Antisense oligonucleotide of IL-17AmRNA as well as application and medicinal composition of antisense oligonucleotide

Abstract

The invention provides antisense oligonucleotide of IL-17A mRNA (messenger Ribonucleic Acid) as well as application and a medicinal composition of the antisense oligonucleotide, and relates to the technical field of biological medicines. The nucleotide sequence of the antisense oligonucleotide of the IL-17A mRNA provided by the invention is as shown in SEQ ID NO.1, 3, 5 to 18, 20 to 23, 26 to 28 or 31. The antisense oligonucleotide can be specifically combined with IL-17A mRNA, RNase H is recruited after the antisense oligonucleotide is combined with the IL-17A mRNA, then degradation of the IL-17A mRNA is achieved, synthesis of IL-17A protein is prevented, and the antisense oligonucleotide can be used for preparing drugs for treating IL-17A related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an antisense oligonucleotide of IL-17A mRNA and an application and a pharmaceutical composition thereof. Background Art

[0002] Interleukin 17 (IL-17) is an important cytokine with multiple roles in mucosal immunity and is a major pathological cytokine and therapeutic target in many autoimmune, inflammatory diseases and cancers. The IL-17 family is mainly composed of six structurally related cytokines: IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (IL-25) and IL-17F. Among the six members, IL-17A was the first to be discovered and is the most important and most studied cytokine in the IL-17 family.

[0003] Dry eye disease (DED) is a common multifactorial disease of the ocular surface, with the main clinical symptoms of eye pain, light sensitivity, dryness, irritation, and fluctuating or blurred vision. Dry eye disease affects millions of patients worldwide, with a prevalence of 5%-50%, which increases with age, greatly affecting the patients' work and quality of life. Uncontrolled severe DED can lead to corneal ulcers and scarring, resulting in vision loss. Disruption of tear film homeostasis caused by multiple factors can lead to increased tear osmotic pressure, which in turn leads to corneal and conjunctival damage, ultimately promoting the occurrence and development of DED. The TFOSDEWS (Tear Film & Ocular Surface Society) II consensus shows that chronic inflammation plays an important role in this process, and high osmotic stress induces inflammatory damage to the ocular surface, further exacerbating the inflammatory response.

[0004] Several studies have shown that IL-17A plays a vital role in dry eye disease. During the development of dry eye disease in mice, the proportion of CD4+T cells (Th1) and Th17 cells in the draining lymph nodes increased, and the levels of IFN-γ and IL-17A cytokines increased. IL-17A significantly increased the transcription or secretion levels of IL-6, IL-8, and IL-1β in corneal epithelial cells, promoted corneal inflammatory response, and led to corneal barrier damage. The use of IL-17A neutralizing antibodies can significantly alleviate the symptoms of dry eye disease. In addition, in patients with dry eye disease, the significant increase in IL-17A is associated with increased transcription or secretion levels of IL-6, IL-8, and IL-1β in corneal epithelial cells, and the expression levels of these factors are positively correlated with the ocular surface disease index (OSDI), tear breakup time (BUT), and corneal fluorescein staining scores. Further studies have shown that IL-17A not only plays a role in the local inflammatory response of dry eye disease, but may also affect the severity of dry eye disease through systemic immune response. For example, in patients with systemic immune-mediated diseases, serum levels of IL-17A are positively correlated with the severity of dry eye. Inhibition of IL-17A can alleviate the clinical manifestations of dry eye, such as the use of cilomilast, a phosphodiesterase type 4 (PDE4) inhibitor, which can significantly reduce IL-17-related immune responses in experimental dry eye models.

[0005] At present, there are still large unmet clinical needs in the field of dry eye disease, and the main R&D pipeline is still in the clinical stage, focusing on the development of small molecule drugs.

[0006] Nucleic acid drugs are the third largest category of drugs after small molecule drugs and antibody drugs. Compared with traditional small molecule drugs and antibody drugs, they mainly act on the upstream of protein synthesis and regulate after gene transcription and before protein translation. Nucleic acid drugs have the advantages of clear targets, simple design, short R&D cycle, strong specificity, wide application range and long-term effect. Chemically modified antisense oligonucleotide (ASO) drugs have certain in vivo stability, high specificity, can address targets that traditional small molecule drugs and biological drugs cannot reach, and can reduce systemic drug toxicity. The efficacy of local administration is significantly better than that of systemic administration (for example, Nusinersen for the treatment of spinal muscular atrophy, which is administered by intrathecal injection).

[0007] In view of this, the present invention is proposed. Summary of the invention

[0008] The first object of the present invention is to provide an antisense oligonucleotide of IL-17A mRNA to solve the above technical problems.

[0009] The second object of the present invention is to provide applications of the antisense oligonucleotides.

[0010] The third object of the present invention is to provide a pharmaceutical composition.

[0011] In order to achieve the above objectives, the following technical solutions are adopted:

[0012] In a first aspect, the present invention provides an antisense oligonucleotide to IL-17A mRNA, wherein the nucleotide sequence of the antisense oligonucleotide is shown in SEQ ID NO. 1, 3, 5-18, 20-23, 26-28 or 31.

[0013] As a further technical solution, the antisense oligonucleoside includes one or more modified sugars, one or more modified nucleic acid bases or one or more modified internucleoside bonds.

[0014] As a further technical solution, the modified sugar includes a 2'-modified sugar;

[0015] The 2'-modified sugar includes a 2'-O-methoxyethyl modified sugar.

[0016] As a further technical solution, the modified nucleic acid base includes 5-methylcytosine.

[0017] As a further technical solution, the modified internucleoside bond includes a phosphorothioate internucleoside bond.

[0018] As a further technical solution, the antisense oligonucleotide comprises: a gap segment consisting of 10 linked 2' deoxynucleosides, a 5' wing segment consisting of 5 linked nucleosides, and a 3' wing segment consisting of 5 linked nucleosides; the gap segment is positioned between the 5' wing segment and the 3' wing segment;

[0019] The sugar in each nucleotide of the 5'-wing segment is a 2'-O-methoxyethyl modified sugar;

[0020] The sugar in each nucleotide of the 3'-wing segment is a 2'-O-methoxyethyl modified sugar;

[0021] The cytosine in the antisense oligonucleotide is 5-methylcytosine;

[0022] The internucleoside bonds in the antisense oligonucleotide are phosphorothioate internucleoside bonds.

[0023] In a second aspect, the present invention provides the use of the above antisense oligonucleotide in the following a or b:

[0024] a. Knock down the expression level of IL-17A mRNA;

[0025] b. Application in the preparation of drugs for treating IL-17A related diseases.

[0026] As a further technical solution, the IL-17A-related disease includes dry eye.

[0027] In a third aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned antisense oligonucleotide.

[0028] As a further technical solution, a pharmaceutically acceptable carrier is also included.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The antisense oligonucleotides to IL-17A mRNA provided by the present invention can specifically bind to IL-17A mRNA, recruit RNase H after binding, and then achieve the degradation of IL-17A mRNA, prevent the synthesis of IL-17A protein, and can be used to prepare drugs for treating IL-17A related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 The knockdown effect of different antisense oligonucleotides on IL-17A gene in HDF cells;

[0033] Figure 2 To detect the cytotoxicity of antisense oligonucleotides with different sequences;

[0034] Figure 3 The therapeutic effect of SG31-1 in the New Zealand white rabbit dry eye model, where the left picture shows tear secretion, the middle picture shows sodium fluorescein staining, and the right picture shows the statistical graph of sodium fluorescein staining;

[0035] Figure 4 This is the therapeutic effect of SG31-11 in the New Zealand white rabbit dry eye model, where the left picture shows tear secretion, the middle picture shows sodium fluorescein staining, and the right picture shows the statistical graph of sodium fluorescein staining. DETAILED DESCRIPTION

[0036] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0037] In a first aspect, the present invention provides an antisense oligonucleotide to IL-17A mRNA, wherein the nucleotide sequence of the antisense oligonucleotide is shown in SEQ ID NO. 1, 3, 5-18, 20-23, 26-28 or 31.

[0038] Table 1 Antisense oligonucleotide sequences

[0039] Number Sequence SEQ ID NO.1 AGGACCAGGATCTCTTGCTG SEQ ID NO.3 TCATTTCCTATCCTACATAT SEQ ID NO.5 TAAATAACTTAAAGCCCTTA SEQ ID NO.6 GAGAATTATATTAAATCCTT SEQ ID NO.7 ATATAGCTATCTTTCAGTTT SEQ ID NO.8 AATATAGCTATCTTTCAGTT SEQ ID NO.9 CAATATAGCTATCTTTCAGT SEQ ID NO.10 TTATATTAAATCCTTTGTAC SEQ ID NO.11 GGTCCTCATTGCGGCTGCAG SEQ ID NO.12 AAGTTCGTTCTGCCCCATCA SEQ ID NO.13 AGTTCGTTCTGCCCCATCAG SEQ ID NO.14 GTTCGTTCTGCCCCATCAGC SEQ ID NO.15 TTCGTTCTGCCCCATCAGCT SEQ ID NO.16 AGAAATTTTGCACTGCCATT SEQ ID NO.17 GCCAAGTGTTACCTCTGAAG SEQ ID NO.18 CAGAAATTTTGCACTGCCAT SEQ ID NO.20 TCTTACATTTACCTAGGCAG SEQ ID NO.21 CATAATGTTAACACCATGGC SEQ ID NO.22 AATGAGTTTAGTCCGAAATG SEQ ID NO.23 CATCATGTGACACTTCTTGT SEQ ID NO.26 AGCATCATGTGACACTTCTT SEQ ID NO.27 CTACATTTTTCAGATCAGCT SEQ ID NO.28 CCAAGTGTTACCTCTGAAGC SEQ ID NO.31 TACGATGTGAAACTTGAAAC

[0040] The antisense oligonucleotides to IL-17A mRNA provided by the present invention can specifically bind to IL-17A mRNA, recruit RNase H after binding, and then achieve the degradation of IL-17A mRNA, prevent the synthesis of IL-17A protein, and can be used to prepare drugs for treating IL-17A related diseases.

[0041] In some alternative embodiments, the antisense oligonucleoside comprises one or more modified sugars, one or more modified nucleic acid bases or one or more modified internucleoside bonds.

[0042] Antisense oligonucleotides containing modified sugars, modified nucleic acid bases or modified internucleoside bonds have better stability and higher affinity for mRNA.

[0043] In some optional embodiments, the modified sugar includes but is not limited to 2'-modified sugar, or other modified sugars known to those skilled in the art that can improve nucleic acid stability;

[0044] The 2'-modified sugar includes a 2'-O-methoxyethyl modified sugar.

[0045] In some optional embodiments, the modified nucleic acid base includes but is not limited to 5-methylcytosine, or other modified nucleic acid bases known to those skilled in the art that can improve nucleic acid stability.

[0046] In some optional embodiments, the modified internucleoside bonds include but are not limited to phosphorothioate internucleoside bonds, or other modified internucleoside bonds known to those skilled in the art that can improve nucleic acid stability.

[0047] In some optional embodiments, the antisense oligonucleotide comprises: a gap segment consisting of 10 linked 2' deoxynucleosides, a 5' wing segment consisting of 5 linked nucleosides, and a 3' wing segment consisting of 5 linked nucleosides; the gap segment is positioned between the 5' wing segment and the 3' wing segment;

[0048] The sugar in each nucleotide of the 5'-wing segment is a 2'-O-methoxyethyl modified sugar;

[0049] The sugar in each nucleotide of the 3'-wing segment is a 2'-O-methoxyethyl modified sugar;

[0050] The cytosine in the antisense oligonucleotide is 5-methylcytosine;

[0051] The internucleoside bonds in the antisense oligonucleotide are phosphorothioate internucleoside bonds.

[0052] The above modifications to the antisense oligonucleotides can help to improve the stability of the antisense oligonucleotides and their affinity for binding to mRNA.

[0053] In a second aspect, the present invention provides the use of the above antisense oligonucleotide in the following a or b:

[0054] a. Knock down the expression level of IL-17A mRNA;

[0055] b. Application in the preparation of drugs for treating IL-17A related diseases.

[0056] The antisense oligonucleotides to IL-17A mRNA provided by the present invention can specifically bind to IL-17A mRNA, recruit RNase H after binding, and then achieve degradation of IL-17A mRNA, thereby reducing the expression level of IL-17A mRNA. The reduction in the expression level of IL-17A mRNA is helpful to achieve the treatment of related diseases caused by IL-17A mRNA.

[0057] In some optional embodiments, the IL-17A-related diseases include but are not limited to dry eye.

[0058] In a third aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned antisense oligonucleotide.

[0059] The pharmaceutical composition contains the antisense oligonucleotide provided by the present invention, and thus has all the beneficial effects of the antisense oligonucleotide of the present invention.

[0060] In some optional embodiments, a pharmaceutically acceptable carrier is also included.

[0061] "Pharmaceutically acceptable" ingredients are suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity), that is, substances with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents. The term refers to pharmaceutical carriers that are not necessary active ingredients themselves and are not overly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in pharmaceutical compositions may contain liquids such as water, saline, glycerol and sorbitol. In addition, auxiliary substances may also be present in these carriers, such as lubricants, glidants, wetting agents or emulsifiers, pH buffer substances and stabilizers, such as albumin.

[0062] The pharmaceutical composition can be prepared into various dosage forms suitable for administration, including but not limited to injections, eye drops, emulsions, powders, lyophilized powders, capsules, and tablets.

[0063] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0064] It should be noted that in the following reagents, BTT: 5-(Benzylthio)-1H-tetrazole, NMI: N-methylimidazole.

[0065] Example 1 Preparation of MOE-Gapmer antisense oligonucleotides by solid phase technology

[0066] Standard phosphoramidite building blocks and solid supports were used to incorporate nucleoside residues, including T, A, G, and mC residues. Phosphoramidite solutions of each monomer (β-D-2'-deoxyribonucleoside and β-D-2'-(MOE) ribonucleoside) were prepared using acetonitrile as solvent, with a concentration of 0.06M.

[0067] 500nmol synthesis column made of Universal CPG solid support was loaded on LK-48E synthesizer, and the specified sequence was synthesized using phosphoramidite coupling method. For the coupling step, phosphoramidite monomer was delivered in an amount exceeding 4 times the load on the solid support and phosphoramidite condensation was continued for 10min. All other steps were carried out according to the standard protocol supplied by the manufacturer. Dimethoxytrityl (DMT) on nucleotide 5'-hydroxyl was removed using a dichloromethane solution containing 3% trichloroacetic acid. Acetonitrile containing 0.35M BTT and 0.5% NMI was used as an activator during the coupling step. A solvent (1:1 pyridine and acetonitrile) containing 0.2M diphenylacetyl disulfide (PADS) was used for sulfurization treatment, and the contact time was three minutes to introduce thiophosphate linkage.

[0068] After the synthesis of the specified sequence, the solid support-bound specified sequence was suspended in ammonia water (25wt%-30wt%) and heated at 85°C for 2h. The solid support was then filtered off and the ammonia was removed under reduced pressure. The residue was purified by high pressure liquid chromatography to prepare the MOE-Gapmer antisense oligonucleotides shown in Table 1.

[0069] The length of the MOE-Gapmer antisense oligonucleotide in Table 1 is 20 nucleosides and is designed as a 5-10-5 gap body. The gap contains 10 2'-deoxynucleosides and is flanked by wings containing 5 nucleosides on both sides (in the 5' and 3' directions). Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment are 2'-MOE sugar-modified, each nucleoside in the gap is 2'-deoxy sugar-modified, the internucleoside bonds in the entire gap body are phosphorothioate (P=S) bonds, and all cytosine residues in the entire gap body are 5-methylcytosine.

[0070] Example 2 Real-time fluorescence quantitative PCR detection of the effect of antisense oligonucleotides of different sequences on reducing IL-17A gene expression

[0071] The cells used in this experiment are human dermal fibroblasts (HDF). These cells were seeded in a 24-well plate at 1.5 x 10 5Cells were cultured for 24 hours at 37°C and 5% CO2, and then the cells were treated with Trizol (Invitrogen) to extract RNA. The obtained RNA was used as a template and M-MLV reverse transcriptase (Promega) was used to perform reverse transcription to obtain cDNA. Subsequently, cDNA was used as a template and ACTB was used as an internal reference gene to detect the expression of the IL-17A gene by real-time fluorescence quantitative PCR, and the 2^-ΔΔCT method was used for data analysis. Compared with the cell group treated with DEPC water, the knockdown efficiency of oligonucleotides at different concentrations was calculated, and the results are shown in the figure. Figure 1 The results of real-time fluorescence quantitative PCR showed that a total of 31 antisense oligonucleotides were included in this example, of which 21 oligonucleotides significantly inhibited the expression of IL-17A mRNA, with knockdown efficiencies ranging from 20% to 80% (Table 2).

[0072] Table 2 Knockdown efficiency of antisense oligonucleotides in Example 1

[0073]

[0074]

[0075] Example 3 Caspase-Glo 3 / 7 detection of cytotoxicity of antisense oligonucleotides with different sequences

[0076] The antisense nucleotide sequence capable of knocking down IL-17A mRNA expression was transfected into HepG2 cells, and the cytotoxicity was reflected by the content of Caspase 3 / 7. HepG2 cells were seeded in a white opaque 96-well plate, with 3x10 cells per well. 4Cells were transfected with different sequence oligonucleotides into the corresponding wells using Lipofectamine RNAiMax (ThermoFisher) transfection reagent 12 hours later. The final concentration of oligonucleotides was 0.1 μM and 1 μM. The positive control group was transfected with the cEt modified sequence 374 (nucleotide sequence CTGGTGCTGCCTGTAG (SEQ ID NO.32)) known to have a large cytotoxicity. The wells transfected with DEPC water were recorded as 0 μM. Different sequences and different concentrations were repeated 3 times. After continued cultivation at 37°C and 5% CO2 for 24 hours, fresh culture medium was replaced, 50 μL of fresh culture medium was added to each well, and Caspase-Glo 3 / 7 reagent was added to each well with an equal volume of culture medium. After incubation at room temperature for 1 hour, the fluorescence signal value was detected by an ELISA instrument and compared with the fluorescence value of the wells corresponding to the DEPC water transfection to measure the cytotoxicity of oligonucleotides with different sequences. The results are shown in the figure. Figure 2 As shown. DEPC water group as negative control group, 374 as positive control group, has strong cytotoxicity. The oligonucleotide sequence in this example is basically non-cytotoxic (Table 3).

[0077] Table 3 Cytotoxicity test of antisense oligonucleotides with different sequences

[0078]

[0079]

[0080] Example 4: Detection of therapeutic effects of some antisense oligonucleotides with different sequences in the New Zealand white rabbit dry eye model

[0081] The animal model used in this experiment was a New Zealand white rabbit dry eye model induced by 0.2% benzalkonium chloride (BAC, sigma). 2-2.5 kg New Zealand white rabbits were dripped with 0.2% BAC, 35 μL each time, twice a day, for a total of five days, and their tear secretion was detected by tear detection filter paper strips (Tianjin Jingming). After the dry eye model was successfully induced, the New Zealand white rabbits were randomly divided into two groups, one group as the control group, which was dripped with PBS, and the other group as the experimental group, which was dripped with 1 mg (35 μL) of antisense oligonucleotide drugs (SG31-1 or SG31-11), once a day, for a total of 5 days. Tear secretion and corneal damage were again tested using tear detection filter paper strips (Tianjin Jingming) and fluorescein sodium ophthalmic test strips (Tianjin Jingming). The results are as follows Figure 3 , 4 As shown, both SG31-1 and SG31-11 can improve tear secretion and reduce corneal damage in New Zealand white rabbits.

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An antisense oligonucleotide of IL-17A mRNA, characterized in that The nucleotide sequence of the antisense oligonucleotide is shown in SEQ ID NO.1, 3, 5-18, 20-23, 26-28 or 31.

2. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleosides include one or more modified sugars, one or more modified nucleic acid bases, or one or more modified internucleoside linkages.

3. The antisense oligonucleotide according to claim 2, characterized in that The modified sugars include 2'-modified sugars; The 2'-modified sugar includes a 2'-O-methoxyethyl modified sugar.

4. The antisense oligonucleotide according to claim 2, characterized in that The modified nucleic acid base includes 5-methylcytosine.

5. The antisense oligonucleotide according to claim 2, characterized in that The modified internucleoside linkages include phosphorothioate internucleoside linkages.

6. The antisense oligonucleotide according to any one of claims 1 to 5, characterized in that The antisense oligonucleotide comprises: a gap segment consisting of 10 linked 2' deoxynucleosides, a 5' wing segment consisting of 5 linked nucleosides, and a 3' wing segment consisting of 5 linked nucleosides; the gap segment is positioned between the 5' wing segment and the 3' wing segment; The sugar in each nucleotide of the 5'-wing segment is a 2'-O-methoxyethyl modified sugar; The sugar in each nucleotide of the 3'-wing segment is a 2'-O-methoxyethyl modified sugar; The cytosine in the antisense oligonucleotide is 5-methylcytosine; The internucleoside bonds in the antisense oligonucleotide are phosphorothioate internucleoside bonds.

7. Use of the antisense oligonucleotide according to any one of claims 1 to 6 in the following a or b: a. Knock down the expression level of IL-17A mRNA; b. Application in the preparation of drugs for treating IL-17A related diseases.

8. The use according to claim 7, characterized in that: The IL-17A-related diseases include dry eye.

9. A pharmaceutical composition, characterized in that The invention comprises the antisense oligonucleotide according to any one of claims 1 to 6.

10. The pharmaceutical composition according to claim 9, characterized in that Also included are pharmaceutically acceptable carriers.

Images