QPCR (quantitative polymerase chain reaction) kit for detecting mycoplasma pollution

Abstract

The invention relates to the technical field of biology, in particular to a qPCR (quantitative polymerase chain reaction) kit for detecting mycoplasma pollution. The qPCR kit comprises a PCR reaction solution 1, a PCR reaction solution 2, a positive quality control product and a negative quality control product, the PCR reaction solution 1 comprises upstream and downstream degenerate primers for amplifying 16s DNA of mycoplasma, a 16s conserved probe, an 18s DNA internal control primer and probe, a PCR reaction buffer solution, dNTPs and an enzyme mixed solution. The kit disclosed by the invention is high in mycoplasma type coverage degree and detection sensitivity; internal quality control is added to monitor whether an inhibitor exists in a reaction system or not, so that false negative is avoided, and the accuracy is improved; the spatial conformation of the bifunctional enzyme is stabilized by adding an enzyme protection solution, the activity of the bifunctional enzyme is enhanced, and the amplification efficiency is high; the detection is rapid, and the whole detection process is completed within 50 minutes; and freezing and repeated freezing and thawing are not needed, so that the use convenience of a user is improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a qPCR kit for detecting mycoplasma contamination. Background Art

[0002] Mycoplasma is a type of prokaryotic organism that is 0.1 to 0.3 microns in size and has no cell wall. It is highly polymorphic and can easily pass through the filter membrane and escape the sterilization filtration step of the culture medium. Mycoplasma contamination is currently the most common prokaryotic contamination of laboratory cells. Mycoplasma contamination can affect various cell characteristics such as cell morphology, function, metabolism, cell membrane, growth rate, induce chromosome aberration, and intracellular signal transduction. Due to the huge impact on the results of cell culture experiments, regulations require that "no mycoplasma contamination must be ensured" for the process of biological products involving cell culture.

[0003] When cells contaminated with mycoplasma are cultured, the pH value of the culture medium will not change, nor will it become turbid, making it difficult to directly observe whether the cells are contaminated. Traditional culture methods and indicator cell methods have long detection cycles or sensitivity issues, which lengthens the production or product release cycle of enterprises, and require conditional release of cell raw materials based on risk assessment or the need for a rapid and efficient alternative method for mycoplasma detection.

[0004] Currently European Pharmacopoeia (EP) <2.6.7>, Japanese Pharmacopoeia (JP) and United States Pharmacopoeia (USP) <63> Nucleic acid methods have been included as mycoplasma detection methods. Some nucleic acid-based mycoplasma detection kits have also appeared on the market, but the detection reagents are all stored at -20°C freezing conditions. The reagents need to be thawed when used, which is inconvenient to operate. Multiple freeze-thaw cycles have a certain impact on the detection performance of the reagents. Moreover, the frozen reagents have high requirements for transportation conditions, which further increases the detection cost. On the other hand, the existing PCR mycoplasma detection also has some performance problems. For example, some kits involve opening the lid, which poses a greater risk of contamination. The primer probes are not well designed, and the detection sensitivity and specificity are insufficient, making it difficult to fully cover the common types of contaminating mycoplasmas.

[0005] Therefore, providing a qPCR kit for detecting mycoplasma contamination has important practical significance. Summary of the invention

[0006] In view of this, the present invention provides a qPCR kit for conveniently, rapidly and efficiently detecting mycoplasma contamination in cell culture.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a primer probe set, wherein the primer probe set comprises a target primer set and a target probe:

[0009] (I), the upstream primer of the target primer set has a nucleotide sequence as shown in SEQ ID No.1;

[0010] (II), the downstream primer of the target primer set has a nucleotide sequence as shown in SEQ ID No. 2; and

[0011] (III), the target probe has a nucleotide sequence as shown in SEQ ID No. 3; or

[0012] (V) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (IV) but different from the nucleotide sequence shown in any one of (I) to (IV) due to the degeneracy of the genetic code; or

[0013] (VI), a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (V), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV); or

[0014] (VII) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of any one of (I) to (VI).

[0015] In some specific embodiments of the present invention, the primer probe set further includes an internal control primer set and an internal control probe:

[0016] (I), the upstream primer of the internal control primer set has a nucleotide sequence as shown in SEQ ID No.4;

[0017] (II), the downstream primer of the internal control primer set has a nucleotide sequence as shown in SEQ ID No.5; and

[0018] (III), the internal control probe has a nucleotide sequence as shown in SEQ ID No.6; or

[0019] (V) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (IV) but different from the nucleotide sequence shown in any one of (I) to (IV) due to the degeneracy of the genetic code; or

[0020] (VI), a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (V), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV); or

[0021] (VII) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of any one of (I) to (VI).

[0022] In a second aspect, the present invention also provides the use of the primer probe set in preparing a qPCR kit for detecting mycoplasma contamination.

[0023] In a third aspect, the present invention also provides a qPCR kit for detecting mycoplasma contamination, comprising the primer probe set.

[0024] In some specific embodiments of the present invention, the qPCR kit includes qPCR reaction solution 1, qPCR reaction solution 2, a positive quality control product, and a negative quality control product;

[0025] The qPCR reaction solution 1 includes a PCR enhancer, a reaction buffer, the target primer set, the target probe for detecting 16s, two internal control primer sets for detecting DNA internal controls, one internal control probe for detecting DNA internal controls, a bifunctional DNA polymerase, UNG enzyme, dATP, dGTP, dCTP, dUTP, and 0.1% sodium azide;

[0026] The qPCR reaction solution 2 contains 1-3 mM Mn(OAc)2 and 0.1% sodium azide.

[0027] In some specific embodiments of the present invention, the qPCR enhancer comprises 1% to 10% DMSO, 200 to 500 mM betaine, 0.01% to 0.05% Tween 20 and 1% to 10% glycerol; and / or

[0028] The reaction buffer included 50 mM Tricine and 100 mM potassium acetate.

[0029] In some specific embodiments of the present invention, the primer concentration in the target primer set is 0.3-0.9 μM, and the concentration of the target probe is 0.15-0.45 μM; and / or

[0030] The primer concentration in the internal control primer set is 0.3-0.9 μM, and the concentration of the internal control probe is 0.15-0.45 μM; and / or

[0031] The bifunctional DNA polymerase includes rTth DNA polymerase, and the content of the rTth DNA polymerase is 5-15U.

[0032] In a fourth aspect, the present invention also provides the use of the qPCR kit in detecting mycoplasma contamination.

[0033] In a fifth aspect, the present invention also provides a method for detecting mycoplasma contamination, obtaining DNA of a sample to be tested, and performing any of the following tests;

[0034] (I), the primer probe set; or

[0035] (II), the qPCR kit.

[0036] In some specific embodiments of the present invention, the method comprises the following steps:

[0037] Step 1: Sample preparation: Extract DNA from positive quality control, negative quality control and samples to be tested;

[0038] Step 2: Polymerase chain reaction:

[0039] Take 80 μl reaction system as an example: PCR reaction solution 1 20 μl, PCR reaction solution 2 10 μl, template DNA 40-60 μl, and perform fluorescence quantitative PCR reaction under the following conditions: 50℃ 2min, 94℃ 2min, 94℃ 5s, 56℃ 20s for 45 cycles, 40℃ 10s;

[0040] Step 3: Result judgment:

[0041] Negative control: If the FAM channel has No Ct, the test result is valid, otherwise the experiment is considered invalid.

[0042] Positive quality control product: FAM channel Ct value should be ≤35;

[0043] Confirm that the above requirements are met, read the sample Ct value, and if the FAM channel Ct ≤ 35 and there is an obvious amplification curve, it is judged as positive.

[0044] The present invention constructs a qPCR kit for rapid and efficient detection of mycoplasma contamination that can be stored at 2-8°C. It has a wide coverage, including the six most common mycoplasma types of laboratory contamination: fermentative mycoplasma, arginine mycoplasma, oral mycoplasma, salivarius, hyorhinis mycoplasma, acholesteroloma reinhardtii and more than 90 other mycoplasmas.

[0045] The qPCR kit for rapid detection of mycoplasma contamination stored at 2-8°C of the present invention comprises:

[0046] 1. Extraction of negative quality control products, positive quality control products, cells or cell culture supernatant samples;

[0047] 2. Polymerase chain reaction: prepare the reaction system in a 200μl PCR tube: 20μl PCR reaction solution 1, 10μl PCR reaction solution 2, and 40-60μl sample. Perform fluorescent quantitative PCR reaction in the above reaction tube under the following conditions: 50℃ for 2min, 94℃ for 2min, 45 cycles of 94℃ for 5s and 56℃ for 20s, and 40℃ for 10s.

[0048] The present invention adopts the above technical solution, which has the following advantages compared with the prior art:

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] 1. The kit product of the present invention designs specific degenerate primers and probes according to the conservative regions of fermentation, porcine nose, oral cavity, arginine, and salivarius 16S rDNA (LR214939.1, LC158832.1, CP035041.1, NR_043199.1, and NR_044666.2 mycoplasma sequences). The reporter fluorescence for detecting mycoplasma DNA is labeled with FAM, and the reporter fluorescence for detecting the internal control gene is labeled with ROX. Through Primer-BLAST statistics, a variety of mycoplasmas (including common mycoplasma types in the laboratory) can be detected, and the coverage of mycoplasma detection types is higher than that of existing methods.

[0051] 2. The kit of the present invention has been optimized, and its amplification height is superior to that of mainstream manufacturers in the market, and the amplification sensitivity reaches 5CFU / ml.

[0052] 3. The present invention simultaneously designs eukaryotic cell 18s DNA as an internal control gene to monitor whether there are inhibitors in the reaction system to avoid false negatives;

[0053] 4. The kit product of the present invention can be stored at 2-8°C to avoid repeated freezing and thawing, and is easy to transport and use; the qPCR reaction time is shortened to 50 minutes, which can realize the rapid detection of mycoplasma contamination in the cell culture process. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0055] Figure 1 The standard curve prepared in Example 4 is shown. DETAILED DESCRIPTION

[0056] The present invention discloses a qPCR kit for detecting mycoplasma contamination. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0057] The present invention overcomes the shortcomings of existing mycoplasma detection technology and provides a qPCR kit for convenient, rapid and efficient detection of mycoplasma contamination in cell culture.

[0058] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0059] Provided is a qPCR kit for rapid detection of mycoplasma contamination stored at 2-8°C, comprising qPCR reaction solution 1, qPCR reaction solution 2, a positive quality control product and a negative quality control product.

[0060] The qPCR reaction solution 1 includes a PCR enhancer, a reaction buffer, a mycoplasma degenerate primer, a mycoplasma 16s specific conservative probe, a DNA internal control specific primer, a DNA internal control specific probe, a bifunctional DNA polymerase, a UNG enzyme, dATP, dGTP, dCTP, dUTP, and 0.1% sodium azide.

[0061] The qPCR enhancer is a mixture of 1%-10% DMSO, 200-500 mM betaine, 0.01%-0.05% Tween 20 and 1%-10% glycerol. The reaction buffer is composed of 50 mM Tricine and 100 mM potassium acetate.

[0062] The mycoplasma primer probe base sequences are:

[0063] Target primer 1: 5'-GGTTCTMCGCGTATCTTCAAATT-3', (as shown in SEQ ID NO. 1);

[0064] Target primer 2: 5'-TCCGCCTGAGTAGTAYGYTCGC-3', (as shown in SEQ ID NO. 2);

[0065] Target probe 1: FAM-CACATGCTCCACCGCTTGTGCG-BHQ1, (as shown in SEQ ID NO. 3);

[0066] The base sequences of the two specific primers and probes for detecting the internal control of DNA are:

[0067] Internal control primer 3: 5'-AGCGGATAACAATTTCACACAGGA-3', (as shown in SEQ ID NO. 4);

[0068] Internal control primer 4: 5'-CCAGTATGGAACCACGCTATGT-3', (as shown in SEQ ID NO. 5);

[0069] Internal control probe 2: ROX-TCGGGTTTCCGTCTTGCTCGTATCGC–BHQ2, (as shown in SEQ ID NO. 6).

[0070] The bifunctional DNA polymerase is rTth DNA polymerase, and its content is 5-15U.

[0071] The qPCR reaction solution 2 contains 1-3 mM Mn(OAc)2 and 0.1% sodium azide.

[0072] The qPCR kit for rapid detection of mycoplasma contamination stored at 2-8°C of the present invention comprises:

[0073] 1. Extraction of negative quality control products, positive quality control products, cells or cell culture supernatant samples;

[0074] 2. Polymerase chain reaction: prepare the reaction system in a 200μl PCR tube: 20μl PCR reaction solution 1, 10μl PCR reaction solution 2, and 40-60μl sample. Perform fluorescent quantitative PCR reaction in the above reaction tube under the following conditions: 50℃ for 2min, 94℃ for 2min, 45 cycles of 94℃ for 5s and 56℃ for 20s, and 40℃ for 10s.

[0075] The raw materials and reagents used in the qPCR kit for detecting mycoplasma contamination provided by the present invention can all be purchased from the market.

[0076] The present invention will be further described below in conjunction with embodiments:

[0077] Example 1 Composition of this kit

[0078] 20ul qPCR reaction solution 1: 5% DMSO, 250mM betaine, 0.05% Tween20, 5% glycerol, 50mM tris(hydroxymethyl)methylglycine (pH8.3), 100mM potassium acetate, 0.5uM target primer 1, 0.5uM target primer 2, 0.3uM internal control primer 3, 0.3uM internal control primer 4, 0.25uM target probe 1, 0.15uM internal control probe 2, 10U rTth DNA polymerase (5U / ul), 0.5U UNG enzyme (1U / ul), 0.2mM dATP, 0.2mM dGTP, 0.2mM dCTP, 0.4mM dUTP, 0.1% sodium azide;

[0079] The 4 specific primers and 2 specific probes are:

[0080] Target primer 1: 5'-GGTTCTMCGCGTATCTTCAAATT-3' (as shown in SEQ ID No. 1);

[0081] Target primer 2: 5'-TCCGCCTGAGTAGTAYGYTCGC-3' (as shown in SEQ ID No. 2);

[0082] Target probe 1: FAM-CACATGCTCCACCGCTTGTGCG-BHQ1 (as shown in SEQ ID No. 3);

[0083] Internal control primer 3: 5'-AGCGGATAACAATTTCACACAGGA-3' (as shown in SEQ ID No. 4);

[0084] Internal control primer 4: 5'-CCAGTATGGAACCACGCTATGT-3' (as shown in SEQ ID No. 5);

[0085] Internal control probe 2: ROX-TCGGGTTTCCGTCTTGCTCGTATCGC-BHQ2 (as shown in SEQ ID No. 6).

[0086] Control group: During the primer-probe screening process, another set of primer-probes targeting the target:

[0087] Target primer 3: TTGCGCTCGTTGCAGGACT, as shown in SEQ ID No. 7;

[0088] Target primer 4: GGAGAACCTTACCCACTCTTGACATC, as shown in SEQ ID No. 8;

[0089] Target probe 2: CGACACGAGCTGACGACAACCATG, as shown in SEQ ID No. 9;

[0090] The amplification performance was good, but there was a phenomenon of negative tailing in amplification, so this combination was abandoned.

[0091] 10ulqPCR reaction solution 2 consisted of 1.5mM Mn(OAc)2 and 0.1% sodium azide.

[0092] Negative control was Gibco TM DMEM cell culture medium; the positive control is a plasmid containing the mycoplasma target fragment.

[0093] Positive control plasmid sequence (as shown in SEQ ID No.10)

[0094] ATGATCCGCCTGAGTAGTATGCTCGCAAGAGTGAAACTTAAAGGAATTGACGGGAACCCGCACAAGCGGTGGAGCATGTGGTTTAATTTGAAGATACGCGTAGAACCTTACCCACTCTTGACATCTTCTGCAAAGCTATAGAGATATAGTGGAGGTTAAC AGAATGACAGATGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTAGGTTAAGTCCTGCAACGAGCGCAACCCTTTTCTTTAGTTACTAATATTAAGTTAAGGACTCTAGAGATACTGCCTGGGTAACCAGGAGGAAGGTGGGGACGACGTCAAAT

[0095] Example 2 Mycoplasma nucleic acid extraction

[0096] In this embodiment, when extracting and purifying mycoplasma nucleic acid in the sample, cells or cell culture supernatant routinely cultured in the laboratory were used, and the nucleic acid extraction and purification reagent (magnetic bead method) of Zhengzhou Antu Biotechnology Co., Ltd. (Antu Biotechnology, Henan Zhengxiebei No. 20180037) was used. The specific operation method was carried out according to the instructions.

[0097] Example 3 Construction of reaction system

[0098] 1 Calculate the number of samples required and increase the amount of reagents in proportion to the amount in the table below. Only one positive control and one negative control should be prepared.

[0099] Table 1

[0100]

[0101] 2. Machine testing

[0102] The test was directly performed on a fluorescent quantitative PCR instrument, and the amplification program was set to 50°C for 2 min, 94°C for 2 min, 94°C for 5 s, 56°C for 20 s for 45 cycles, and 40°C for 10 s; FAM and ROX fluorescence were collected after each cycle.

[0103] 3. Quality Control

[0104] Each batch of tests should include a positive quality control and a negative quality control. The Ct value of the FAM channel of the positive quality control should be ≤35, and the negative quality control: FAM channel No Ct, then the test result is valid, otherwise the experiment is considered invalid.

[0105] 4. Interpretation of results

[0106] Confirm that this experiment meets the requirements of the above-mentioned "quality control" and read the sample Ct value. If the FAM channel Ct is ≤35 and there is an obvious amplification curve, it is judged as positive.

[0107] Example 4 Standard Curve Drawing

[0108] Take 10^8 copies / ul of the positive plasmid and make a 10-fold gradient dilution. Use the diluted DNA as a template and prepare the qPCR reaction system according to the reaction system preparation method of Example 3 to perform the qPCR reaction. After the reaction program is completed, draw a standard curve, such as Figure 1 shown.

[0109] The results show that the amplification curve R2 is 0.9984, and the amplification efficiency is 95%, which meets the qPCR requirements. Example 5 Cross-validation

[0110] Common laboratory cell culture types such as NS0, CHO, and 293 cells were extracted and validated by qPCR. The results showed no Ct value, indicating that the kit would not non-specifically amplify the genome of cultured cells.

[0111] Table 2

[0112]

[0113] Example 6 Sensitivity Verification

[0114] Buy The standard product of Mycoplasma hyorhinis was 10 cfu / ml, which was diluted once and then amplified by the kit of the present invention. All 20 samples were detected, and the average ct value was 33.6. The kit of the present invention can stably detect the mycoplasma sample of 5 cfu / ml.

[0115] Table 3

[0116]

[0117]

[0118] Example 7 Mycoplasma Detection Application

[0119] 7.1 The laboratory had four tumor cell lines. After resuscitation and culture, the culture supernatant was taken for extraction and amplification verification. It was found that MCF-7, NCI-N87, and MDA-MB-453 were all contaminated with mycoplasma and needed to be treated.

[0120] Table 4

[0121] Sampling location / channel FAM Rox Negative control No Ct No Ct Positive Control 22.58 No Ct MCF-7 18.22 25.23 NCI-N87 20.31 28.65 MDA-MB-453 22.4 27.73 CFPAC-1 No Ct 26.76

[0122] 7.2 The contaminated MCF-7 cell culture supernatant was diluted 100 times for extraction, and a parallel comparison was performed using the self-built kit and the commercially available kit. The results showed that the amplification Ct and net amplification signal values ​​of the self-built kit were significantly higher than those of the commercially available kit.

[0123] Table 5

[0124]

[0125] Example 8 Detection of Kit Stability

[0126] The kit of the present invention adopts the aptamer-modified rTth enzyme and optimizes the PCR mix, so that it can be stored at 2-8°C for a long time, and the convenience of use is greatly improved.

[0127] 8.1 The mycoplasma nucleic acid detection reagent accelerated at 37°C for 7, 14, and 21 days was tested by using the kit prepared in Example 1 and the detection methods of Examples 2 and 3. The test sample was the supernatant of MCF-7 cell culture frozen at -20°C, diluted 100 times for extraction; accelerated for 21 days, the Ct value deviation was <1.

[0128] Table 6

[0129] Acceleration time (days) Target 0 24.30 7 24.42 14 24.62 21 24.79

[0130] 8.2 The mycoplasma nucleic acid detection reagent placed at 4°C for 1, 3, 6, and 12 months was tested by using the kit prepared in Example 1 and the detection methods of Examples 2 and 3. The test sample was the supernatant of MCF-7 cell culture stored at -20°C, which was diluted 100 times and extracted. After being placed at 4°C for 1 year, the deviation of the detection Ct value was less than 1, and the mycoplasma positive samples could be stably detected, indicating that the reagent can be placed at 2-8°C for a long time.

[0131] Table 7

[0132] Real time (month) Target 0 24.30 1 24.27 3 24.52 6 24.61 12 24.57

[0133] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer probe set, characterized in that: The primer probe set includes a target primer set and a target probe: (I), the upstream primer of the target primer set has a nucleotide sequence as shown in SEQ ID No.1; (II), the downstream primer of the target primer set has a nucleotide sequence as shown in SEQ ID No. 2; and (III), the target probe has a nucleotide sequence as shown in SEQ ID No. 3; or (V) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (IV) but different from the nucleotide sequence shown in any one of (I) to (IV) due to the degeneracy of the genetic code; or (VI), a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (V), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV); or (VII) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of any one of (I) to (VI).

2. The primer probe set according to claim 1, characterized in that: The primer probe set also includes an internal control primer set and an internal control probe: (I), the upstream primer of the internal control primer set has a nucleotide sequence as shown in SEQ ID No.4; (II), the downstream primer of the internal control primer set has a nucleotide sequence as shown in SEQ ID No.5; and (III), the internal control probe has a nucleotide sequence as shown in SEQ ID No.6; or (V) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (IV) but different from the nucleotide sequence shown in any one of (I) to (IV) due to the degeneracy of the genetic code; or (VI), a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (V), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV); or (VII) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of any one of (I) to (VI).

3. Use of the primer probe set as claimed in claim 1 or 2 in the preparation of a qPCR kit for detecting mycoplasma contamination.

4. A qPCR kit for detecting mycoplasma contamination, characterized in that: Comprising the primer probe set as described in claim 1 or 2.

5. The qPCR kit according to claim 4, characterized in that The qPCR kit includes qPCR reaction solution 1, qPCR reaction solution 2, positive quality control product, and negative quality control product; The qPCR reaction solution 1 includes a PCR enhancer, a reaction buffer, the target primer set, the target probe for detecting 16s, two internal control primer sets for detecting DNA internal controls, one internal control probe for detecting DNA internal controls, a bifunctional DNA polymerase, UNG enzyme, dATP, dGTP, dCTP, dUTP, and 0.1% sodium azide; The qPCR reaction solution 2 contains 1-3 mM Mn(OAc)2 and 0.1% sodium azide.

6. The qPCR kit according to claim 5, characterized in that The qPCR enhancer comprises 1% to 10% DMSO, 200 to 500 mM betaine, 0.01% to 0.05% Tween 20 and 1% to 10% glycerol; and / or The reaction buffer included 50 mM Tricine and 100 mM potassium acetate.

7. The qPCR kit according to claim 5 or 6, characterized in that: The primer concentration in the target primer set is 0.3-0.9 μM, and the concentration of the target probe is 0.15-0.45 μM; and / or The primer concentration in the internal control primer set is 0.3-0.9 μM, and the concentration of the internal control probe is 0.15-0.45 μM; and / or The bifunctional DNA polymerase includes rTth DNA polymerase, and the content of the rTth DNA polymerase is 5-15U.

8. Use of the qPCR kit according to any one of claims 4 to 7 in detecting mycoplasma contamination.

9. Method for detecting mycoplasma contamination: obtain DNA of the sample to be tested and perform any of the following tests; (I), a primer probe set as described in claim 1 or 2; or (II) The qPCR kit according to any one of claims 4 to 7.

10. The method according to claim 9, characterized in that The following steps are involved: Step 1: Sample preparation: Extract DNA from positive quality control, negative quality control and samples to be tested; Step 2: Polymerase chain reaction: Take 80 μl reaction system as an example: PCR reaction solution 1 20 μl, PCR reaction solution 2 10 μl, template DNA 40-60 μl, and perform fluorescence quantitative PCR reaction under the following conditions: 50℃ 2min, 94℃ 2min, 94℃ 5s, 56℃ 20s for 45 cycles, 40℃ 10s; Step 3: Result judgment: Negative control: If the FAM channel has No Ct, the test result is valid, otherwise the experiment is considered invalid. Positive quality control product: FAM channel Ct value should be ≤35; Confirm that the above requirements are met, read the sample Ct value, and if the FAM channel Ct ≤ 35 and there is an obvious amplification curve, it is judged as positive.

Images