes (980nm, 0.5W / cm2) at predetermined time points after treatment with PBS and PLH1100. 2 ); (F) Relative content analysis of intratumor lactate levels; (G) Schematic diagram of the in vivo experimental timeline of BALB / c-nu mice; (H) Tumor volume changes over time in the four treatment groups; (I) Representative MRI images of mouse brain GBM in the four treatment groups on day 28; (J) Overall survival rate of mice with tumor burden; (K, L) Immunofluorescence and positive rate analysis of Ki67 and Tunel in tumor tissues after treatment; Scale bar: 50μm; (M) Confocal images of in vitro BBB penetration of Ang-2 and Cy5.5-modified PLH1100 by U87 and GL261-hFn14 / luc cells through the Transwell model. Scale bar: 20μm; (N) H&E staining of major organs after 14 days of different treatments. Scale bar: 200μm; (O) H&E staining of tumor tissues after different treatments; Immunofluorescence of HMGB1 and CRT in tumors after different treatments. Scale bar: 50μm.

[0042] Figure 7 Evaluation of the synergistic therapeutic effect of PLH1100 combined with mBiTE in C57BL / 6 mice. (A) Schematic diagram of the in vivo experimental timeline showing the experimental timeline of C57BL / 6 mice; (B) Representative images of allogeneic bioluminescence at different times in different treatment groups (n=4); (C) Total tumor flux (p / s) calculated using Living Image software; (D) Overall survival of mice with tumor burden; (EG) Evaluation of Fn14 expression in tumor tissues of different treatment groups; Scale bar: 50μm; (H) Changes in mouse body weight over time; (I) Flow cytometry gating strategy used to identify immune cells in the tumor microenvironment.

[0043] Figure 8Evaluation of PLH1100's improvement on immunosuppressive TME. (AC) Flow cytometric analysis of mature DCs (CD86+, CD80+, gated by CD45+CD11c+), M1 TAMs (CD86+, gated by CD45+, F4 / 80+, CD11b+), and CD8+ / CD4+ T cells (gated by CD45+, CD3+) in tumors after different treatments; (DG) Statistical analysis of DCs, M1 TAMs, CD8+ T cells, and CD4+ T cells in different treatment groups; (H, I) Detection of IFN-γ and TNF-α in different treatment groups.

[0044] Fig. 9 Flow cytometric analysis of (A) Treg cells (CD3+CD4+Foxp3+ cells gated on CD45+) and (B) MDSCs (CD11b+Gr-1+ cells gated on CD4+) in tumors; (C, D) histograms of tumor Treg cells and MDSCs. DETAILED DESCRIPTION

[0045] The raw materials and equipment used in the present invention are all known products, which are obtained by purchasing commercially available products. The thiol-coupled polypeptide (Ang-2-SH) was specifically synthesized by Xi'an Ruixi Biological Company (20 mg, purity 95%); distearoylphosphatidylethanolamine-polyethylene glycol-maleimide (DSPE-PEG2000-Maleimide, abbreviated as DSPE-PEG2000-Mal) was purchased from Xi'an Ruixi Biological (No.: R-0039-2k; PEG molecular weight is 2000Da; specification 100 mg); lactate oxidase (LOX) was purchased from Yuanye Biological (CAS No.: 9028-72-2) Item No.: S25769-100u; specification: ≥80 units / mg solid.

[0046] The "room temperature" referred to in the present invention is 25±5°C, and the time of "overnight" is 12±2 hours.

[0047] Example 1. Preparation of Hemicyanine Dye-Based Molecule NIR-II Hcy1100

[0048] According to the following synthetic route, NIR-ⅡHcy1100 was prepared:

[0049]

[0050] (1) Synthesis steps of compound 1

[0051] 0.25 g (1.48 mmol) of benz[cd]indole-2(1H)-one and 4.44 mmol of potassium carbonate (K2CO3) were dissolved in 8 ml of dimethylformamide (DMF) and stirred at room temperature for 30 minutes. Then, 0.46 g (2.96 mmol) of iodoethane was added to the solution, and the solution was heated to 90°C and reacted for 8 hours. After cooling to room temperature, the solution was filtered and the filtrate was collected. The product was purified by silica gel column chromatography (ethyl acetate / hexane=1:10) to obtain a yellow solid, compound 1 (0.27 g, 93% yield). 1 H NMR(400MHz,Chloroform-d)δ8.06(dd,J=7.0,0.6Hz,1H),8.01(dd,J=8.1,0.7Hz,1H),7.71(dd,J=8.2,7.0Hz,1H),7.54(d d, J=8.5, 0.6Hz, 1H), 7.47 (dd, J=8.5, 6.9Hz, 1H), 6.93 (dd, J=6.9, 0.6Hz, 1H), 3.99 (q, J=7.2Hz, 2H), 1.38 (t, J=7.2Hz, 3H).

[0052] (2) Synthesis steps of compound 2

[0053] 0.25 g (1.27 mmol) of compound 1 was dissolved in 10 ml of anhydrous tetrahydrofuran (THF) and cooled to 0 ° C under continuous stirring. Then, 0.64 ml of 3 mol / L methylmagnesium chloride (MeMgCl) tetrahydrofuran solution was slowly added. After the addition was completed, the reaction mixture was stirred at 60 ° C for 2 hours. Subsequently, 20 ml of 2 mol / L hydrochloric acid was added, and tetrahydrofuran was evaporated. The residue was mixed with 10 ml of saturated potassium iodide (KI) solution and left to stand for 30 minutes. After the product was precipitated, it was collected by filtration and dried under vacuum without further purification to obtain a red solid, compound 2 (yield was 76%). 1 H NMR (400MHz, DMSO-d6) δ8.99(d,J=7.2Hz,1H),8.81(d,J=8.0Hz,1H),8.56(d,J=7.4Hz,1H),8.46(d,J=8.2Hz ,1H),8.18(t,J=7.6Hz,1H),8.02(t,J=7.9Hz,1H),4.73(q,J=7.3Hz,2H),3.25(s,3H),1.56(t,J=7.3Hz,3H).

[0054] (3) Synthesis steps of compound 3

[0055] The method of compound S-5 in reference (DOI: 10.1002 / anie.201303016) was used to synthesize a colorless liquid, compound 3 (yield: 63%). 1 H NMR (400MHz, Chloroform-d) δ9.91 (s, 1H), 2.91 (ddt, J = 8.0, 7.1, 2.3Hz, 2H), 2.54 (tt, J = 7.9, 2.3Hz, 2H), 2.02 (tt, J = 8.4, 6.9Hz, 2H).

[0056] (4) Synthesis steps of compound 6

[0057] 0.57 g (4.13 mmol) of 4-methoxybenzene-1,2-diamine and 0.42 g (3.72 mmol) of cyclohexane-1,2-dione were dissolved in 10 ml of acetonitrile (CH3CN). The mixture was heated at 90°C overnight. After cooling to room temperature, the mixture was purified by silica gel column chromatography (ethyl acetate / hexane=1:10) to obtain the target product as a yellow solid, compound 6 (0.68 g, yield 85%). 1 H NMR (400MHz, Chloroform-d) δ7.83 (d, J = 9.2 Hz, 1H), 7.30 (dd, J = 9.1, 2.8 Hz, 1H), 7.25 (s, 1H), 3.93 (s, 3H), 3.18–3.07 (m, 4H), 2.02 (h, J = 3.3Hz, 4H).

[0058] (5) Synthesis steps of compound 7

[0059] 0.72 g (3.36 mmol) of compound 6 was dissolved in 10 ml of toluene and cooled to 0°C. Then, 5 times the molar amount of sodium borohydride (NaBH4) was slowly added. After the addition was completed, 15 ml of glacial acetic acid was slowly added to the reaction mixture within 1 hour, and stirred at 0°C for another hour. Subsequently, the mixture was heated to 120°C for 8 hours. After cooling, the reaction was terminated by adding 1 mol / L hydrochloric acid, and the mixture was extracted with ethyl acetate. The organic layer was collected and dried over anhydrous sodium sulfate (Na2SO4). The obtained solid was filtered and washed with ethyl acetate. The filtrate was collected and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 1:20) to obtain the yellow solid target product, compound 7 (0.42 g, yield 45.6%). 1H NMR(400MHz,Chloroform-d)δ6.49(d,J=8.5Hz,1H),6.21(d,J=2.7Hz,1H),6.17(d,J=8.4Hz,1H),3.74(s,3H),3.47–3.26(m,3H),3.15 (ddd,J=29.1,14.7,7.1Hz,3H),1.85(q,J=8.8Hz,2H),1.60(s,2H),1.55–1.44(m,2H),1.41–1.30(m,2H),1.14(dt,J=12.3,7.1Hz,6H).

[0060] (6) Synthesis steps of compound 8

[0061] The method of compound 2 in reference (10.1002 / anie.202211409) was used to synthesize a yellow solid, compound 8 (yield 52%). 1 H NMR(400MHz,Chloroform-d)δ11.52(s,1H),9.45(s,1H),6.49(s,1H),6.02(s,1H),3.52–3.13(m,6H),1 .98(q,J=5.6Hz,1H),1.87–1.61(m,3H),1.55–1.31(m,4H),1.20(t,J=7.2Hz,3H),1.11(t,J=7.0Hz,3H).

[0062] (7) Synthesis steps of compound 9

[0063] Referring to the synthesis steps of compound 4, a yellow solid, compound 9 (yield 48%) was obtained. 1 H NMR(400MHz,Chloroform-d)δ9.93(s,1H),6.60(d,J=2.1Hz,1H),6.40(s,1H),6.27(s,1H),3.54–3.35(m,3H),3.31–3.12(m,3H),2.72 (t,J=2.1Hz,4H),1.96–1.78(m,2H),1.54(td,J=9.7,9.2,2.8Hz,2H),1.46–1.33(m,2H),1.21(t,J=7.1Hz,3H),1.14(t,J=7.0Hz,3H).

[0064] (8) Synthesis steps of NIR Hcy1100

[0065] Referring to the synthesis steps of NIR Hcy800, a green solid, NIR Hcy1100 (yield 56%) was synthesized.1 HNMR (400MHz, DMSO-d6) δ8.34(d,J=7.4Hz,1H),8.11(d,J=13.3Hz,1H),7.98(t,J=4.1Hz,2H),7.82(t,J=7. 7Hz,1H),7.54–7.42(m,2H),7.16(s,1H),7.11(d,J=7.0Hz,1H),6.91(s,1H),6.24(d,J=13.3Hz,1H),4.16(q ,J=7.0Hz,2H),3.84(dq,J=14.0,7.0Hz,1H),3.78–3.47(m,4H),3.36(d,J=7.4Hz,1H),3.04(s,4H),2.02(s ,1H),1.82(s,1H),1.73–1.55(m,3H),1.50–1.39(m,3H),1.30(td,J=7.1,5.0Hz,6H),1.13(t,J=6.9Hz,3H). 13 CNMR(101MHz,CDCl3)δ164.58,152.81,148.00,144.33,141.43,136.03,134.66,13 2.70,130.72,130.31,130.17,129.30,128.75,127.63,125.98,125.93,119.08,118 .66,105.08,103.89,96.90,57.77,53.56,52.33,44.84,40.61,38.30,29.76,27.7 3,27.52,25.49,25.38,23.25,21.19,13.42,12.40,10.19,0.07.MS(ESI)calcd.For C 37 H 40 N3O + [M + ],542.3166; found 542.3166.

[0066] Example 2: Preparation of semicyanine photosensitizer PLH1100 nanoparticles

[0067] Angiopep-2 (Ang-2) is a 19-amino acid ligand (TFFYGGSRGKRNNFKTEEY, SEQ ID No. 1) that binds to low-density lipoprotein receptor-related protein-1 (LRP1) and is widely used to target LRP1 at the BBB (blood-brain barrier) for brain delivery.

[0068] First, 3 mg of Ang-2-SH, 1 mg of DSPE-PEG2000-Mal and 4 ml of PBS were treated overnight at 37°C under nitrogen, and the resulting solution was then dialyzed and freeze-dried to obtain DSPE-PEG2000-Ang-2. Next, 1.0 mg of NIR-II Hcy1100 prepared in Example 1, 2.0 mg of DSPE-PEG2000 and 1.0 mg of DSPE-PEG2000-Ang-2 were completely dissolved in 0.5 ml of chloroform and immediately dried under vacuum to obtain a mixture. The mixture was mixed with 2 ml of deionized water, stirred and sonicated for 2 minutes. The mixture was heated in a water bath at 70°C for 30 minutes to promote self-assembly. After cooling to room temperature, 2 mg of lactate oxidase (LOX) was added and stirred for 2 hours to load LOX through electrostatic interactions to form a suspension containing PLH1100 nanoparticles.

[0069] The resulting suspension was ultrafiltered at 3700 rpm for 20 minutes through a membrane with a molecular weight cutoff of 100,000 Da. Finally, the solution was filtered using a 0.22 micron Millex-GP filter for subsequent use.

[0070] The following comparative samples are prepared by comparative examples.

[0071] Comparative Example 1: Preparation of Hemicyanine Dye-Based Molecule NIR HCy800

[0072] NIR HCy800 was prepared according to the following synthetic route:

[0073]

[0074] (1) Synthesis steps of compound 4

[0075] 1.1 g (7.23 mmol) of 2-hydroxy-4-methoxybenzaldehyde, 2.51 g (14.46 mmol) of compound 3 obtained in Example 1 and 7.07 g (21.69 mmol) of cesium carbonate (Cs2CO3) were dissolved in dimethylformamide (DMF). The reaction mixture was stirred at room temperature for 48 hours. The precipitated solid was filtered and washed with ethyl acetate. The product was then purified by silica gel column chromatography (ethyl acetate / hexane=1:10) to obtain a yellow solid, compound 4 (1.53 g, yield 65.6%) 1 HNMR(400MHz,Chloroform-d)δ9.96(s,1H),7.11(d,J=8.4Hz,1H),6.76(d,J=2.5 Hz,1H),6.72(dd,J=8.4,2.4Hz,1H),6.69(s,1H),3.85(s,3H),2.81–2.72(m,4H).

[0076] (2) Synthesis steps of NIR HCy800

[0077] 0.50 g (2.20 mmol) of compound 4 was dissolved in 0.025-0.05 M anhydrous acetic anhydride (Ac2O), and 1.2 times the molar amount of compound 2 obtained in Example 1 and 3.5 times the molar amount of sodium acetate (AcONa) were added. The mixture was stirred at 100 ° C for 2 hours. The reaction mixture was concentrated under reduced pressure to obtain a crude product, which was then further purified by silica gel column chromatography (dichloromethane / methanol=20:1) to obtain NIR Hcy800 (0.56 g, 47.4% yield). 1 H NMR (400MHz, DMSO-d6) δ8.80(d,J=7.4Hz,1H),8.62(d,J=14.3Hz,1H),8.39(d,J=8.1Hz, 1H),8.05(t,J=7.7Hz,1H),7.94(d,J=8.2Hz,1H),7.81(d,J=7.3Hz,1H),7.73(dd,J=8.2, 7.4Hz,1H),7.63–7.56(m,2H),7.38(d,J=2.5Hz,1H),7.05(dd,J=8.6,2.5Hz,1H),6.68( d,J=14.3Hz,1H),4.51(q,J=7.1Hz,2H),3.95(s,3H),3.00(s,4H),1.42(t,J=7.1Hz,3H). 13 CNMR(101MHz,DMSO-d6)δ165.23,165.01,162.98,158.75,157.73,156.73,154.46,152.77,140.19,138.13,133.57,131.79,130.98 ,130.21,129.76,129.67,125.69,124.46,117.18,114.86,113.41,109.81,102.12,56.79,55.39,24.80,14.66.MS(ESI)calcd.For C 28 H 24 NO2 + [M + ],406.1802;found 406.2.

[0078] Comparative Example 2: Preparation of Hemicyanine Dye-Based Molecule NIR HCy970

[0079] NIR HCy970 was prepared according to the following synthetic route:

[0080]

[0081] (1) Synthesis steps of compound 5

[0082] Referring to the synthesis steps of compound 4, a red solid, compound 5 (1.35 g, yield 56.3%) was obtained. 1 HNMR(400MHz,Chloroform-d)δ9.99(s,1H),7.00–6.95(m,1H),6.57(d,J=2.3Hz,1H ), 6.43 (s, 2H), 3.38 (q, J = 7.1Hz, 4H), 2.71 (d, J = 1.7Hz, 4H), 1.20 (t, J = 7.1Hz, 6H).

[0083] (2) Synthesis steps of NIR HCy970

[0084] Referring to the synthesis steps of NIR Hcy800 in Comparative Example 1, a red solid, NIR Hcy970 (0.25 g, yield 34.9%) was obtained. 1 H NMR (400MHz, DMSO-d6) δ8.54(d,J=7.4Hz,1H),8.34(d,J=13.5Hz,1H),8.13(d,J=8.0Hz, 1H),7.91(t,J=7.7Hz,1H),7.86(s,1H),7.63(d,J=8.2Hz,1H),7.56(dt,J=8.3,3.6Hz,2 H),7.37(d,J=7.1Hz,1H),7.03(d,J=13.6Hz,2H),6.33(d,J=13.6Hz,1H),3.58(q,J=7.1 Hz, 4H), 3.44 (q, J = 7.0Hz, 2H), 2.97 (s, 4H), 1.34 (t, J = 7.1Hz, 3H), 1.22 (t, J = 7.0Hz, 6H). 13 C NMR (101MHz, DMSO) δ168.21,156.77,152.82,151.52,141.12,137.19,134.39,133.48,130.84,130.66,130.43,130.16,129.97,126.7 6,121.94,115.30,114.07,108.67,105.55,97.36,56.49,45.12,38.60,25.53,25.01,21.54,19.04,13.98,13.08.MS(ESI)calcd.For C 31 H 31 N2O + [M+ ],447.2431;found 447.2.

[0085] Comparative Example 3: Preparation of PH1100 Nanoparticles

[0086] The preparation of PLH1100 nanoparticles in Reference Example 2 was different only in that lactate oxidase (LOX) was not added, and the nanoparticles without adsorbing LOX after micelle encapsulation were prepared, which were recorded as PH1100.

[0087] The beneficial effects of the present invention are demonstrated by experimental examples below.

[0088] Experimental Example 1: Determination of the photothermal properties of hemicyanine dye-based molecules

[0089] The invention prepares semi-cyanine dye-based molecules NIR Hcy800, NIR Hcy970 and NIR Hcy1100, and density functional theory (DFT) calculation and electrostatic potential analysis are carried out to test the electronic excitation and photophysical property changes of the three semi-cyanine dye-based molecules.

[0090] The optimized geometry, HOMO, LUMO and molecular electrostatic potential (MEP) are shown in the figure. Figure 1 AC. According to the DFT calculation results, NIR Hcy1100 shows a smaller HOMO-LUMO band gap of 1.80 eV, while NIR Hcy800 and NIR Hcy970 show HOMO-LUMO band gaps of 2.05 eV and 1.95 eV, respectively. In addition, the three different electron donors also change the intrinsic electrostatic potential. Among them, NIR Hcy1100 has the lowest extreme value of 74.08 kcal / mol, while NIR Hcy800 and NIR Hcy970 are 80.09 kcal / mol and 77.02 kcal / mol, respectively. In summary, the introduction of the electron-rich end group 1,4-diethyl-decahydroquinoline not only gives Hcy a coplanar and larger π-conjugated DA structure, but also promotes intramolecular charge transfer and reduces the HOMO-LUMO band gap.

[0091] In addition, the photophysical properties of the three compounds were examined ( Figure 1D). In this study, it was observed that the 1,4-diethyl-decahydroquinoline group promoted a red shift in the absorption and emission spectra, which exhibited a maximum absorption wavelength of over 1000 nm and a strongest emission wavelength of 1100 nm (NIR-II Hcy1100). In contrast, the methoxy- and N,N-diethyl-substituted molecules showed optimal emission wavelengths of 800 nm (NIR Hcy800) and 970 nm (NIR Hcy970), respectively. However, both molecules exhibited narrow absorption spectra with negligible fluorescence absorption at 900 nm. In summary, Hcy substituted with 1,4-diethyl-decahydroquinoline (NIR-II Hcy1100) exhibited excellent photophysical properties compared with methoxy- (NIR Hcy800) and N,N-diethyl-substituted (NIR Hcy970), making it an ideal organic photosensitizer for GBM PTI.

[0092] From the above experimental results, it can be seen that compared with NIR Hcy800 and NIR Hcy970, NIR-II Hcy1100 has the smallest HOMO-LUMO band gap and a larger π-conjugated DA structure, showing excellent photophysical properties, with a maximum absorption wavelength of more than 1000nm and a strongest emission wavelength of 1100nm. Therefore, the present invention selects NIR-II Hcy1100 as a small molecule for constructing a semi-cyanine photosensitizer.

[0093] Experimental Example 2: Structural characterization, performance determination and therapeutic effect of semicyanine photosensitizers on GBM model mice

[0094] 1. Experimental methods

[0095] (1) Cell culture and animals

[0096] HEK-293T cells and human and mouse glioblastoma (GBM) cell lines (U87 and GL261) were purchased from ATCC and cultured in DMEM medium containing 10% fetal bovine serum and 1.0 mmol / L penicillin-streptomycin combination, and 5% CO2, 37°C humidified incubator. GL261 cells expressing human Fn14 and luciferase (GL261-hFn14 / luc) were established according to the methods in the references (DOI: 10.1016 / j.canlet.2024.216760; 10.1080 / 2162402X.2022.2127508; 10.1038 / s41467-023-39683-z; 10.1007 / s00262-024-03757-8) for subsequent experiments.

[0097] In addition, female BALB / c-nu mice and C57BL / 6 mice aged 6-8 weeks were purchased from GemPharmatech and housed under pathogen-free conditions with a typical 12-hour light-12-hour dark cycle.

[0098] (2) In vitro photothermal efficacy detection and detection of intracellular ROS generation using BES-H2O2-Ac

[0099] PLH1100 was placed in a 1.5 ml test tube and illuminated with a 980 nm laser (0.5 W / cm 2 ) for 10 minutes to evaluate its photothermal performance. An infrared thermal imager was used to monitor and record temperature changes. To evaluate photothermal stability, four heating and cooling cycles were repeated and temperature data were collected in each cycle. PBS was used as a control under the same conditions to ensure accurate comparison.

[0100] To detect the generation of intracellular ROS, U87 and GL261 cells were first seeded in 24-well plates at a density of 5 × 10^4 cells per well and allowed to attach during a 24-hour incubation period. Then, the cells were treated with 5 μg / mL of PLH1100 and 10 μM of lactic acid for 2 hours. Subsequently, the cells were stained with BES-H2O2-Ac for 30 minutes and washed three times with PBS before being observed under a confocal microscope.

[0101] (3) MTT cytotoxicity assessment

[0102] First, cells were plated at 5 × 10 ^6 The cells were seeded at a density of 100 cells / mL in a 100 mm cell culture dish and incubated in complete medium in a cell culture incubator for 24 h. After incubation, the cells were harvested and divided into different groups into 1.5 mL test tubes. Subsequently, the medium was replaced with 1 mL of DMEM containing different concentrations of PLH1100 (0, 1, 2, 3, 4, 5, 6, 7, 8 μg / mL). Next, the cells were laser treated (980 nm, 0.5 W / cm 2 , 10 minutes). After 24 hours, 500 μl of MTT (1×) was added to each well and incubated for another 4 hours. Then, the culture medium was removed and 500 μl of DMSO was added to each test tube to dissolve the formed formazan crystals. The absorbance at 570 nm and 630 nm was measured using a microplate reader. The relative cell viability was calculated using the following formula:

[0103]

[0104] (4) Annexin V-FITC&PI evaluation of cytotoxicity

[0105] U87 and GL261 cells were plated at 3 × 10^5 Cells were seeded into 6-well plates at a density of 10 cells and incubated for 24 hours to allow them to attach. Subsequently, the cells were subjected to different treatment conditions: PBS group, PBS + light group, 5μg / mL PLH1100 + dark group, and 5μg / mL PLH1100 + light group. The light treatment group was exposed to 980nm light for 10 minutes, while the dark treatment group did not receive light under the same conditions. After treatment, the cells were washed 3 times with PBS and then stained using the Annexin V-FITC&PI Cell Apoptosis Detection Kit in 1× Binding Buffer. The stained cells were analyzed using flow cytometry to detect the level of cell apoptosis under different conditions.

[0106] (5) Photothermal conversion efficiency

[0107] The photothermal conversion efficiency (η) is measured as follows:

[0108]

[0109] Where h represents the heat transfer coefficient, s is the surface area of ​​the container, and the product of hs can be calculated by referring to the following formula (2). Qdis represents the heat dissipated by the solvent and the container. I is the incident power, and A980 is the absorbance at 980nm.

[0110]

[0111] Where m and c represent the mass and specific heat capacity of the solution, respectively. τs can be determined by formula (3):

[0112]

[0113] Where t is the real-time temperature during cooling, and θ is a dimensionless parameter whose value can be obtained by formula (4):

[0114]

[0115] (6) Establishment of tumor model

[0116] For the GBM mouse model, anesthetized BALB / c-nu and C57BL / 6 mice were stereotaxically injected with 1×10^5 U87 cells or GL261-hFn14 / luc cells into the right frontal lobe of the brain (2 mm from the sagittal suture, 1 mm from the bregma, and 3 mm in depth).

[0117] (7) Evaluation of blood-brain barrier permeability and lactate oxidation in vivo

[0118] First, this study evaluated the blood-brain barrier permeability in vitro using the Transwell model. For in vivo evaluation, BALB / c-nu mice bearing U87 tumors were injected with Cy5.5-labeled PLH1100 (10 mg / kg) via the tail vein 7 days after the tumor model was established. At 3, 6, 9, 12, and 24 hours after injection, the mice were killed, the brain and other major organs were removed, and the blood-brain barrier permeability and in vivo biodistribution were evaluated by detecting fluorescent signals. Subsequently, the tumors and normal brain tissues collected at different time points were homogenized with ice-cold PBS for 4 minutes, the homogenates were centrifuged at 15,000 rpm for 15 minutes, and the supernatants were transferred to 96-well plates to determine lactate levels. In addition, another group of mice was used to evaluate the blood-brain barrier permeability of PLH1100 by NIR-II imaging.

[0119] (8) In vivo photothermal therapy and photothermal imaging

[0120] U87 tumor-bearing BALB / c-nu mice were randomly divided into 4 groups (n=4 in each group) and received different treatments: control group, PBS+light, PLH1100+darkness, and PLH1100+light (PLH1100 dose was 10 mg / kg in the corresponding groups). 2 ) started 12 hours after administration and was performed 4 times for 5 minutes each time. Photothermal imaging was performed in the PBS+light and PLH1100+light treatment groups 12 hours after administration and recorded at 0, 3 and 6 minutes after irradiation. The growth of GBM was recorded by MRI imaging every 7 days, and the death of mice was used as the endpoint of the experiment. In the parallel group, mice were killed 3 days after the last irradiation, and tumors and major organs (heart, liver, spleen, lungs and kidneys) were removed for immunofluorescence and H&E staining.

[0121] (9) Statistical analysis

[0122] Images and fluorescence intensity were processed and analyzed using Image J software. Data were analyzed by GraphPad Prism version 9.0, and the results were expressed as mean ± standard deviation (SD), n ≥ 3. Statistical significance between two independent groups was determined by unpaired two-tailed Student's t test, and one-way ANOVA was used for comparison between multiple groups. Survival data were evaluated by the Kaplan-Meier method and compared using the log-rank test. *p<0.05, **p<0.01, ***p<0.001.

[0123] 2. Experimental results

[0124] (1) Structural characterization and photothermal properties of PLH1100 nanoparticles

[0125] result( Figure 2) showed that the self-assembly process of PLH1100 nanoparticles was red-shifted from the maximum absorption peak of 730nm to 800nm ​​( Figure 2 A), and a fluorescence emission peak at about 1150 nm ( Figure 3 A) was confirmed to be successfully synthesized. Transmission electron microscopy (TEM) and dynamic light scattering (DLS) measurements showed that the PLH1100 nanocomposite was a uniform spherical structure with an average diameter of 206 nm ( Figure 2 B, C). In addition, the presence (PLH1100) or absence (designated PH1100) of LOX affected the potential of the nanoparticles, with average potentials of -31.0 mV and -40.2 mV, respectively, while the potential of free LOX was approximately 12.0 mV, indicating the successful binding of LOX to the nanoparticles ( Figure 2 D). In this study, the concentrations of NIR-II Hcy1100 and LOX were determined by UV-visible spectrophotometry. The results showed that the concentration of NIR-II Hcy1100 in PLH1100 was 404.5 μg / mL, while the concentration of LOX was 375.8 μg / mL ( Figure 3 B, C). To evaluate the stability of PLH1100 in a physiological environment, its hydrodynamic size was characterized in PBS for 7 days. Figure 3 As shown in Figure , E, no significant size change was observed, indicating that the nanocomposite has good stability. At the same time, PLH1100 nanoparticles also showed significant absorption intensity under 980nm light, providing an ideal biological window for effective photothermal therapy of deep brain tumors.

[0126] In vitro, an infrared camera was used to record the photothermal effect of PLH1100 under 980nm laser irradiation. Figure 2 E, F, 0.5W / cm 2 980 nm laser irradiation for 10 min resulted in a rapid temperature rise of PLH1100 at different concentrations (0, 5, 10, 15, 30 μg / mL) in PBS solution. The temperature rise of PLH1100 at different laser exposure powers (0.1, 0.3, 0.5, 0.7 W / cm 2 ) under 10μg / mL PLH1100 in 10 minutes ( Figure 3 F). The results show that the photothermal capacity of PLH1100 is positively correlated with concentration, laser exposure power and time. In addition, Figure 2 G shows the 15 μg / mL PLH1100 aqueous solution under 980 nm laser (0.5 W / cm 2 ) under the photothermal heating and cooling curves. The linear fit of cooling time to ln(θ) is as follows: Figure 2 As shown in H, the photothermal conversion efficiency of PLH1100 is calculated to be 58.7%. Figure 2 The photothermal stability of 15 μg / mL PLH1100 was also examined in I. After 4 laser on / off cycles, the temperature did not decrease significantly and reached a consistent maximum temperature of approximately 66 °C, indicating its excellent photothermal stability.

[0127] (2) Catalytic activity and cytotoxicity of PLH1100 towards lactate

[0128] The accumulation of lactic acid in the tumor microenvironment has a negative impact on immunotherapy, while reducing the lactic acid produced by tumor cell metabolism helps eliminate tumors. To verify the catalytic ability and biological activity of PLH1100 on lactic acid, this study immersed the dialysis membrane containing PLH1100 in a lactic acid solution and incubated it in a shaker at 37°C. Samples were taken regularly to measure the residual lactic acid concentration in the dialysate. Figure 4 As shown in A, the lactate concentration in the dialysate gradually decreased, similar to the free LOX group, indicating that PLH1100 did not affect the catalytic activity of LOX. Next, the reaction product H2O2 was also studied to reconfirm the catalytic process of PLH1100. As the lactate concentration increased, the generated H2O2 showed a similar concentration-dependent pattern, and a decrease in dissolved oxygen was observed ( Figure 4 B), indicating that this degradation reaction requires oxygen. In addition, the release of NIR-II Hcy1100 was tested by high performance liquid chromatography (HPLC) ( Figure 4 C, D). PLH1100 was dispersed in 5 mM lactic acid solution and NIR-II Hcy1100 was separated and detected by ultrafiltration centrifugal column every 20 minutes at 37°C. From 20 to 100 minutes, the chromatographic peak at 800 nm was detected to increase gradually, maintaining the same retention time as NIR-II Hcy1100, indicating that the acidic conditions and catalytic process may have destroyed the structure of the nanodots and released NIR-II Hcy1100.

[0129] Cytotoxicity assays such as Figure 4 As shown in Figure E, when the concentration of PLH1100 was 5 μg / mL, under 980 nm laser irradiation (0.5 W / cm2, 10 min), the late necrosis rate of GL261 was close to 40% (PI+, Annexin V+), while in the dark, the cell necrosis rate was only 5% ( Figure 4 E, F). Similar results were confirmed in a human GBM cell line (U87) ( Figure 4J). This indicates that PLH1100 has a strong anti-tumor effect under light conditions. Then, cytotoxicity was also tested by adding lactic acid to explore the killing effect of endogenous H2O2 on cancer cells. In this study, as the concentration of PLH1100 increased, it showed strong cytotoxicity against GL261 cells in the presence of exogenous lactic acid (10mM), while tumor cells incubated with lactic acid alone did not show significant cell death ( Figure 4 G, H). Similar results were also observed in U87 cells ( Figure 4 K). In addition, this study used BES-H2O2-Ac (specific H2O2 probe) to detect the generation of H2O2. Figure 4 I and Figure 4 As shown in Figure 1, after adding free LOX or PLH1100, a strong fluorescence signal was observed in tumor cells incubated with lactate, while no fluorescence signal was detected in the PLH1100-treated group without lactate addition. This indicates that at the in vitro cellular level, PLH1100 can oxidize lactate similar to LOX and promote the production of intracellular H2O2, thereby enhancing its cytotoxicity.

[0130] (3) Examination of PLH1100-induced immunogenic cell death in vitro

[0131] Photothermal effect and H2O2 also help activate tumor immunogenicity and enhance immune response by promoting the release and expression of DAMPs (including HMGB1, ATP, and CRT) by dying cells, which are representative markers of ICD. Specifically, PLH1100-induced HMGB1 and ATP release, as well as CRT expression ability, were detected by immunofluorescence staining, flow cytometry, and chemiluminescence. Figure 5 As shown in AC, after 980 nm laser irradiation for 6 h, HMGB1 was significantly released in GL261 and U87 cells treated with PLH1100, and the extracellular fluorescence intensity in the light group was significantly higher than that in the control group and the dark group. Similarly, the expression of CRT and the release of ATP increased significantly after light treatment ( Figure 5 DF). These results further indicate that the photothermal effect of PLH1100, as well as the consumption of lactate, can not only effectively kill tumor cells but also significantly promote ICD.

[0132] (4) Therapeutic effect of semicyanine photosensitizers on GBM model mice

[0133] In this study, the ability of PLH1100 to cross the BBB was evaluated in vitro using a Transwell model. Figure 6As shown in Figure 2, the red fluorescence detected in U87 and GL261-hFn14 / luc cells in the lower cavity indicated that PLH1100 could effectively penetrate the BBB after modification with Ang-2. Subsequently, this study evaluated the dynamic distribution of PLH1100 in BALB / c-nu mice bearing orthotopic U87 tumors. The results showed that PLH1100 accumulated in intracranial tumors 3 hours after administration, reached peak fluorescence intensity at 12 hours, and then gradually decreased. During the monitoring period, the liver was the main organ for PLH1100 accumulation, with the highest fluorescence intensity after 9 hours, followed by the lungs and kidneys ( Figure 6 A, B). NIR-II fluorescence imaging has superior deep tissue penetration, low background noise, and high resolution. Since the emission spectrum of NIR-II Hcy1100 exceeds 1100nm, this study used NIR-II imaging to evaluate the dynamic distribution of PLH1100 in intracranial tumors. Figure 6 As shown in C, its imaging properties are consistent with those of Cy5.5-labeled nanoparticles. Tumor imaging can be observed 3 hours after administration, and the peak fluorescence intensity is reached at 12 hours. In addition, in vivo photothermal effect measurements showed that under 980nm laser irradiation (0.5W / cm 2 ), the intracranial temperature of the treatment group gradually increased over time and reached 55°C within 6 minutes, which met the requirements of mild photothermal therapy, while the temperature of the control group did not increase significantly ( Figure 6 D, E). In addition, this study also evaluated the safety and biocompatibility of PLH1100 after 14 days of administration by H&E staining of the main organ sections of mice. The results showed that no significant pathological structural damage was observed in the main organs of the treatment group compared with the control group ( Figure 6 N). In summary, it is shown that the PLH1100 constructed in this study can effectively reach the target tumor and exhibit excellent photothermal performance in vivo while having reliable safety.

[0134] In addition, this study evaluated the therapeutic effect of PLH1100 and its activation of ICD effect using BALB / c-nu mice bearing orthotopic U87 tumors. The detailed treatment regimen is shown in Figure 6 G. Seven days after the establishment of the orthotopic U87 model, each mouse received a single dose of PLH1100 (10 mg / kg) and was treated with 980 nm laser 12 hours later. Each laser irradiation lasted for 6 minutes and was repeated 4 times. MRI was used to monitor tumor growth. Figure 6 As shown in Figure H, over time, the tumor volume of the control group, PBS + light group, and PLH1100 + dark group increased more than that of the PLH1100 + light treatment group. On days 21 and 28, the average tumor volume of the PLH1100 + light group was significantly smaller than that of the other three groups (p < 0.01). Figure 6I shows representative MRI results on day 28. Accordingly, the survival time of mice in the PLH1100+light-treated group was longer than that in the other three groups ( Figure 6 J). Further histopathological analysis ( Figure 6 K, L; Figure 6 O) showed that the Ki67 positivity rate was lower, the Tunel positivity rate was higher, and tumor cells underwent significant apoptosis in the PLH1100+light treatment group, indicating that the photothermal effect slowed down tumor proliferation and induced tumor cell death to a certain extent. Importantly, this study also evaluated the induced DAMPs, such as HMGB1 and CRT. Figure 6 As shown in Figure 2, PLH1100+light therapy significantly promoted the release of nuclear HMGB1 and the expression of extracellular CRT, which helped activate antigen-presenting cells and enhance the body's tumor immune response. Finally, this study evaluated the relative lactate content in the tumor ( Figure 6 F). The relative lactate content in the tumors of the PLH1100-treated group was reduced compared with the control and light-treated groups. In addition, the lactate content in the PLH1100+light-treated group was lower than that in the PLH1100+dark group, indicating that the photothermal effect further promoted the release of LOX. These results indicate that PLH1100 in this study can not only inhibit tumor growth in vivo, but also effectively reduce lactate levels and improve the acidic environment in tumors.

[0135] From the above experimental results, it can be seen that the semi-cyanine photosensitizer PLH1100 has excellent brain targeting, tumor enrichment, photostability and biocompatibility, as well as outstanding photothermal conversion efficiency (58.7%) and NIR-II tumor imaging capabilities, and can effectively reduce lactic acid levels and improve the acidic environment within the tumor.

[0136] Experimental Example 3: Synergistic therapeutic effect of semicyanine photosensitizer combined with bispecific T cell engager

[0137] 1. Preparation and expression of bispecific T cell engagers

[0138] Studies have shown that Fn14 can be an ideal target for GBM immunotherapy. Previously, the literature (DOI: 10.1080 / 2162402x.2021.1983306) has reported a Fn14×hCD3 BiTE (referred to as hBiTE) that can mediate human T cell targeting of the U87 cell line. In order to further evaluate the synergistic anti-tumor efficacy of PTI and BiTE through activation of ICD, this study expressed a Fn14×CD3 mBiTE (referred to as mBiTE) that can mediate mouse T cell killing of GL261-hFn14 / luc (a mouse GBM cell line expressing human Fn14 protein and luciferase).

[0139] According to the literature (DOI: 10.1080 / 2162402x.2021.1983306), hBiTE was constructed and expressed, and the CD3 sequence targeting the human CD3 antigen in hBiTE (named hCD3) was replaced with the CD3 sequence targeting the mouse CD3 antigen (named mCD3), and mBiTE was constructed and expressed. The recombinant cDNA encoding mBiTE was subcloned into a eukaryotic expression vector with a C-terminal His tag for purification. HEK-293T cells were transfected with these vectors and cultured in FreeStyle serum-free medium (Thermo Fisher Scientific) at 37°C and 5% CO2. After 7 days, the supernatant was collected, and the recombinant mBiTE was purified using a Ni-NTA affinity column and further refined by a Superdex 200Increase 10 / 300GL column (GE). The purity and size of the purified mBiTE were confirmed by SDS-PAGE and Coomassie Brilliant Blue staining. Among them, the anti-Fn14 scFv sequence, including the VL and VH regions, comes from the monoclonal antibody P4A8 (patent EP2294089A2), which has been verified to effectively bind to Fn14 on glioma cells. The anti-CD3 scFv sequence in the mBiTE construction comes from mouse CD3ε (clone OKT3). The specific sequence is as follows:

[0140] Anti-mCD3 scFv sequence (SEQ ID No. 2):

[0141] GGAGGCGGTGGCAGCGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGAAAGTCCCTGAAACTCTCCTGTGAGGCCTCTGGATTCACCTTCAGCGGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGGAGGGGGCTGGAGTCGGTCGCATAC ATTACTAGTAGTAGTATTAATATCAAATATGCTGACGCTGTGAAAGGCCGGTTCACCGTCTCCAGAGACAATGCCAAGAACTTACTGTTTCTACAAATGAACATTCTCAAGTCTGAGGACACAGCCATGTACTACTGTGCAAGATTCGACTGGGACAAAAATTACTGGGGCCAAGGAACCATGGTCACCGTCTCCTCAGGTGGCGGAGGCAGCGGTGGCGGAGGCAGTGGAGGCGGTGGCAGCGACATCCAGATGACCCAGTCTCCATCATCACTGCCTGCCTCCCTGGGAGACAGAGTCACTATCAATTGTCAGGCCAGTCAGGACATTAGCAATTATTTAAACTGGTACCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATTATACAAATAAATTGGCAGATGGAGTCCCATCAAGGTTCAGTGGCAGTGGTTCTGGGAGAGATTCTTCTTTCACTATCAGCAGCCTGGAATCCGAAGATATTGGATCTTATTACTGTCAACAGTATTATAACTATCCGTGGACGTTCGGACCTGGCACCAAGCTGGAAATCAAACGG。

[0142] Anti-Fn14 scFv sequence (SEQ ID No.3):

[0143] CAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGGTTCCGGCTACACATTCACTGATTATGGCATGCACTGGGTGCGGCAGGCCCCTGGACAAGGGCTAGAGTGGATGGGAGTTATTAGTACTTACAATGGTTATACAAACTACAACCAGAAGTTTAAGGGCAGAGTCACAATGACTGTAGACAAATCCACGAGCACAGCCTATATGGAACTTCGGAGCTTGAGATCTGACGATACGGCCGTGTATTACTGTGCAAGAGCCTACTATGGCAACCTTTACTATGCTATGGACTACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCAGACATTGTGCTGACACAGTCTCCTGCTTCCCTGGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATGCAGGGCCAGCAAAAGTGTCAGTACATCTAGCTATAGTTATATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCAAATATGCATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCTCCCTCAACATCCATCCCATGGAGGAGGACGATACCGCAATGTATTTCTGTCAGCACAGTAGGGAGCTTCCATTCACGTTCGGCGGAGGGACAAAGTTGGAAATAAAA。

[0144] G4S linker sequence (SEQ ID No.4):

[0145] GGCGGAGGGGGTTCCGGTGGTGGCGGATCTGGAGGTGGCGGCAGC。

[0146] 2. Experimental methods

[0147] (1) Cell culture and animals

[0148] Refer to the cell culture and animals in Experimental Example 2.

[0149] (2) T cell isolation

[0150] Human peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors by gradient centrifugation (800 × g, 15 minutes). To activate T cells, 200 ng / mL anti-CD3 monoclonal antibody (OKT3, BioLegend), 100 ng / mL anti-CD28 monoclonal antibody (CD28.2, BioLegend), and 100 U / mL recombinant human interleukin-2 (IL-2, LifeScience) were used to treat T cells for 48 hours. Mouse PBMCs were mechanically isolated from the spleen and activated with IL-2 and 8 μg / mL concanavalin A (Millipore Sigma).

[0151] (3) In vitro synergistic therapy evaluation method

[0152] U87 and GL261-hFn14 / luc tumor cells were seeded into 24-well plates (1×10^5 cells per well) and incubated for 24 hours to allow attachment. Subsequently, cells were subjected to different treatment conditions: PLH1100+light, PLH1100+light+hBiTE / mBiTE, PLH1100+light+human T cells (hT cells) / mouse T cells (mT cells), hBiTE / mBiTE+hT cells / mT cells, PLH1100+light+hBiTE / mBiTE+hT cells / mT cells. PLH1100 was used at a concentration of 5μg / mL and the illumination time was 10 minutes (980nm, 0.5W / cm 2 ). After irradiation, 0.1 μg / mL BiTE and / or effector cells (human / mouse T cells) were added to the corresponding groups, and the ratio of effector cells to tumor cells was 8:1. The viability of tumor cells was then evaluated using the MTT method. The proliferation of T cells was evaluated by measuring the CytoTellTM Red signal intensity 24 hours after treatment.

[0153] (4) In vivo synergistic therapy evaluation method

[0154] C57BL / 6 mice bearing GL261-hFn14 / luc tumors were randomly divided into 5 groups (n=4 per group) and received different treatments: PBS+light, PLOX, PLH1100+light, mBiTE, PLH1100+light+mBiTE. The dose of PLH1100, 980nm light intensity, frequency and duration were the same as those for the in vitro synergistic treatment evaluation method. Three days after the last irradiation, Fn14×CD3 mBiTE (10 ng) was dissolved in 5μl X-vivo medium by stereotactic equipment and injected once every 2 days for a total of 3 times. Tumor growth was monitored every 7 days by IVIS system, and mouse body weight was recorded every 2 days. Mouse death was taken as the endpoint of the experiment. In the parallel group, mice were sacrificed 7 days after synergistic treatment, and tumors were collected and analyzed for tumor microenvironment by flow cytometry.

[0155] (5) Statistical analysis

[0156] Refer to the statistical analysis method of Experimental Example 2.

[0157] 3. Experimental results

[0158] (1) In vitro evaluation of the synergistic therapeutic effect of Fn14×CD3 mBiTE and PLH1100

[0159] Figure 6 G and H show the schematic diagram of mBiTE construction and SDS-PAGE protein quantification. The results showed that the molecular weight of mBiTE was between 55-70 kDa, similar to hBiTE, proving that mBiTE has been successfully constructed and purified. In the immune-mediated killing evaluation, mBiTE (0.1 μg / mL) showed excellent effects, with an average cell killing rate of 55% (0.1 μg / mL) at an 8:1 effector cell to target cell ratio and a killing time of 4 hours. Figure 5 L) Subsequent evaluations at different concentration gradients showed that the EC 50 0.064 μg / mL ( Figure 5 M).

[0160] Under similar conditions, synergistic therapeutic strategies were also evaluated. First, this study evaluated the effect of PTI of PLH1100 on killing of GL261-hFn14 / luc. Figure 6As shown in I and J, after laser irradiation, the photothermal effect changed the morphology of tumor cells and caused partial cell death. Then, the killing effect of adding mBiTE and / or mouse T cells (mT cells) 4, 8 and 12 hours after laser irradiation was examined. The results showed that the treatment groups with only mBiTE or mT cells added did not significantly increase the killing effect on GL261-hFn14 / luc. However, the treatment groups with both mBiTE and mT cells added after laser irradiation showed a significant killing effect, which was stronger than the treatment groups with only mBiTE or mT cells added. In addition, in the human immune cell cytotoxicity experiment, the synergistic treatment group with the addition of hBiTE and hT cells showed a more obvious killing effect on U87 cells after laser irradiation, surpassing the other four treatment groups ( Figure 5 N,O). Finally, considering that both photothermal effect and mBiTE-mediated mT cell activity are accompanied by the release of DAMPs and inflammatory factors, which contribute to the proliferation of lymphocytes. TM Red monitored the proliferation of mT cells. Figure 6 As shown in K, after 24 hours of co-culture killing, the signal intensity of mT cells in the co-treatment group decreased by 34.2%, which was higher than that in the non-co-treatment group (24.7% and 10.5%, respectively). This further indicates that the mT cells in the co-treatment group were more activated and underwent more proliferation and division. Similarly, the signal intensity of hT cells in the co-treatment group was also significantly reduced compared with the other treatment groups ( Figure 5 P).

[0161] In summary, the photothermal effect induced by PLH1100 can inhibit tumor cell growth in vitro, induce an effective immune proliferation response, and has a significant synergistic effect with Fn14-targeted BiTE in the treatment of GBM.

[0162] (2) Synergistic treatment of PTI+Fn14×CD3 mBiTE strategy in orthotopic GBM model of C57BL / 6 mice

[0163] Figure 7 A shows the detailed treatment scheme for C57BL / 6 mice. The dose of PLH1100 and laser irradiation scheme were the same as in the previous experiment. Figure 7As shown in B and C, among the single treatment groups (PBS+Light, PLOX, PLH1100+Light, mBiTE), mBiTE showed the best therapeutic effect, and the treated mice showed slower tumor growth and relatively longer survival time. In addition, the PTI method of PLH1100+Light delayed the growth of intracranial tumors in mice more effectively than the PBS+Light and PLOX treatment groups. Importantly, compared with single treatment, the combined treatment of PTI+Fn14×CD3 mBiTE strategy significantly inhibited tumor growth. The PLH1100+Light strategy of this study enhanced the tumor cell killing ability of mBiTE and extended the survival time of treated mice to nearly 90 days ( Figure 7 D). To verify the monitoring results, this study used immunofluorescence and Western blotting to detect Fn14 expression on GL261-hFn14 / luc cells ( Figure 7 EG). The results showed that the PTI+Fn14×CD3 mBiTE strategy significantly inhibited the expression of Fn14; the expression level in the PLH1100+Light+mBiTE treatment group was the lowest, followed by the mBiTE and PLH1100+Light treatment groups, with the mBiTE treatment group having a lower level than PLH1100+Light. This suggests that the Fn14×CD3mBiTE in this study is effective in killing GL261-hFn14 / luc tumors, and its efficacy further enhances the immune activation effect induced by PLH1100. During the treatment period, this study continuously monitored the changes in body weight of mice in each group, and no significant differences were observed ( Figure 7 H). Taken together, these results demonstrate that the PTI+Fn14×CD3 mBiTE strategy is indeed feasible and can effectively treat an intracranial orthotopic GBM model in immunocompetent mice.

[0164] (3) Regulation and improvement of the immunosuppressive tumor microenvironment (TME) by PLH1100

[0165] PLH1100 not only improves the acidic environment within the tumor, but also promotes the expression and release of damage-associated molecular patterns (DAMPs). This may activate immune cells such as lymphocytes within the tumor and enhance the anti-tumor efficacy of mBiTE. Therefore, this study systematically evaluated the changes in TME after different treatments based on the sorting strategy of flow cytometry ( Figure 7 I). Dendritic cells (DCs) play a key role in initiating immune responses, and their maturity was assessed using flow cytometry in this study. Figure 8As shown in A and D, compared with the PBS+Light group, the percentages of mature DCs (CD45+CD11c+CD80+CD86+) in the PLOX, PLH1100+Light, mBiTE and PLH1100+Light+mBiTE groups increased by approximately 11%, 18%, 15% and 33%, respectively.

[0166] In addition, this study evaluated the polarization of tumor-associated macrophages from the M2 phenotype (CD45+CD11b+F4 / 80+CD206+) to the M1 phenotype (CD45+CD11b+F4 / 80+CD86+), because M1 macrophages can inhibit and destroy tumor cells through phagocytosis or cytokine-mediated cell death. Figure 8 As shown in B and E, compared with the PBS+Light group, the M1 cell population in the single treatment groups (PLOX, PLH1100+Light, and mBiTE) increased by 9%, 6%, and 3%, respectively; however, the combined treatment group increased significantly by 17%. These results consistently indicate that combined treatment is more effective than single treatment in promoting DC maturation and M1 polarization.

[0167] Following these cascade events, activated cytotoxic CD8+ T lymphocytes (CTLs) and CD4+ helper T cells play a key role in cellular and humoral immunity in cancer immunotherapy. Therefore, this study analyzed the infiltration of CTLs in GBM in different treatment groups ( Figure 8 C, F, G). After PLH1100+Light+mBiTE treatment, the infiltration of CTLs in the tumor increased significantly, from an average of 30.6% in the PBS+Light group to 54.3%. In contrast, the CTLs infiltration levels in the PLOX, PLH1100+Light, and mBiTE treatment groups were 41%, 32.4%, and 43.3%, respectively ( Figure 8 C, F). Similarly, this study found that the synergistic treatment of PTI+Fn14×CD3 mBiTE increased the infiltration of CD4+T cells in the tumor compared with the PBS+Light group ( Figure 8 C, G).

[0168] In addition, this study also examined the immune response cytokines in tumors, including interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α), such as Figure 8 As shown in H and I, the PTI+Fn14×CD3 mBiTE group had the highest level of inflammation. In addition, regulatory T cells (Treg) and myeloid-derived suppressor cells (MDSCs), as the main tumor immunosuppressive components, are major obstacles to anti-cancer immunity. Recent studies have shown that abnormal lactate metabolism in the TME is associated with enhanced activity of Treg cells and MDSCs in tumors. Fig. 9 As shown in AD, the PTI+Fn14×CD3 mBiTE synergistic strategy of this study significantly reduced Treg cells and MDSCs in the tumor, as indicated by the immune markers CD45+CD3+CD4+Foxp3+ and CD45+CD11b+Gr-1+, respectively. Overall, the PTI+Fn14×CD3 mBiTE strategy of this study successfully activated the immunosuppressive TME of GBM and showed excellent synergistic antitumor response.

[0169] From the above experimental results, it can be seen that when the concentration of PLH1100 is 5μg / mL, the light intensity is 980nm, 0.5W / cm 2 After 10 minutes of irradiation, combined use with 0.1μg / mL mBiTE can exert a synergistic effect. Among them, during the polarization of tumor-associated macrophages from M2 phenotype (CD45+CD11b+F4 / 80+CD206+) to M1 phenotype (CD45+CD11b+F4 / 80+CD86+), the M1 cell population in the combined treatment group increased by 17%, which was greater than the sum of the single treatment groups PLH1100+Light (6%) and mBiTE (3%), confirming that PLH1100 combined with Fn14×CD3mBiTE has a significant synergistic effect in the PTI treatment of GBM at 980nm light intensity.

[0170] In summary, the present invention provides a semi-cyanine photosensitizer and its preparation method and application. The present invention develops a semi-cyanine dye-based molecule with a D-π-A structure through donor substitution engineering, and the semi-cyanine dye-based molecule has excellent spectral properties. The PLH1100 nanoassembly further constructed based on the semi-cyanine dye-based molecule of the present invention has excellent brain targeting, tumor enrichment, photostability and biocompatibility, as well as excellent photothermal conversion efficiency and NIR-II tumor imaging capability, and is suitable for photothermal immunotherapy of brain glioblastoma. In addition, the present invention also found that PLH1100 can significantly enhance the efficacy of a bispecific T cell adapter targeting the Fn14 target, and the combination of PLH1100 and a bispecific T cell adapter plays a synergistic role in photothermal immunotherapy, which opens up a new way for the clinical treatment of glioblastoma and has significant clinical application potential.

Claims

1. A hemicyanine dye-based molecule, characterized in that Its structure is shown in Formula I: Wherein R1 is selected from hydrogen, C 1-3 Alkyl, R2 is selected from hydrogen, C 1-3 alkyl.

2. The hemicyanine dye-based molecule according to claim 1, characterized in that Its structure is as follows:

3. A nanoparticle, characterized in that: The invention is a product obtained by reacting the semi-cyanine dye-based molecules as claimed in claim 1 or 2, liposomes, ligand-modified liposomes and biocatalysts as raw materials.

4. The nanoparticle according to claim 3, characterized in that The biocatalyst is lactate oxidase; The ligand is a ligand targeting low-density lipoprotein receptor-related protein-1; Preferably, the amino acid sequence of the ligand is shown in SEQ ID No.1; The method for preparing the ligand-modified liposome comprises the following steps: reacting the thiolated ligand with the maleimide-containing liposome to obtain the ligand-modified liposome; More preferably, the liposome is DSPE-PEG2000.

5. A method for preparing the nanoparticles according to claim 3 or 4, characterized in that: The method comprises the following steps: heating the hemicyanine dye-based molecules, liposomes and ligand-modified liposomes to react to obtain a mixture, and reacting the mixture with a biocatalyst again to obtain nanoparticles.

6. The method according to claim 5, characterized in that The mass ratio of the semi-cyanine dye-based molecules, liposomes, ligand-modified liposomes and biocatalysts is 1:1-3:0.5-2:1-3; the solvent for the heating reaction is an inorganic solvent; the temperature of the heating reaction is 60-80°C and the time is 20-40 minutes; the temperature of the secondary reaction is 10-40°C and the time is 1-3 hours.

7. Use of the hemicyanine dye-based molecule according to claim 1 or 2 or the nanoparticle according to claim 3 or 4 in the preparation of a photosensitizer.

8. The use according to claim 7, characterized in that The photosensitizer is a drug for preventing and / or treating glioblastoma.

9. A combined drug, characterized in that: It contains the nanoparticles and bispecific T cell engagers of claim 3 or 4 for simultaneous or separate administration in unit preparations of the same or different specifications, and a pharmaceutically acceptable carrier; Preferably, the bispecific T cell engager is a bispecific T cell engager targeting Fn14; The mass ratio of the nanoparticles to the bispecific T cell engager is 4-6:0.05-0.15, preferably 5:0.

1.

10. Use of the combined drug and the light-emitting device according to claim 9 in the preparation of a device for treating glioblastoma; preferably, the wavelength of the light source in the light-emitting device is 950-1000nm, and the irradiance is 0.3-0.7W / cm 2 , the irradiation time is 5-15 minutes; more preferably, the wavelength of the light source in the light emitting device is 980nm, and the irradiance is 0.5W / cm 2 , the irradiation time is 10 minutes.

Images