Aspergillus tubingensis strain and application thereof

Abstract

The invention discloses an Aspergillus tubingensis strain and application thereof, the classification name of the Aspergillus tubingensis strain is Aspergillus tubingensis TL-B31f, and the preservation number of the Aspergillus tubingensis strain is CCTCC (China Center For Type Culture Collection) M 20241814. The Aspergillus tubingensis strain has the capabilities of efficiently dissolving phosphorus and producing iron carriers and 3-indoleacetic acid (IAA), can be applied to non-grain cultivated land as a growth promoting agent, and can improve soil matrix components, so that the non-grain cultivated land can be suitable for planting rice and promoting the growth of the rice, thereby being beneficial to improving the grain yield.

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and in particular to an Aspergillus tubingensis strain and application thereof. Background Art

[0002] Food security is the foundation of a country, and farmland is the cornerstone of food production and ecological security. However, farmland, which is the basis of human survival and development, has shown a tendency to be used for non-grain production in recent years, that is, farmland for rice and other grains is used for other production operations, such as planting trees, fruits, vegetables or flowers. After being used for non-grain production, it is difficult to use these farmlands for rice cultivation, which affects food security.

[0003] In the existing technology, the fertility of non-grain farmland is mainly increased to make it suitable for rice cultivation, and the source of fertility is chemical fertilizers and biological organic fertilizers. However, this method has limited effect on soil improvement, and the growth of rice in non-grain farmland is still restricted, affecting grain production. Summary of the invention

[0004] In view of the existing technical problems, the present application provides a strain of Aspergillus tubingensis and its application, so as to realize the planting of rice on non-grain arable land, promote the growth of rice, and ensure the grain yield.

[0005] The Aspergillus tubingensis strain provided in the present application is classified and named Aspergillus tubingensis TL-B31f, deposited in the China Center for Type Culture Collection, with the deposit number CCTCC M 20241814, the deposit date is August 19, 2024, and the deposit address is Wuhan, China.

[0006] The Aspergillus tubingensis TL-B31f provided in the present application has efficient phosphate solubilization ability and the ability to produce 3-indoleacetic acid (IAA) and iron carriers required for plant growth, and can be used as a growth-promoting strain in the soil.

[0007] The present application also provides a microbial agent comprising the Aspergillus tubingensis strain according to claim 1.

[0008] Optionally, the microbial agent is a suspension of conidia of the Aspergillus tubingensis strain.

[0009] Optionally, the suspension is prepared by dispersing conidia of the Aspergillus tubingensis strain in water.

[0010] The present application also provides the use of the microbial agent in rice cultivation.

[0011] Optionally, the rice is planted in the soil of non-grain arable land. The non-grain arable land refers to arable land used for growing food crops such as rice but used to grow economic plants such as bamboo shoots, fruits, green trees, vegetables or flowers. In this application, non-grain arable land is, for example, a field where vegetables and fruits have been planted. Since a large amount of chemical fertilizers are used in field production management for the planting of vegetables and fruits, the problems of soil degradation, soil acidification and destruction of the arable layer are prominent.

[0012] Optionally, the application includes: applying the microbial agent to the roots of the rice during the growth period of the rice, wherein the specific means of application is to irrigate the roots of the rice.

[0013] Optionally, the concentration of the microbial agent is 1×10 5 ~1×10 7 Conidia / mL. Preferably 1×10 6 conidia / mL.

[0014] Optionally, the application time is from the stage when the rice sprouts out of the soil to the stage when the plant height is 2 to 3 cm.

[0015] Optionally, the amount of the microbial agent applied to each rice plant is 8-15 mL, preferably 10 mL.

[0016] Compared with the prior art, the Aspergillus tubingensis strain provided in the present application has the ability to efficiently solubilize phosphate, produce siderophores and 3-indoleacetic acid (IAA), and can be used as a growth-promoting bacterium in non-grain farmland. It can improve the soil matrix composition, make non-grain farmland suitable for growing rice, promote rice growth, and thus help increase grain production. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A This is the colony morphology of strain TL-B31f after being cultured on PDA medium at 25°C for 7 days;

[0018] Figure 1B This is the colony morphology of strain TL-B31f after being cultured on CYA medium at 25°C for 7 days;

[0019] Figure 1C This is the colony morphology of strain TL-B31f after being cultured on MEA medium at 25°C for 7 days;

[0020] Figure 2 Schematic diagram of the maximum likelihood (ML) tree of 39 taxa of Aspergillus species constructed based on the four genes ITS, TUB, RPB2 and CaM, with Talaromyces flavus CBS310.38 as the outgroup of the tree, and the corresponding values ​​with the maximum ML support rate of more than 50% are shown. The taxa of the isolated strains in this study are shown in bold;

[0021] Figure 3 The figure is the result of the determination of the phosphorus solubilizing ability of 15 strains;

[0022] Figure 4 The figure shows the results of the determination of the ability of 15 strains to produce siderophores;

[0023] Figure 5 The results of the IAA production capacity test of 15 strains are shown in Figure 1, where the tryptophan content in each PDB medium is 0, 0.1%, and 1.0%;

[0024] Figure 6 This graph shows the effect of 15 strain suspensions on the growth of rice planted in non-grain farmland soil after 55 days of root irrigation. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0027] This application involves a variety of culture media, and the specific formulas of each culture medium are as follows:

[0028] Potato dextrose agar (PDA) medium (per liter): 200 g peeled potatoes, 20 g glucose, 20 g agar, 1000 mL double distilled water.

[0029] NBRI-MTSB medium (per liter): glucose 10 g, magnesium chloride 5 g, potassium chloride 0.2 g, magnesium sulfate heptahydrate 0.25 g, ammonium sulfate 0.1 g, calcium phosphate 5 g, agar 15 g, double distilled water 1000 mL, pH 7.0.

[0030] CAS medium (per liter): Solution A: CAS 0.0605g, double distilled water 50mL, 1mM ferric chloride hexahydrate (containing 10mM HCl) 10mL; Solution B: HDTMA 0.0729g, double distilled water 40mL; Solution C: double distilled water 750mL, 10x MM9 (potassium dihydrogen phosphate 0.3g, sodium chloride 0.5g, ammonium chloride 1.0g, sodium hydroxide 6.0g, 30.24g PIPES, double distilled water 1000mL) 100mL, PIPES 30.24g, agar 15g, pH 6.8. Solutions A and B were mixed and sterilized. After solution C was sterilized and cooled to about 50°C, the above sterilized A+B solution, 10% casamino acid 30mL, glucose 2g, 1M magnesium chloride 1mL, and 100mM calcium chloride 1mL were added.

[0031] Potato dextrose (PDB) medium (per liter): 200 g peeled potatoes, 20 g glucose, 1000 mL double distilled water.

[0032] CYA medium (per liter): Czapek Concentrate (30 g sodium nitrate, 5 g potassium chloride, 5 g magnesium sulfate heptahydrate, 0.1 g ferrous sulfate heptahydrate, 0.1 g zinc sulfate heptahydrate, 0.05 g copper sulfate pentahydrate, 1000 mL double distilled water) 10 mL, 30 g sucrose, 5 g yeast extract, 1 g dipotassium hydrogen phosphate, 0.005 g copper sulfate pentahydrate, 0.01 g zinc sulfate heptahydrate, 20 g agar, 1000 mL double distilled water, pH 6.2.

[0033] MEA medium (per liter): 50 g malt extract, 0.005 g copper sulfate pentahydrate, 0.01 g zinc sulfate heptahydrate, 1000 mL double distilled water, pH 5.4.

[0034] Example 1 Isolation, purification and screening of strains

[0035] 1.1 Isolation and purification

[0036] The five-point sampling method was used to collect soil from non-grain cultivated land in several counties and districts of Hangzhou City, Zhejiang Province, including loquat and rice rhizosphere soil in Jiande, mulberry and rice rhizosphere soil in Chun'an, blueberry and rice rhizosphere soil in Tonglu, grape and rice rhizosphere soil in Fuyang, bamboo and rice rhizosphere soil in Lin'an, and seedlings and rice rhizosphere soil in Yuhang. Each soil sample was sealed in a clean bag and brought back to the laboratory. The soil dilution method was used to isolate the microbial strains in each soil sample. The specific operation was as follows: 20 g of soil sample was weighed in 180 mL of double distilled water (ddH2O), shaken on a shaker at 180 rpm for 30 min, and made into 10 -1 Soil dilution; take 1mL of this dilution and place it in a centrifuge tube containing 9mL ddH2O to make 10 -2 Soil dilution; and so on, get 10-3 , 10 -4 Soil dilution. Take 100 μL of 10 -3 and 10 -4 The soil dilution was spread on a PDA plate and cultured in a 25°C incubator for 3 to 4 days. Fungi with fast growth rate (large colonies) and different colony morphologies (e.g., color, sparse or dense hyphae, concentric radiation, etc.) were selected and purified on a new PDA plate. After 2 to 3 purifications, 215 strains were obtained.

[0037] 1.2 Screening

[0038] Phosphate solubilization: Use a cork puncher to cut bacterial slices (5 mm in diameter) and transfer 215 strains to NBRI-MTSB medium plates. Culture at 25°C for 3 days and observe the size of the phosphate solubilization circle.

[0039] Siderophore production: Use a cork puncher to cut bacterial slices (5 mm in diameter) and transfer the strains with phosphate-dissolving ability to CAS medium plates and culture them at 25°C for 3 days. Observe the color change of the medium. If it changes from blue to orange-yellow, it indicates that the strains on the medium have the ability to produce siderophores.

[0040] IAA production: Use a cork punch to cut bacterial slices (5 mm in diameter) and transfer the strains with phosphate solubilization and iron carrier production into test tubes containing 10 mL of PDB medium (containing 0%, 0.1% or 1.0% tryptophan), culture on a shaker at 25°C and 180 rpm for 7 days, and use a spectrophotometer to detect whether IAA is produced.

[0041] From three groups of experiments, 15 strains with the capabilities of solubilizing phosphate, producing siderophores and producing IAA were screened out and numbered as JD-L31f, JD-R21f, CA-R11f, TL-B11f, TL-B21f, TL-B31f, FY-G-R31f, FY-R11f, FY-R31f, FY-R41f, FY-R71f, LA-R21f, YH-S11f, YH-R21f and YH-R31f. Among them, JD-L31f was isolated from Jiande loquat rhizosphere soil, JD-R21f was isolated from Jiande rice rhizosphere soil, CA-R11f was isolated from Chun'an rice rhizosphere soil, TL-B11f was isolated from Tonglu blueberry rhizosphere soil, TL-B21f was isolated from Tonglu blueberry rhizosphere soil, TL-B31f was isolated from Tonglu blueberry rhizosphere soil, FY-G-R31f was isolated from Fuyang grape-rice rhizosphere soil; FY-R11f was isolated from Tonglu blueberry rhizosphere soil, TL-B21f was isolated from Tonglu blueberry rhizosphere soil, TL-B31f was isolated from Tonglu blueberry rhizosphere soil, FY-G-R31f was isolated from Fuyang grape-rice rhizosphere soil, and FY-R11f was isolated from Tonglu blueberry rhizosphere soil. 1f was isolated from the rhizosphere soil of rice in Fuyang, FY-R31f was isolated from the rhizosphere soil of rice in Fuyang, FY-R41f was isolated from the rhizosphere soil of rice in Fuyang, FY-R71f was isolated from the rhizosphere soil of rice in Fuyang, LA-R21f was isolated from the rhizosphere soil of rice in Lin'an, YH-S11f was isolated from the rhizosphere soil of seedlings in Yuhang, YH-R21f was isolated from the rhizosphere soil of rice in Yuhang, and YH-R31f was isolated from the rhizosphere soil of rice in Yuhang.

[0042] Determination of phosphate solubilization capacity of 15 strains:

[0043] The 15 strains stored at -70°C were activated by culturing on PDA plates at 25°C for 3 days, and then bacterial slices (5 mm in diameter) were cut with a cork puncher and transferred to NBRI-MTSB medium plates. They were cultured at 25°C for 3 days and the diameter of the phosphate dissolution zone was measured.

[0044] Determination of the iron carrier production capacity of 15 strains: The 15 strains activated on the PDA plate were cut into bacterial slices (5 mm in diameter) using a cork puncher and transferred to CAS medium plates and cultured at 25°C for 3 days, and the diameter of the orange-yellow halo was measured.

[0045] Determination of IAA production capacity of 15 strains: The 15 strains activated in Example 2 were cut into bacterial pieces (5 mm in diameter) using a cork punch and transferred to a test tube containing 10 mL of PDB medium, cultured on a shaker at 25°C and 180 rpm for 7 days, and the OD530 value was measured using a spectrophotometer. Different tryptophan contents (0.1%, 1.0%) in PDB were used as different treatments, and PDB without tryptophan was used as a blank control.

[0046] See also Figures 3 to 5 As shown in Table 1, the experimental results show that among the 15 strains, strain TL-B31f has excellent phosphate solubilization, siderophore production and IAA production capabilities.

[0047] Table 1 Phosphate solubilization, siderophore production and IAA ability of 15 fungal strains

[0048]

[0049] Note: Different lowercase letters indicate significant differences at P < 0.05 level.

[0050] Example 2 Identification of strain TL-B31f

[0051] (1) Morphological characteristics of strains

[0052] The isolated strain TL-B31f was inoculated into PDA medium, CYA medium and MEA medium respectively, and cultured at 25°C for 7 days. The colony morphology of the strain on the three media was observed. The results are shown in Figure 1A to Figure 1C .

[0053] in, Figure 1A This is the colony morphology of strain TL-B31f after being cultured on PDA medium at 25°C for 7 days. The colonies are round, the mycelium is white to light yellow, and the brown-black conidia are arranged in whorls. Figure 1B This is the colony morphology of strain TL-B31f after culturing on CYA medium at 25°C for 7 days. The colonies are round, nearly flat, velvety, with white mycelium and brown-black conidia. Figure 1C The colony morphology of strain TL-B31f after culturing on MEA medium at 25°C for 7 days is round, dark brown, velvety and slightly flocculent. Based on the results in Figure 1, it is preliminarily determined that strain TL-B31f is Aspergillus sp.

[0054] (2) Phylogenetic analysis

[0055] The genomic DNA of strain TL-B31f was extracted and the genomic DNA was expressed using primer pairs ITS5 (5′-GGA AGT AAA AGT CGTAAC AAG G-3′) (SEQ ID NO: 1) and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) (SEQ ID NO: 2), Bt2a (5′-GGT AAC CAA ATC GGT GCT GCT TTC-3′) (SEQ ID NO: 3) and Bt2b (5′-ACC CTCAGT GTA GTG ACC CTT GGC-3′) (SEQ ID NO: 4), 5F (5′-GAY GAY MGW GAT CAY TTY GG-3′) (SEQ ID NO: 5) and 7CR (5′-CCC ATR GCT TGY TTR CCC AT-3′) (SEQ ID NO: 6), CMD5 (5′-CCGAGT ACA AGG ARG CCT TC-3′) (SEQ ID NO: 7). NO: 7) and CMD6 (5′-CCG ATR GAG GTC ATR ACG TGG-3′) (SEQ ID NO: 8), and ITS, TUB, RPB2, and CaM genes were amplified by PCR reaction.

[0056] The PCR amplification system (50 μL) was as follows: 17 μL ddH2O, 25 μL Mix (Zhejiang Shangya Biotechnology Co., Ltd.), 2 μL 10 μM primers, and 4 μL DNA. The amplification procedure for the ITS region was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 45 s, 52°C annealing for 45 s, 72°C extension for 1 min, 35 cycles; 72°C total extension for 10 min. The amplification procedure for the TUB and CaM genes was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 60 s, 55°C annealing for 60 s, 72°C extension for 90 s, 35 cycles; 72°C total extension for 10 min. The RPB2 gene amplification program was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 51°C annealing for 30 s, 72°C extension for 1 min, 5 cycles; 94°C denaturation for 30 s, 49°C annealing for 30 s, 72°C extension for 1 min, 5 cycles; 94°C denaturation for 30 s, 47°C annealing for 30 s, 72°C extension for 1 min, 30 cycles; 72°C total extension for 10 min. The fragments obtained by PCR amplification were sent to Beijing Qingke Biotechnology Co., Ltd. (Hangzhou Branch) for sequence determination. The sequencing results are as follows:

[0057] ITS region sequence:

[0058] ATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTC(SEQ ID NO:9)

[0059] TUB region sequence:

[0060] CATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTACAACTTTTTCACACCTCTCAATTGGTCAACAATGTGGAAAGGATTGGGTTTCCTGACGCGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTTAGATCACACCGTCCCTGAGTTTTTTCACGACAATATCATCAATGTCCTGACCACTTCAGCAGGCTAGCGGTAACAAGTATGTCCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACG(SEQ ID NO:10)

[0061] RPB2 region sequence:

[0062] AGTACGCTCTTGCTACCGGTAACTGGGGAGAGCAGAAGAAGGCAGCCAGCGCCAAGGCTGGTGTATCTCAAGTGCTCAGTCGTTATACCTACGCCTCTACGTTGTCCCACCTTCGTCGTACCAATACACCCATTGGTCGAGACGGTAAGATTGCCAAACCTCGTCAGCTCCACAACACCCATTGGGGTCTGGTTTGTCCAGCTGAAACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGGCGCTCATGTGCTACATCACTGTTGGTACGCCTAGTGAGCCCATTATTGATTTCATGATTCAACGAAACATGGAAGTCCTCGAACAATTCGAGCCGCAGGTGACGCCAAATGCAACCAAGGTGTTTGTCAACGGTGTTTGGGTGGGTATTCATAGAGATCCTGCGCATCTGGTGAACACCATGCTCTCTCTCCGTCGCCGGAACATGATCTCGCACGAGGTCAGTCTGATTCGTGATATTCGTGAGCGAGAGTTCAAGATCTTTACCGATGCTGGACGCGTGTGTCGGCCACTGTACGTCGTCGACAATGACCCCAAGAGCGAGAACTGTGGTTCACTGGTGCTCAACAAGGAGCACATCCGCAAACTGGAGCAAGACAAGGATTTGCCCCCCGATCTGGATCCAGAAGACCGCAGGGAGCGCTACTTTGGTTGGGATGGTTTGGTGAAGTCTGGTGTCGTTGAGTACGTCGACGCCGAGGAAGAAGAGACAATCATGATCGTGATGACACCAGAGGACCTGGAGATCTCGAAGCAACTTCAGGCCGGTTATGCCCTTCCCGAGGAGGAGCTGCACGACCCCAACAAGCGTGTGCGTTTCTATTCTGAGTCAAAAGGCACACACCTGG(SEQ ID NO:11)

[0063] CaM region sequence:

[0064] TAATGTATTTTCAAACTCAATAGGACAAGGATGGCGATGGTGGGTGGAATTCTGTCCCCTTCACGTTTTACCTGTAGCGCCCGATCCGACCGCGGGATTTCGACAGCTATTTCCCCCTTCGATCTGAATCATAATACTGATGTAATCTGGAAATAGGCCAGATCACCACCAAGGAGCTCGGCACTGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCTGAGCT TCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGAACGATCGACTTCCCCGGTATGTGATAGATCTACGCCTGTAAGGCGGGAATGCCGTATGGATTGTGATTGACTTTTGCCGCCAGAATTCCTTACCATGATGGCTCGTAAGATGAAGGACACCGACTCCGAGGAGGAAATCCGCGAGGCTTTCAAGGTCTTCGACCGCGACAACAATGGTTTCA (SEQ ID NO:12)

[0065] Figure 2 The phylogenetic tree was constructed by the maximum likelihood method of MEGA6.0. The phylogenetic tree consisted of 39 taxa, of which T. flavus CBS310.38 was used as an outgroup. The phylogenetic tree constructed after concatenating the sequences of the four loci showed that strain TL-B31f was clustered together with Aspergillus tubingensis YH-R31f, Aspergillus tubingensis FY-R71f, Aspergillus tubingensis YH-R21f, Aspergillus tubingensis FY-R11f and Aspergillus tubingensis NRRL62644 as a branch with a support rate of 100%. The results of phylogenetic analysis were consistent with the results of morphological identification, indicating that strain TL-B31f belonged to Aspergillus tubingensis, and was named Aspergillus tubingensis TL-B31f, which was deposited in the China Center for Type Culture Collection with the strain accession number of CCTCC M 20241814.

[0066] Example 3 Effect of Aspergillus tubingensis TL-B31f on the growth promotion of rice in non-grain cultivated soil

[0067] Aspergillus brunneoviolaceus JD-L31f, Talaromyces veerkampii JD-R21f, Penicillium limosum CA-R11f, Penicillium limosum TL-B11f, Aspergillus brunneoviolaceus TL-B21f, Aspergillus tubingensis TL-B31f, Penicilliumoxalicum FY-G-R31f, Aspergillus tubingensis FY-R11f, Talaromyces veerkampii FY-R31f, Talaromyces veerkampii FY-R41f, Aspergillus tubingensis FY-R71f, Talaromyces purpureogenus LA-R21f, Aspergillus brunneoviolaceus YH-S11f, Aspergillus tubingensis YH-R21f, and Aspergillus tubingensis YH-R31f were activated on PDA culture plates, and then fungus pieces (5 mm in diameter) were cut with a cork puncher and transferred to new PDA culture plates. The plates were cultured at 25°C for 7 to 10 days, and spores were collected with sterile water to obtain 10 6 A suspension containing 10 conidia / mL.

[0068] 'Xiushui 131' rice seeds were first disinfected with 75% alcohol for 1 min, and then rinsed with sterile water for 3 times. The above seeds were placed on moist sterile filter paper and pre-cultured at 25°C for 2 days. The germinated seeds were sown in planting pots filled with non-sterile non-grain cultivated soil (vegetable and fruit fields in Xihu District, Hangzhou) and cultured in a greenhouse at 25°C and 70-80% relative humidity. Rice seedlings with basically the same growth were retained, with 6 plants per pot, 12 pots per treatment, and repeated three times. 10 mL of each conidia suspension was irrigated at the roots of rice plants, and irrigated with sterile water as a control. After growing in a greenhouse at 25°C and 70-80% relative humidity for 55 days, the height, root length, fresh weight and dry weight of rice plants were measured. Among them, the growth-promoting effect (GPF%) = (treatment-control) / control×100%.

[0069] The results are as follows Figure 6 As shown in Tables 2 and 3, the experimental results show that the application of the suspension of Aspergillus tubingensis TL-B31f in non-grain cultivated land soil can significantly promote the growth of rice, measured by indicators such as plant height, root length, underground dry weight or fresh weight, and aboveground dry weight or fresh weight.

[0070] Table 2 Effects of suspensions prepared from 15 strains on rice plant height and root length

[0071]

[0072]

[0073] Note: Different lowercase letters indicate significant differences at P < 0.05 level.

[0074] Table 3 Effects of suspensions prepared from 15 strains on rice growth

[0075]

[0076] Note: Different lowercase letters indicate significant differences at P < 0.05 level.

[0077] The above-described embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the present application. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the attached claims.

Claims

1. A strain of Aspergillus tubingensis, characterized in that The classification name is Aspergillus tubingensis TL-B31f, and the deposit number is CCTCC M 20241814.

2. A microbial agent comprising the Aspergillus tubingensis strain according to claim 1.

3. The microbial agent according to claim 2, characterized in that: The microbial inoculant is a suspension of conidia of the Aspergillus tubingensis strain.

4. The microbial agent according to claim 3, characterized in that: The suspension is prepared by dispersing conidia of the Aspergillus tubingensis strain in water.

5. Use of the microbial agent according to any one of claims 2 to 4 in rice cultivation.

6. The use according to claim 5, characterized in that: The rice is planted in the soil of non-grain cultivated land.

7. The use according to claim 5, characterized in that: include: During the growth period of rice, the microbial agent is applied to the roots of the rice.

8. The use according to claim 7, characterized in that: The concentration of the microbial agent is 1×10 5 ~1×10 7 conidia / mL.

9. The use according to claim 7, characterized in that: The application time is from the time when rice sprouts out of the soil to the stage when the plant height is 2 to 3 cm.

10. The use according to claim 7, characterized in that: 8 to 15 mL of the microbial agent was applied to each rice plant.

Images