Peach brown rot antagonistic yeast strain HYQ-4.1 as well as biocontrol inoculant and application thereof

Abstract

The invention provides a peach brown rot antagonistic yeast strain HYQ-4.1 as well as a biocontrol inoculant and application thereof, and belongs to the technical field of biocontrol bacteria. According to the invention, a brown rot pathogenic bacterium is separated and identified from peach fruits with brown rot, the brown rot pathogenic bacterium is meaustralian-type sclerotinia sclerotiorum, a novel antagonistic yeast strain is obtained by screening aiming at the pathogenic bacterium, the novel antagonistic yeast strain is Wickerhamomyces anomalus strain HYQ-4.1, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.30543. The strain HYQ-4.1 has a good bacteriostasis rate on meaustralian-type sclerotinia sclerotiorum, the prevention and incidence rate on in-vitro fruits is controlled to be 23.33% or below, and the scab diameter of brown rot pathogen in peach fruits can be effectively inhibited. The invention provides a new means for prevention and control of peach brown rot.

Description

Technical Field

[0001] The invention belongs to the technical field of biocontrol bacteria, and particularly relates to a peach brown rot antagonistic yeast strain HYQ-4.1 and a biocontrol agent and application thereof. Background Art

[0002] Peach is the main fruit tree cultivated in northern my country. According to statistics, the national peach cultivation area is 957,300 hectares, with a total output of 18 million tons. [1] The cultivated area in Shanxi is 48,000 hectares, with a total output of 1.513 million tons and a yield of 31.52 t / hm 2 , ranked first in the country [2] However, the brown rot caused by the infection of the ascomycete Monilinia spp. has caused a decrease in the yield and quality of many peaches. [3] The disease can occur throughout the growth and development period of peaches. In severe cases, it can cause a large number of fruits to fall. It is also very easy to occur during storage and transportation, causing huge economic losses. [4] Studies have found that Monilinia fructicola, Monilia yunnanensis, Monilinia fructigena and Monilia mumecola are the main pathogens of peach brown rot in my country, among which Monilinia fructicola is the dominant species in my country and is widely distributed. [5，6] .

[0003] At present, the prevention and control of peach brown rot is mainly through chemical control in production. Although it can reduce the occurrence of peach brown rot, long-term use is likely to have negative impacts on human, animal and environmental health, and induce plant pathogens to develop drug resistance. [7，8] Therefore, finding effective, environmentally friendly, clean and healthy prevention and control methods is a hot topic in research. In recent years, more and more biocontrol bacteria have been discovered, studied and used in production. Currently, the biocontrol bacteria used for brown rot mainly include Bacillus, Actinomycetes, Talaromyces and Pseudomonas. [9，10] . Han Kaidi et al. [5] Research has found that Bacillus subtilis causes the hyphae of M. yunnanensis to twist, swell and constrict, thereby achieving a biocontrol effect on peach brown rot.

[11] , S. spartinae W9 produced 18 major volatile organic compounds, some of which had antifungal activity and had biological control ability against strawberry gray mold. Pichia membranacea and Klebsiella citrifolia inhibited the occurrence of brown rot by competing with pathogens for nutrients and space

[12] The C. pratensis strain reduced the mycelial density of the pathogen and inhibited the pathogen

[13] However, there are few studies on antagonistic yeasts that have biocontrol effects on peach brown rot pathogens at home and abroad.

[0004] References

[0005] [1] Liang Ruizheng, Li Haiyan, Zhu Pengxiang, Lu Tailiang, Wan Baoxiong. Current situation, development trend and countermeasures of Guangxi peach industry[J]. Southern Horticulture, 2023, 34(04): 60-64.

[0006] [2] Wang Lirong. Current status and development suggestions of peach industry in my country[J]. Chinese Fruit Trees, 2021(10):1-5.

[0007] [3]Hassan MM,Daniele B, C,Oliveira LL,Véronique S,Bénédicte Q,Marco C. Phenotyping Brown Rot Susceptibility in Stone Fruit:ALiterature Review with Emphasis onPeach[J].Horticulturae,2021,7(5):115-115.

[0008] [4] Li Zhiwei, Wang Shaoli, Liu Baoyou, Du Jianfeng, Wang Yingzi. Identification and pathogenicity analysis of the pathogenic fungus causing peach brown rot in Shandong Province[J]. Journal of Fruit Science, 2023, 40(02): 327-339.

[0009] [5] Han Kaidi, Liu Jia, Zhang Shuwu, Xu Bingliang, Lü Shimin, Zhai Yifan, Wang Jie. Screening of biocontrol bacteria against peach brown rot pathogen Monilia yunnanensis and analysis of their antagonistic mechanism[J]. Chinese Fruit Trees, 2023(10):89-94.

[0011] [6]Rungjindamai N, Jeffries P, Xu

[0012] [7] Evgenios A, JE C. Fungicide-Induced Hormesis in PhytopathogenicFungi: A Critical Determinant ofSuccessfulAgriculture and EnvironmentalSustainability[J]. Journal of agricultural and food chemistry, 2021, 69(16): 4561-4563.

[0014] [8] Jia Xiangzi, Ye Jian, Wang Cheng, Xiong Zhengwen, Kong Xiangwei, Zhang Qingxia, Ji Zhaolin. Identification of the species of the biocontrol bacterium JY-d1 against peach brown rot and its biocontrol mechanism against peach brown rot[J]. Journal of Yangzhou University (Agriculture and Life Sciences), 2021, 42(04): 128-134.

[0015] [9] Luo Mei, Yin Weixiao, Luo Chaoxi. AS-PCR detection technology for resistance of peach brown rot pathogen to carbendazim[J]. Plant Protection, 2020, 46(6): 136-143+154.

[0016]

[10] Jia F,Chen M,Liu C,Chen S,LiuW,Huang K,Sun Horticulturae, 2024,(327):112836.

[0017]

[11] Zou X,WeiY,Zhu J,Sun J,Shao

[0018]

[12] Zhang J, Liu J, Xie J, Deng L, Yao S, Zeng K. Biocontrol efficacy of Pichia membranaefaciens and Kloeckera apiculata against Monilinia fructicola and their ability to induce phenylpropanoidpathway inplum fruit [J]. Biological Control, 2018, 129: 83-91.

[0019]

[13] Wu H, Li J, LiuW, Bai Summary of the invention

[0021] In view of this, the object of the present invention is to provide a peach brown rot antagonistic yeast strain HYQ-4.1, which belongs to abnormal Wickham yeast (W.anormalus), has a good preventive effect on the pathogen of peach brown rot, and the inhibition rate of its pathogen M.fructicola (M.fructicola) reaches more than 78.00%.

[0022] The invention provides an abnormal Wickham yeast strain HYQ-4.1, whose preservation number is CGMCC No.30543.

[0023] The invention provides a biocontrol fungicide, wherein the active ingredient comprises the abnormal Wickham yeast strain HYQ-4.1 or the fermentation liquid of the abnormal Wickham yeast strain HYQ-4.1.

[0024] Preferably, the effective viable bacterial concentration of the abnormal Wickham yeast strain HYQ-4.1 is ≥ 1×10 8 cells / mL or g.

[0025] Preferably, the biocontrol agent comprises a powder and / or an aqueous solution.

[0026] The invention provides application of the abnormal Wickham yeast strain HYQ-4.1 or the biocontrol agent in preventing and controlling peach brown rot.

[0027] Preferably, the pathogen of peach brown rot includes Monilinia fructicola.

[0028] Preferably, the method for preventing and controlling peach brown rot includes increasing the activity of stress-resistant enzymes in peach fruit.

[0029] Preferably, the peach fruit stress-resistant enzymes include at least one of the following: phenylalanine ammonia lyase, peroxidase, polyphenol oxidase and glucosidase.

[0030] The present invention provides the use of the abnormal Wickham yeast strain HYQ-4.1 in preparing an antibacterial agent for the American-Australian type of drupe chain sclerotinia and / or in inhibiting the plant pathogenic fungus American-Australian type of drupe chain sclerotinia.

[0031] Preferably, the applied concentration of the abnormal Wickham yeast strain HYQ-4.1 is ≥1×10 5 cells / mL.

[0032] The present invention provides an abnormal Wickham yeast strain HYQ-4.1, with a deposit number of CGMCC No.30543. The present invention isolates pathogenic bacteria from diseased fruits with brown rot symptoms of fruit trees of Shanxi Agricultural University, and uses the pathogenic bacteria as the test target bacteria to screen out a biocontrol strain HYQ-4.1 with obvious antagonism to a peach brown rot pathogen, with an inhibition rate of more than 78.00%, which has significant advantages over other strains screened in the same batch. At the same time, through morphological, physiological, biochemical and molecular identification, the biocontrol strain is identified as abnormal Wickham yeast. The present invention adopts in vitro fruit prevention effect determination, and the strain HYQ-4.1 has a good prevention and control effect on the brown rot pathogen, with an incidence rate as low as 23.33%, and at the same time controls the rot diameter of the fruit. It can be seen that the strain HYQ-4.1 has a good prevention and control effect on the peach brown rot pathogen, and provides a new means for preparing a biocontrol agent for peach brown rot and preventing and controlling peach brown rot in agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The results of the colony morphology and conidia morphology of peach brown rot pathogen, where A: the front of the colony cultured on PDA; B: the back of the colony cultured on PDA; C: conidiophores (10×40); D: conidia (10×40); E: germinated conidia;

[0034] Figure 2 This is the phylogenetic tree of the pathogen M-1 constructed based on ITS sequences;

[0035] Figure 3 Symptoms and results of inoculation with peach fruit pathogen M-1;

[0036] Figure 4 The results of the inhibitory effect of strain HYQ-4.1 on the American and Australian type of drupe chain sclerotinia M-1, A: American and Australian type of drupe chain sclerotinia M-1 colony (CK); B: The inhibitory effect of strain HYQ-4.1 on the American and Australian type of drupe chain sclerotinia M-1;

[0037] Figure 5 To antagonize the biological control effect of yeast on peach brown rot;

[0038] Figure 6 The colony morphology (A) and cell morphology (B) of antagonistic yeast HYQ-4.1;

[0039] Figure 7 This is the phylogenetic tree of the antagonistic yeast HYQ-4.1 constructed based on ITS sequences;

[0040] Figure 8 These are the results of the effects of abnormal Wickham yeast on the defensive enzyme activities of peach fruit, where A is POD activity, B is PPO activity, C is GLU activity, and D is PAL activity.

[0041] Description of biological material deposit

[0042] A strain of Wickerhamomyces anomalus, HYQ-4.1, was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on May 17, 2024. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the biological deposit number is CGMCC No.30543. DETAILED DESCRIPTION

[0043] The invention provides an abnormal Wickham yeast strain HYQ-4.1, whose preservation number is CGMCC No.30543.

[0044] In the present invention, the pathogen is firstly isolated from peach fruits with brown rot symptoms. After the pathogen is inoculated, the symptoms of the fruit obtained are completely consistent with the symptoms of naturally diseased peach fruits. At the same time, after molecular identification, the isolated peach fruit brown rot virus is Monilinia fructicola, and the ITS sequence is as shown in SEQ ID NO: 1 (AACCTGCGGAAGGATCATTACA GAGTTCATGCCCGAAAGGGTAGACCTCCCACCCTTGTGTATTATTACTTTGTTGCTTTGGCGAGCTGCCTTCGGGCCTTGTATGCTCGCCAGAGGATAATTAAACTCTTTTTATTAATGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTATTGAGTCTATGTCAGTAATGGCAGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAACGTAGTAATATCTCTCGTTACAGGTTCTCAGTGTGCTTCTGCCAAAACCCAAATTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA). The present invention isolates yeast strains from peach leaves and fruit surfaces, and uses the above-determined American-Australian type drupe chain sclerotinia pathogen as the target bacteria to carry out antagonistic experiments to screen antagonistic yeast strains. The results show that the present invention screens out 5 antagonistic yeast strains with obvious antibacterial rates against peach fruit brown rot virus bacteria, among which the antibacterial rate of strain HYQ-4.1 is the highest, which is 78.31%. The results of the in vitro fruit protection test showed that strain HYQ-4.1 could effectively control the incidence of brown rot, which was controlled below 23.33%. At the same time, strain HYQ-4.1 significantly reduced the diameter of the lesions of brown rot fungi in peach fruits, and the control effect increased with the increase of strain HYQ-4.1 concentration. It can be seen that strain HYQ-4.1 has an excellent control effect on peach fruit brown rot.

[0045] In the present invention, morphological, physiological and biochemical and molecular identification experiments were carried out on the strain HYQ-4.1. The morphological characteristics of the strain HYQ-4.1 are as follows: the colonies on the NYDA medium are milky white, round, with radial protrusions on the surface, viscous and aromatic; under a microscope, the cells are oval and elliptical. In the physiological and biochemical experiments, the fermentation experiment of Tang showed D-glucose positive, sucrose positive, starch negative, maltose positive, D-galactose positive, cellobiose negative, lactose negative and raffinose positive; the carbon source assimilation experiment showed D-glucose positive, D-galactose positive, starch positive, sucrose positive, D-xylose positive, trehalose positive, sorbitol positive, D-arabinose negative, maltose positive, citric acid positive, succinic acid positive, inositol negative, glycerol positive, raffinose positive, L-rhamnose negative; in the nitrogen source assimilation experiment, L-lysine positive, ammonium sulfate positive, potassium sulfate positive, sodium nitrite negative; at the same time, the strain did not produce starch, urea hydrolysis negative, and gelatin liquefaction negative. In the molecular identification experiment, the ITS sequence of strain HYQ-4.1 is shown in SEQ ID NO:2 (GCGGAAGGATCATTATAGTATTCTATTGCCAGCGCTTAATTGCGCGGC).The BLAST comparison of NCBI database revealed that strain HYQ-4.1 and abnormal Wickham yeast belong to the same closely related species, with a homology of more than 99%. At the same time, the phylogenetic tree results showed that strain HYQ-4.1 and abnormal Wickham yeast were clustered in the same branch. Based on the results of morphology, physiological and biochemical experiments and molecular identification, strain HYQ-4.1 was judged to be abnormal Wickham yeast.

[0046] The invention provides a biocontrol fungicide, wherein the active ingredient comprises the abnormal Wickham yeast strain HYQ-4.1 or the fermentation liquid of the abnormal Wickham yeast strain HYQ-4.1.

[0047] In the present invention, the anomalous Wickham yeast strain HYQ-4.1 preferably includes the bacterial body or spores of the anomalous Wickham yeast strain HYQ-4.1.

[0048] In the present invention, the effective viable bacterial concentration of the abnormal Wickham yeast strain HYQ-4.1 is preferably ≥ 1×10 8 The biocontrol agent preferably comprises a powder and / or an aqueous solution.

[0049] In the present invention, the method for preparing the biocontrol agent powder preferably comprises the following steps:

[0050] Amplify and culture the abnormal Wickham yeast strain HYQ-4.1, and collect the cells or spores;

[0051] The bacterial body or spore is mixed with a freeze-drying protective agent, and freeze-dried to obtain a biocontrol agent powder.

[0052] The present invention has no particular limitation on the method for amplifying and culturing the abnormal Wickham yeast strain HYQ-4.1, and any amplifying and culturing method for abnormal Wickham yeast known in the art can be used.

[0053] In the present invention, the method for preparing the biocontrol agent aqueous solution preferably comprises the following steps:

[0054] The abnormal Wickham yeast strain HYQ-4.1 is inoculated into a fermentation medium for fermentation and culture to obtain a fermentation liquid;

[0055] The fermented bacterial liquid is mixed with an aqueous solvent to obtain an aqueous biocontrol agent.

[0056] In the present invention, the fermentation medium is preferably a malt extract medium, the fermentation culture is preferably a shaking culture, the aqueous solvent is preferably glycerol, and the volume ratio of the fermentation liquid to the aqueous solvent is preferably 1:1.

[0057] Based on the good prevention effect of abnormal Wickham yeast strain HYQ-4.1 on peach brown rot, the present invention provides the use of the abnormal Wickham yeast strain HYQ-4.1 or the biocontrol agent in preventing and controlling peach brown rot.

[0058] In the present invention, the application concentration of the abnormal Wickham yeast strain HYQ-4.1 is preferably ≥1×10 5 cells / mL, more preferably 1×10 6 cells / mL~1×10 9 cells / mL, more preferably 1×10 8 cells / mL~1×10 9 cells / mL.

[0059] In the present invention, the pathogen of peach brown rot preferably includes Monilinia fructicola. In the embodiment of the present invention, the pathogen isolated from peach fruits with brown rot symptoms in Jinzhong City, Shanxi Province was identified by ITS, and the isolated strain M-1 (GenBank accession number: PP526970) had a similarity of more than 99% with the NCBI database of Monilinia fructicola. The strain M-1 was compared with sequences with higher homology to construct a phylogenetic tree. The phylogenetic tree analysis results based on the ITS sequence showed that the strain M-1 and the monilinia fructicola belonged to the same branch of the phylogenetic tree. Therefore, the pathogen of peach brown rot isolated by the present invention is Monilinia fructicola. The back grafting experiment showed that the symptoms of peach fruits back grafted with the pathogen strain M-1 were consistent with the symptoms of the disease under natural conditions, and the control group did not get sick. The result clearly showed that the pathogen strain M-1 of peach brown rot isolated by the present invention was Monilinia fructicola.

[0060] In the present invention, the control of peach brown rot preferably includes increasing the activity of anti-adversity enzymes in peach fruit. The anti-adversity enzymes in peach fruit preferably include at least one of the following: phenylalanine ammonia lyase (PAL), peroxidase (POD), polyphenol oxidase (PPO) and glucosidase (GLU). In the embodiment of the present invention, the abnormal Wickham yeast strain HYQ-4.1 treatment group (brown rot infected peach fruit treated with strain HYQ-4.1) and the control group (brown rot infected peach fruit), the POD activity change trend is first rising, then falling, and then rising. Compared with the control group, the POD activity of peach treated with W.anomalus generally increased, and the POD activity was the highest at the 2nd day and began to rise at the 5th day. The change trend of the GLU activity of peach fruit treated with HYQ-4.1 was consistent with that of the control group, reaching a peak at the 3rd day, and the GLU activity of peach fruit treated with HYQ-4.1 was 1.12 times that of the control. The PAL activity of peach fruit treated with HYQ-4.1 was significantly higher than that of the control group, with an activity of 52% higher, reaching a maximum value at the 4th day. The PPO enzyme activity of peach fruit treated with W.anomalus increased significantly compared with the control, and the maximum PPO activity of peach treated with W.anomalus was 1.45 times that of the control. It can be seen that PPO, POD, GLU and PAL are enzymes related to pathogen resistance. The strain HYQ-4.1 stimulates the activity of enzymes related to pathogen infection defense and improves the antioxidant capacity of plants, thereby inducing peach to resist pathogen infection.

[0061] The present invention provides the use of the abnormal Wickham yeast strain HYQ-4.1 in preparing an antibacterial agent for the American-Australian type of drupe chain sclerotinia and / or in inhibiting the plant pathogenic fungus American-Australian type of drupe chain sclerotinia.

[0062] In the present invention, the abnormal Wickham yeast strain HYQ-4.1 is preferably applied by spraying, and the spraying concentration is preferably ≥ 1×10 5 cells / mL, more preferably 1×10 6 cells / mL~1×10 9 cells / mL, more preferably 1×10 8 cells / mL~1×10 9 The present invention has no limitation on the amount of spraying, and the amount of spraying can be carried out according to methods known in the art, such as spraying the infected part.

[0063] The peach brown rot antagonistic yeast strain HYQ-4.1 and its biocontrol agent and application provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0064] Example 1

[0065] Screening and verification of an antagonistic yeast against peach brown rot

[0066] 1 Materials and methods

[0067] 1.1 Test materials

[0068] Peach brown rot fruits were collected from the "Cui Yu" peach variety from the Fruit Tree Research Institute of Shanxi Agricultural University in Taigu County, Shanxi Province; and several "Cui Yu" and healthy fruits were collected as materials for in vitro inoculation experiments.

[0069] 1.2 Main instruments and reagents

[0070] Ultraviolet spectrophotometer (UV-2450), Shimadzu Corporation, Japan; electronic analytical balance (BT224s), Beijing Zhongheng Rixin Technology Co., Ltd.; clean bench (S.SW-CJ-1FD), Shanxi Chicheng Experimental Instrument Sales Co., Ltd.; optical microscope, Shanghai Aiyan Biotechnology Co., Ltd.

[0071] 1.3 Test culture medium

[0072] Bengal red medium, PDA solid medium, Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd.; NYDA medium reference Cao Xuan

[14] The recipe.

[0073] 1.4 Methods

[0074] 1.4.1 Isolation and purification of pathogens

[0075] The pathogen was isolated from symptomatic peach fruit using conventional tissue isolation method.

[15] , use a sterile knife to cut a tissue of about 5mm×5mm at the junction of the diseased fruit and the healthy fruit, soak it in a 1% NaClO solution for 3 minutes for disinfection, wash it with sterile water 3 times, and air-dry it on sterile dry filter paper. Place the samples on the PDA plate, 3 samples on each plate, in a triangle shape, and culture them in a 28℃ constant temperature incubator in the dark for 5 to 6 days. Pick the edge of the colony and repeatedly subculture it for 4 to 5 generations until pure separation is obtained. Transfer it to a PDA slope and store it at 4℃. Select 15 symptomatic fruits (divided into 5 groups, 3 samples in each group) for experimental comparison.

[0076] 1.4.2 Pathogen inoculation (Koch's postulates)

[0077] Healthy, uniform-sized, and mature "Cui Yu" peaches were selected as inoculation materials. Before the experiment, the fruits were soaked in 0.1% sodium hypochlorite solution for 15 minutes, rinsed with sterile water three times after disinfection, and dried at room temperature.

[0078] Punch-inoculation cake method: The isolated strain is cultured on a PDA plate until the hyphae are luxuriant, and a 5mm diameter cake is punched along the edge of the colony with a sterile puncher for later use. Use a sterile puncher (5mm diameter) to punch two 3mm deep holes at the equator of the fruit, and the pathogen cake is inoculated on the wounded part of the peel with the hyphae surface close to the hole. The blank PDA cake is used as a control. The symptoms of the sample are observed 1 day after inoculation, and 6 biological replicates are set.

[0079] 1.4.3 Pathogen identification

[0080] 1.4.3.1 Morphological identification of pathogens

[0081] The purified strain was inoculated on PDA and cultured at 28°C and 75% relative humidity for 5 days. The macroscopic characteristics of the colony and the microscopic characteristics such as hyphae and spore morphology were observed under a microscope, referring to the Manual of Fungal Identification.

[16] As the basis for morphological classification of pathogens.

[0082] 1.4.3.2 Molecular identification of pathogens

[0083] Purify the pathogen and collect the hyphae after culturing on PDA plates for 5 days, then grind into fine powder under liquid nitrogen, repeat 3 times, extract the genomic DNA of the strain with TSINGKE Plant DNA Extraction Kit (Universal) and perform PCR amplification. The PCR product was sent to Beijing Qingke Biological Co., Ltd. for sequencing, and the sequencing results were analyzed by BLAST comparison, and the phylogenetic tree was constructed by the neighbor-joining method of MEGA 5.0 software, with 1000 bootstrap replicates. Molecular biological identification was combined with morphological identification to determine the type of pathogen.

[0084] 1.4.4 Screening and identification of antagonistic yeast

[0085] 1.4.4.1 Screening of antagonistic yeast

[0086] The ripe and intact peaches were rinsed, soaked in 75% ethanol for 30 seconds on a clean bench, disinfected with 2% sodium hypochlorite for 1 minute, and rinsed with sterile water three times.

[17] Screening of antagonistic yeast from peach leaves and fruit surfaces. Mince the tissue sample and weigh 5 g to place in PDB liquid medium and shake on a shaker for 12 hours. Serially dilute the culture to reduce the cell concentration, then apply 0.1 mL of each dilution on Bengal red medium with a sterile glass applicator. All cultures were cultured at 28 for 48 hours. The isolated yeast was re-cultured on NYDA medium until a pure culture was obtained. Yeast colonies were selected according to different morphological characteristics.

[0087] Yeast isolates were cultured together with pathogens on PDA medium to evaluate their antagonistic ability. A 5 mm diameter cake was taken from the edge of the activated pathogen and placed in the center of the PDA plate. Then, 2 days of activated antagonistic yeast was inoculated 2.5 cm from the edge of the plate, and the control was a blank, with 4 points per plate, repeated 3 times. After culturing at 28°C for 7 days, the inhibition rate was calculated according to the following formula I.

[0088]

[0089] 1.4.4.2 Determination of the protective effect of isolated fruits

[0090] Reference Zhang

[18] The biocontrol effect of antagonistic yeast on brown rot was determined using the method of "Cui Yu" peach. Preparation of antagonistic yeast suspension: After the yeast was isolated and purified and activated for 2 days, 2 loops were picked and placed in 50 mL of NYDB medium, and cultured at 28°C and 180 r / min for 24 hours; the culture solution was centrifuged at 8000 r / min for 15 minutes, and the supernatant was discarded. The precipitate was washed twice with sterile saline and resuspended, and counted with a hemocytometer for later use. 20 μL was mixed with different concentrations (1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 A suspension of W. anomalus (1×10 / mL) was injected into the pre-treated peach fruit wounds (soaked in 2% sodium hypochlorite solution for 3 min and rinsed with sterile water). As a control, the control was 20 μL of distilled water. 2 h after yeast inoculation, each wound was infected with 20 μL of spore suspension of brown rot fungus (1×10 5 The treated fruits were cultured at 25°C and 85% to 90% relative humidity for 5 days, and the fruit decay rate and decay diameter were measured. Each treatment included three replicates, with 10 fruits in each replicate.

[0091] 1.4.4.3 Determination of antagonistic yeast morphology and physiological and biochemical indicators

[0092] The antagonistic yeast samples were streaked onto NYDA and PDA plates for single colonies and cultured at 25°C for 24 h. The morphological and physiological and biochemical indices were determined.

[19] The physiological and biochemical characteristics were in accordance with the Manual of Characteristics and Identification of Yeast

[20] conduct.

[0093] 1.4.4.4 Molecular Biological Identification of Antagonistic Yeast

[0094] The DNA of antagonistic yeast was extracted using TSINGKE Plant DNA Extraction Kit (Universal). The PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were analyzed by BLAST comparison, and the phylogenetic tree was constructed using the neighbor-joining method of MEGA 5.0 software, with 1000 bootstrap replicates. Molecular biological identification was combined with morphological identification to determine the antagonistic yeast species.

[0095] 1.4.4.5 Biological control of peach brown rot by W.anomalus

[0096] Three circular wounds (5 mm in diameter and 3 mm in depth) were made on each surface-sterilized peach using a sterile cork borer. Then 30 μL of different concentrations of W. anomalus (1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 After 2 h, 30 μL of M. fructicola (1×10 5 After natural drying, the treated fruits were placed in a fresh-keeping box and cultured at 25°C with alternating light and dark for 12 h. The incidence rate and lesion diameter of peach fruits were measured after 5 days.

[0097] 1.4.5 Determination of defensive enzyme activity in peach fruit

[0098] The peach treatment process was the same as in 1.4.4.2, and the concentration of W.anomalus was 1×10 8 Preparation of enzyme extract: Put about 2g tissue sample into a sterile mortar, add 10ml 4℃ pre-cooled phosphate buffer (pH 7.8) and a small amount of quartz sand, and grind the sample on ice. Vortex and shake evenly, centrifuge at 8000g for 20min at 4℃, collect the supernatant and store at 4℃.

[0099] PPO enzyme activity was determined according to the catechol method;

[0100] Refer to Xiao

[21] The POD activity was determined by the method of

[0101] Refer to Yan

[22] The GLU enzyme activity was determined by the method of others;

[0102] Reference Saeid KJ

[23] The PAL enzyme activity was determined by the method of et al.

[0103] 1.4.6 Data Processing

[0104] After the data were processed with Excel 2007, one-way analysis of variance was performed on the data of each group using SPSS25.0, with p<0.05 as the standard for judging significance.

[0105] 2 Results

[0106] 2.1 Isolation, identification and pathogenicity determination of peach brown rot pathogen

[0107] 2.1.1 Morphological characteristics of pathogens

[0108] The strain M-1 isolated from diseased peach fruits grew well on the PDA plate. The colony edges were neat, without rosette structures, and the color was grayish yellow. The color in the middle of the colony was darker and the edges were neat ( Figure 1 The back of the culture dish is white ( Figure 1 Middle B); conidiophores are beaded, unbranched or dichotomously branched, with acute-angled branches, and conidiophores are relatively short ( Figure 1 Middle C). Conidia are colorless single spores, mostly lemon-shaped, branched, and some have flat ends at the top ( Figure 1 D, E). Combined with Zhou Fang

[24] Analysis of the population structure of brown rot pathogens and Wei Jingchao's "Handbook of Fungal Identification"

[25] The morphological characteristics of the isolated strain are similar to those of M.fructicola.

[0109] 2.1.2 ITS sequence amplification and phylogenetic analysis

[0110] The ITS sequence length of the isolated strain was 516 bp. The BLAST analysis results showed that the isolated strain M-1 (GenBank accession number: PP526970) had a similarity of more than 99% with the American-Australian type Monilinia fructicola in the NCBI database. The strain M-1 was compared with sequences with higher homology to construct a phylogenetic tree. The phylogenetic tree analysis results based on the ITS sequence showed that the strain M-1 and the American-Australian type Monilinia fructicola belonged to the same branch of the phylogenetic tree. This indicated that the pathogen of peach brown rot in this test material was M. fructicola.

[0111] 2.1.3 Pathogenicity test of pathogens

[0112] After M-1 was inoculated on healthy peach fruits, the inoculated area began to become diseased 2 days later, and small round water-like spots appeared near the inoculated area ( Figure 3 Middle B), 3 days later, the ulcerated spots at the inoculation site expanded rapidly and conidiophores appeared ( Figure 3 C and D), one side of the fruit was completely rotten at 5 days, and a large number of conidia appeared on the surface of the fruit ( Figure 3Middle E). The symptoms were consistent with those under natural conditions and none of the controls were sick.

[0113] 2.2 Biocontrol effects and identification of antagonistic yeast

[0114] 2.2.1 Biocontrol effect of antagonistic yeast on peach brown rot pathogen

[0115] Five strains with good inhibitory effects on M. fructicola were selected from the antagonistic yeast isolated from peach orchards. Among them, three yeast strains had an inhibition rate of more than 50.00% against the American and Australian type of drupe chain sclerotinia, and the antagonistic yeast HYQ-4.1 had the best antagonistic effect on brown rot fungi, with an inhibition rate of (78.31±0.93%) (Table 1). The plate confrontation results of HYQ-4.1 against M. fructicola are shown in the figure below. Figure 4 .

[0116] Table 1 Inhibitory effect of antagonistic yeast on peach brown rot pathogen

[0117]

[0118] Note: Different letters represent significant differences between values, P ≤ 0.05.

[0119] 2.2.2 Determination of the protective effect of HYQ-4.1 in vitro fruit

[0120] The effect of W.anomalus on reducing peach brown rot is as follows Figure 5 After 5 days of cultivation, the rot rate of peach fruit control group reached 86.33%, which was significantly higher than that of W.anomalus ( Figure 5 In contrast, peach fruit infected with 1×10 9 The control effect of W.anomalus at a concentration of 1×10 / mL on brown rot was the best, reaching 23.33%, followed by 1×10 8 The control effect of W.anomalus at a concentration of 1×10 9 There was no significant difference between the concentrations of 100 / mL and 26.67%. In addition, W. anomalus significantly reduced the diameter of the lesions of brown rot fungi in peach fruits in a concentration-dependent manner ( Figure 5 In B), W. anomalus was exposed to high concentration (1×10 8 and 1×10 9 / mL) showed effective inhibition of peach brown rot fungus.

[0121] 2.2.3 Morphological identification and physiological and biochemical characteristics of HYQ-4.1 strain

[0122] After two days of cultivation on NYDA medium, colony HYQ-4.1 was found to be milky white, round, with radial protrusions on the surface, sticky in texture and aromatic ( Figure 6 A). Observing the strain under a microscope, it was found that its cells were oval and elliptical ( Figure 6 (B) According to Liu X et al.

[26] Regarding the characterization of W. anomalus, it was found that the physiological and biochemical characteristics of the antagonistic yeast were consistent with those of W. anomalus (Table 2).

[0123] Table 2 Physiological and biochemical characteristics of antagonistic yeast HYQ-4.1

[0124]

[0125] Note: “+” indicates positive, “-” indicates negative.

[0126] 2.2.4 Molecular identification of HYQ-4.1 strain

[0127] The isolated strain was 589 bp. BLAST analysis in the NCBI database showed that strain HYQ-4.1 and abnormal Wickerham yeast belonged to closely related species, with a homology of more than 99%. The phylogenetic tree was constructed using MEGA5.0 software. The results showed that combined with the morphological identification results, strain HYQ-4.1 was identified as abnormal Wickerham yeast (Wickerhamomycesanomalus) ( Figure 7 ).

[0128] 2.3 Effect of strain HYQ-4.1 on the activities of antioxidant enzymes in peach

[0129] Changes in antioxidant enzyme activities in peach fruits after W.anomalus treatment Figure 8 As shown. The POD activity of peaches treated with W.anomalus was generally higher than that of the control group ( Figure 8 In A), the POD activity of both groups increased first, then decreased, and then increased again. The POD activity of the treatment group was the highest on the 2nd day and increased on the 5th day, while the POD activity of the control group was the highest on the 3rd day and increased on the 6th day.

[0130] like Figure 8 As shown in B, the PPO activity of peach fruits treated with W.anomalus first increased and then decreased, while the PPO activity of the control group was relatively stable overall. The enzyme activity of peach fruits treated with W.anomalus and the control gradually increased and reached a peak after 5 days. PPO activity decreased slightly in the following two days. However, during the entire storage period, the PPO enzyme activity of peach fruits treated with W.anomalus increased significantly compared with the control. The maximum PPO activity of peaches treated with W.anomalus was 1.45 times that of the control.

[0131] The change trend of GLU activity in peach fruits treated with W.anomalus was consistent with that in the control group. Both enzyme activities reached their peak after 3 days. However, in the early stage of storage, the former was higher than the latter, especially at 3 days of storage, the GLU activity of peach fruits treated with W.anomalus was 1.12 times that of the control. After 5 days, the latter was higher than the former ( Figure 8 Middle C).

[0132] Except for 0 and 1 days, the PAL activity of peach treated with W. anomalus was significantly higher than that of the control group ( Figure 8 (D) The PAL activity of both the treatment group and the control group reached the maximum on the 4th day. At this time, the PAL activity of W. anomalus treatment was 103.71 U / g FW, 52% higher than that of the control group.

[0133] References

[0134]

[14] Cao Xuan, Zheng Xiaodong. Transcriptomic differences analysis of Pichia pastoris under salt stress[J]. Journal of Zhejiang University (Agriculture and Life Sciences), 2020, 46(04): 400-406.

[0135]

[15] Zhang Y, Nan M, Xue H. Isolating, Identifying, and Analyzing the Biological Characteristics of Pathogens Causing Postharvest Disease in Fresh Radix Astragali [J]. Horticulturae, 2023, 9(9): 1019-1038.

[0136]

[16] Wei Jingchao. Handbook of Fungal Identification[M]. Shanghai: Shanghai Science and Technology Press, 1979.

[0137] Wei JC.Handbook of fungal identification[M].Shanghai:ShanghaiScientific&Technical Press,1979.

[0138]

[17] Jiang Jingjing, Zhou Zhaoxu, Du Hui, Lü Zhaolong, Wang Chunming, Guo Jianguo, Zhang Xinrui, Li Jiping. Isolation and identification of the pathogen of apple brown rot in some areas of Gansu and screening of antagonistic bacteria[J]. Biotechnology Bulletin, 2023, 39(10): 209-218.

[0139]

[18] Zhang X, Wu F, Gu N, Yan

[0140]

[19] Shen Ping, Fan Xiurong, Li Guangwu. Microbiology Experiment[M]. Beijing: Higher Education Press, 1999.

[0141]

[20] Barnett JA, Payne RW, Yarrow D. Manual of Characteristics and Identification of Yeasts[M]. Translated by Hu Ruiqing, Qingdao: Qingdao Ocean University Press, 1991: 60-117.

[0142]

[21] Jinwei X, Lina Z, Yueheng B, Bai Yueheng, Rouling L, Guillaume LN N, Solairaj D; Bo L, Xiangyu G, Zhang grapes[J].BiologicalControl,2022,169:104900.

[0143]

[22] YanY,Zhang

[0144]

[23] Saeid KJ, Mohammad K, Mansur G, Onofrio P, Enrico L. Influence of theerineum strain of Colomerus vitis (Acari: Eriophyidae) on grape (Vitis vinifera) defense mechanisms. [J]. Experimental applied acarology, 2018, 75(1):1-24.

[0145]

[24] Zhou Fang. Study on the population structure and pathogenicity of brown rot fungi in Shanxi Province[D]. Shanxi Agricultural University, 2015.

[0146]

[25] Liu

[0147]

[26] Zhu Xiaoqiong, Duan Weijun, Hu Mengjun, et al. Research progress on pathogens of brown rot of drupes and pome fruits[J]. Journal of Mycology, 2022, 41(03): 331-348.

[0148] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Wickerhamomyces anomalus strain HYQ-4.1, characterized in that The deposit number is CGMCC No.30543.

2. A biocontrol agent, characterized in that: The active ingredient comprises the abnormal Wickham yeast strain HYQ-4.1 of claim 1 or the fermentation broth of the abnormal Wickham yeast strain HYQ-4.

1.

3. The biocontrol agent according to claim 2, characterized in that: The effective live bacterial concentration of the abnormal Wickham yeast strain HYQ-4.1 is ≥1×10 8 cells / mL or g.

4. The biocontrol agent according to claim 2 or 3, characterized in that: The biocontrol agent includes powder and / or aqueous solution.

5. Use of the abnormal Wickham yeast strain HYQ-4.1 according to claim 1 or the biocontrol agent according to any one of claims 2 to 4 in preventing and controlling peach brown rot.

6. The use according to claim 5, characterized in that: The pathogens of peach brown rot include Monilinia fructicola.

7. The use according to claim 5, characterized in that: The method for preventing and controlling peach brown rot includes improving the activity of stress-resistant enzymes in peach fruits.

8. The use according to claim 7, characterized in that: The peach fruit stress resistance enzymes include at least one of the following: phenylalanine ammonia lyase, peroxidase, polyphenol oxidase and glucosidase.

9. Use of the abnormal Wickham yeast strain HYQ-4.1 according to claim 1 in preparing an antibacterial agent for Sclerotinia sclerotiorum and / or inhibiting the plant pathogen Sclerotinia sclerotiorum.

10. The use according to any one of claims 5 to 9, characterized in that: The applied concentration of the abnormal Wickham yeast strain HYQ-4.1 is ≥1×10 5 cells / mL.

Images