Transcription factor NtMYC2 and application of encoding protein and expression vector thereof in plant epidermal hair regulation

Abstract

The invention discloses application of a transcription factor NtMYC2 as well as an encoding protein and an expression vector thereof in plant epidermal hair regulation and control, and aims to solve the technical problems that a plant epidermal hair generation mechanism is unknown and an effective regulation and control means and a utilization way are lacked at present. A transcription factor NtMYC2 capable of regulating and controlling plant epidermal hair generation is identified, the gene is located in a cell nucleus, the expression level in leaves is the highest, the gene is a key component in a jasmonic acid signal channel, the expression of the gene is regulated and controlled by a jasmonic acid signal, and the gene can be used for regulating and controlling plant epidermal hair generation. By constructing a gene editing strain of the gene, it is clear that NtMYC2 serves as a key gene to participate in positive regulation of epidermal hair generation, and the NtMYC2 has important application value in the aspect of regulating the total epidermal hair development density.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to transcription factor genes NtMYC2 And the application of its encoding protein and expression vector in the regulation of plant epidermal hairs. Background Art

[0002] The bHLH (basic / helix-loop-helix) family is the second largest transcription factor family in plants. It has a characteristic helix-loop-helix conserved region and plays a role in regulating plant growth and development, secondary metabolism, and resisting adverse stress. The MBW (MYB-bHLH-WD40) complex formed in Arabidopsis thaliana regulates the initiation of epidermal hair development and activates the expression of the downstream gene GL2 to promote epidermal hair differentiation. As a member of the bHLH transcription factor family, AtRHD6 and AtRSL1 Genes can also be activated by the MBW complex to regulate the development of root hair cells. Among them, MYC protein has been confirmed to be involved in plant growth and development, JA signal transduction, ABA response, secondary metabolite synthesis and stress response. In Arabidopsis, AtMYC2 As a central transcription factor, it initiates various physiological processes of the JA pathway, including root growth inhibition, male sterility, and leaf senescence, and is involved in AtMYC3 , AtMYC4 Coordinated regulation of seed number and protein accumulation, AtMYC3 and AtMYC4 Gene overexpression can promote anthocyanin accumulation in Arabidopsis. In addition, MED25 responds to JA signals after binding to MYC2 and regulates the expression of downstream pathogen defense genes. Under drought conditions, AtMYC2 It functions as a transcriptional activator in the ABA signal transduction pathway. NtMYC2a and NtMYC2b Through NtJAZ1 The interaction regulates JA-induced alkaloid synthesis.

[0003] JA signaling has been confirmed to be involved in regulating the occurrence of epidermal hairs. As an important regulatory factor in the JA signaling pathway, MYC plays a very important regulatory role in the development of plant epidermal hairs. AtMYC1 Affects changes in epidermal hair density; Tomato SlMYC1 Activates JA-mediated formation of type VI glandular trichomes in tomato; cucumber CsMYC2 As a negative regulatory factor, it participates in the occurrence of glandular hairs; however, our understanding of the physiological and molecular mechanisms of MYC in regulating epidermal hairs in tobacco is still very limited.

[0004] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0005] The purpose of the present invention is to provide a transcription factor NtMYC2 The application of its encoding protein and expression vector in the regulation of plant epidermal hair occurrence / development is intended to solve the current technical problems of unclear mechanism of plant epidermal hair occurrence and lack of effective regulatory means and utilization approaches.

[0006] In the first aspect disclosed in the present application, the transcription factor NtMYC2 , which encode proteins or contain transcription factors NtMYC2 The expression vector is used to regulate the occurrence / development of plant epidermal hairs.

[0007] In a second aspect disclosed in the present application, the transcription factor NtMYC2 , which encode proteins or contain transcription factors NtMYC2 The expression vector is used in preparing plant materials with low-density epidermal hairs.

[0008] In some embodiments of the present disclosure, the amino acid sequence of the encoded protein is shown as SEQ ID NO.3 or SEQ ID NO.4.

[0009] In a third aspect disclosed in the present application, the transcription factor NtMYC2 , which encode proteins or contain transcription factors NtMYC2 The expression vector is used in the preparation of a preparation for regulating the density of plant epidermal hairs.

[0010] In a fourth aspect disclosed in the present application, the transcription factor NtMYC2 or contain transcription factors NtMYC2 The expression vector is used to regulate the type of plant epidermal hairs and / or the density of plant epidermal hairs.

[0011] In a fifth aspect disclosed in the present application, the transcription factor NtMYC2 or contain transcription factors NtMYC2 The expression vector is used in constructing or breeding transgenic plants with epidermal hair density traits.

[0012] In some embodiments of the present disclosure, the transcription factor NtMYC2 A specific fragment TCTGCTTCGACGTGATTCAAAGG in the open reading frame sequence is used as a target site to construct a gene editing vector; the gene editing vector is transformed into a recipient plant and cultivated to obtain a plant material with a significantly reduced total density of epidermal hairs.

[0013] In some embodiments of the present disclosure, the transcription factor NtMYC2 The nucleotide sequence is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0014] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. This application is obtained from common tobacco K326 NtMYC2 Full-length sequence, two homologous sequences were cloned and named NtMYC2a and NtMYC2b Subcellular localization analysis revealed NtMYC2a and NtMYC2b It is located in the cell nucleus; it is expressed to varying degrees in different tissues and organs of tobacco, with the highest expression level in leaves, indicating that the gene has tissue expression specificity and is involved in the development of tobacco leaves. NtMYC2a The relative expression levels in different tissues were higher than NtMYC2b ; Under different concentrations of MeJA treatment, NtMYC2a and NtMYC2b The expression level of MeJA increased first and then decreased with time, and reached the highest level 6 hours after treatment. NtMYC2 Strong induction of expression and time-efficiency, indicating NtMYC2 It is a key component in the jasmonic acid signaling pathway, and its expression is strictly regulated by jasmonic acid signals.

[0015] 2. This application uses bioinformatics analysis, tissue expression analysis, MeJA-induced expression analysis and construction NtMYC2 Gene editing strains of genes, clear NtMYC2 As a key gene involved in the positive regulation of tobacco epidermal hair occurrence, it has important application value in regulating the total density of epidermal hair development.

[0016] 3. This Application NtMYC2 The cloning and functional localization of the gene will help further study and reveal the molecular regulatory mechanism of tobacco epidermal hair growth and development, and can be effectively utilized in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In one embodiment of this application NtMYC2a and NtMYC2b Agarose gel electrophoresis results, protein sequence alignment analysis and evolutionary tree analysis.

[0018] Figure 2 In one embodiment of this application NtMYC2a and NtMYC2b Subcellular localization of fusion proteins.

[0019] Figure 3 In one embodiment of this application NtMYC2a and NtMYC2btissue expression pattern.

[0020] Figure 4 In one embodiment of this application NtMYC2a and NtMYC2b Expression analysis in response to different concentrations of MeJA treatment.

[0021] Figure 5 In one embodiment of this application NtMYC2 Sequence analysis results of gene-edited homozygous strains.

[0022] Figure 6 In one embodiment of the present application, K326, NtMYC2 Observation and data statistics of leaf epidermal hair morphology of gene-edited strains KO4 and KO35; the least significant difference method was used for significance test, where *: 0.01 <P<0.05;**:P<0.01。

[0023] Figure 7 In one embodiment of this application NtMYC2 and NtJAZ11 Yeast two-hybrid assay results. DETAILED DESCRIPTION

[0024] The specific implementation methods of the present invention are described below in conjunction with examples, but the following examples are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0025] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the reagents and raw materials involved are all commercially available conventional products unless otherwise specified; the test methods involved are all conventional methods unless otherwise specified.

[0026] Embodiment 1 NtMYC2 Gene cloning and bioinformatics analysis In this case, homologous cloning technology was used to amplify the negative regulatory gene of epidermal hair formation in K326 based on the genome sequence of the Solanaceae genome website and the first strand of cDNA synthesized by reverse transcription of total RNA from leaves of common tobacco K326 was used as a template. NtMYC2 Two homologous sequences NtMYC2a (Nitab4.5_0001765g0050.1) and NtMYC2b (Nitab4.5_0001012g0020.1)( Figure 1 A), where NtMYC2a The coding region is 2040 bp in length. NtMYC2b The total length of the coding region is 2046bp, encoding 679 and 681 amino acids respectively. The nucleotide similarity between the two is 96.92% and the amino acid sequence similarity is 96.33%.

[0027] The results of systematic evolution show that ( Figure 1 B), NtMYC2a With Tobacco Fluff NtomMYC2 The similarity is 99.85%, NtMYC2b Tobacco NsylMYC2 The similarity is 99.85%, so NtMYC2a The parent may be Nicotiana fluffyana. NtMYC2b The parent may be forest tobacco. Two copies were found in the genome of Nicotiana benthamiana. NtMYC2a , NtMYC2b and NbMYC2 The similarities of α and β are 85.05% and 86.42% respectively, and both are highly conserved in Nicotiana benthamiana. NtMYC2a , NtMYC2b It is more closely related to tomato, potato and pepper, and more distantly related to Artemisia annua and Arabidopsis thaliana.

[0028] The results of protein multiple sequence alignment showed that ( Figure 1 C), NtMYC2a and NtMYC2b They belong to the bHLH gene family and contain multiple conserved domains: JID domain (JAZ interaction domain), TAD domain and bHLH domain.

[0029] Subcellular localization analysis revealed that ( Figure 2 ), NtMYC2a -GFP and NtMYC2b -GFP fluorescence signal only exists in the cell nucleus, indicating NtMYC2 Localized in the cell nucleus.

[0030] Analysis of tissue expression patterns revealed that ( Figure 3 ), NtMYC2 The gene is expressed to varying degrees in different tissues and organs of tobacco, with the highest expression level in leaves, followed by stems, epidermal hairs, flowers and roots, indicating that the gene has tissue expression specificity and is involved in tobacco leaf development. NtMYC2a The relative expression levels in the above tissues were higher than NtMYC2b ,illustrate NtMYC2a It may be a major gene involved in tobacco leaf development.

[0031] Real-time fluorescence quantitative RT-PCR was used to analyze the effect of MeJA on NtMYC2 The results showed that ( Figure 4 ), under different concentration treatments, NtMYC2a and NtMYC2b The expression of MeJA increased first and then decreased with time, and reached the highest level 6 hours after treatment. NtMYC2 The gene is strongly induced and time-sensitive, which proves NtMYC2The gene is a key component in the tobacco jasmonic acid signaling pathway, and its expression is regulated by jasmonic acid signals.

[0032] Embodiment 2 NtMYC2 Access to gene editing materials For research NtMYC2 The function of genes in the process of plant epidermal hair formation. NtMYC2 -Cas gene editing vector was introduced into tobacco through leaf disc transformation method, and 26 positive plants (T0 generation) were obtained by hygromycin resistance screening. Sequencing analysis found that 8 of the T0 generation positive plants had base mutations in the sgRNA region, and the gene editing efficiency was 30.77%. In the screening of the T1 generation, 2 homozygous mutants with base insertion or deletion mutations in the sgRNA region were obtained. Sequencing of the T1 generation plants with gene mutations found that NtMYC2 -KO4 NtMYC2a The sequence lacks 1 base T. NtMYC2b A base G is inserted into the sequence; NtMYC2 -KO35 NtMYC2a The sequence lacks 4 bases TTCA, NtMYC2b The sequence lacks a base T ( Figure 5 A). The insertion and deletion of these bases lead to NtMYC2 Termination of translation and loss of protein function ( Figure 5 B).

[0033] Embodiment 3 NtMYC2 Functional verification of positive regulation of epidermal hair development For further research NtMYC2 The specific function of the gene in the process of plant epidermal hair formation, in this example, the homozygous mutants (T2 generation) of KO4 and KO35 obtained in Example 2 were compared with the phenotypic characteristics of common tobacco K326 ( Figure 6 ), the results showed that under normal growth conditions, compared with the control K326, NtMYC2 There was no difference in the morphology of leaf epidermal hairs in the gene-edited strains, but the type of epidermal hairs changed, including only long-stalked glandular hairs and short-stalked glandular hairs, and the non-secretory epidermal hairs disappeared, indicating that NtMYC2 It has an impact on the type of leaf epidermal hairs. Observation and statistics of the density of glandular hairs revealed that NtMYC2- KO4, NtMYC2- The total density of leaf epidermal hairs in the KO35 gene-edited line was significantly reduced, among which the density of long-stalked glandular hairs was reduced by 43.75% and 50.00%, and the density of short-stalked glandular hairs was reduced by 40.00% and 60.00%, respectively. The degree of reduction in the density of long-stalked glandular hairs and short-stalked glandular hairs reached a significant level, indicating that NtMYC2 Positively regulates the occurrence of tobacco glandular trichomes.

[0034] Embodiment 4: NtMYC2 and NtJAZ11 Verification of the molecular mechanism of protein interaction and joint regulation of epidermal hair formation In this example, the pGADT7-NtMYC2 yeast two-hybrid vector was constructed, combined with the previously constructed pGBKT7-NtJAZ11 yeast two-hybrid vector, and introduced into yeast for protein interaction analysis.

[0035] The results show that ( Figure 7 ), pGBKT7-NtJAZ11×pGADT7-NtMYC2, the positive control pGBKT7-53×pGADT7-T, and the negative control pGBKT7-Lam×pGADT7-T can all grow plaques and grow normally on the double-deficient plate (DDO), indicating that the plasmid transformation was successful. Except for the negative control, all co-transformed plasmids can grow on QDO / X / A and turn blue, indicating that NtMYC2 and NtJAZ11 proteins interact in yeast cells.

[0036] Although some preferred embodiments of the present application have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0037] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations to the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. Transcription Factors NtMYC2 , which encode proteins or contain transcription factors NtMYC2 Application of the expression vector in regulating the occurrence / development of plant epidermal hairs.

2. Transcription Factors NtMYC2 , which encode proteins or contain transcription factors NtMYC2 Application of the expression vector in preparing low-density epidermal hairy plant materials.

3. Transcription Factors NtMYC2 , which encode proteins or contain transcription factors NtMYC2 Application of the expression vector in the preparation of a preparation for regulating the density of plant epidermal hairs.

4. The use according to claim 1, 2 or 3, It is characterized in that The amino acid sequence of the encoded protein is shown as SEQ ID NO.3 or SEQ ID NO.

4.

5. Transcription Factors NtMYC2 or contain transcription factors NtMYC2 Application of the expression vector in regulating the type of plant epidermal hairs and / or epidermal density traits.

6. Transcription Factors NtMYC2 or contain transcription factors NtMYC2 Application of the expression vector in constructing or breeding transgenic plants with epidermal hair density traits.

7. The use according to claim 6, It is characterized in that Transcription factor NtMYC2 A specific fragment TCTGCTTCGACGTGATTCAAAGG in the open reading frame sequence is used as a target site to construct a gene editing vector; the gene editing vector is transformed into a recipient plant and cultivated to obtain a plant material with a significantly reduced total density of epidermal hairs.

8. The use according to claim 1, 2, 3, 5 or 6, It is characterized in that The transcription factor NtMYC2 The nucleotide sequence is shown as SEQ ID NO.1 or SEQ ID NO.2.

Images