Toxoplasma gondii detection kit and detection method

Abstract

The invention relates to the technical field of parasite detection, in particular to a kit and a method for detecting toxoplasma gondii based on RPA-CRISPR / Cas12a. The kit comprises a crRNA sequence, wherein the crRNA sequence is as shown in SEQ ID NO.7, SEQ ID NO.11, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.23 or SEQ ID NO.30, and the crRNA sequence is as shown in SEQ ID NO.7, SEQ ID NO.11, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.21, SEQ ID Or the difference between the nucleotide sequence and the nucleotide sequence is not more than 2 basic groups. The kit further comprises an RPA primer pair, Cas12a protein and ssDNA, Cas12a carries out DNase activity, the single-stranded DNA marked with fluorophore is cut, and whether a sample to be detected contains toxoplasma gondii DNA or not can be judged by detecting a fluorescence signal. When being used for detecting toxoplasma gondii, the system has the characteristics of short reaction time, strong specificity, high sensitivity, small instrument dependence, simplicity in operation and the like, the effect is outstanding, and the sensitivity is consistent with that of fluorescent quantitative PCR.

Description

Technical Field

[0001] The present invention relates to the technical field of parasite detection, and in particular to a detection kit and a one-tube detection method for accurately and rapidly detecting Toxoplasma gondii based on RPA-CRISPR / Cas12a. Background Art

[0002] Toxoplasma gondii is a protozoan of the phylum Apicomplexa that can parasitize almost all warm-blooded animals, including humans, causing zoonotic parasitic diseases. Typical genotypes of Toxoplasma include type I, type II, and type III. The pathogenicity of Toxoplasma is related to the genotype and virulence of the strain. Humans are susceptible to type II strains, while animals are more susceptible to type I and type III. According to statistics, the infection rate of Toxoplasma in dogs and cats reaches 6%-88%; the infection rate of Toxoplasma in economic animals such as cattle and sheep reaches 12%-35%, which brings huge economic losses to animal husbandry; at the same time, about one-third of the world's population is also infected with Toxoplasma, which poses a major hidden danger to food safety and human health.

[0003] Toxoplasma gondii can be a foodborne and waterborne pathogen and is an opportunistic parasite. Infection with Toxoplasma gondii can lead to toxoplasmosis, which is distributed worldwide and is a parasitic disease that seriously affects public health and the livestock economy. Human toxoplasmosis can cause respiratory symptoms such as fever, cough or dyspnea; gastrointestinal symptoms such as anorexia and diarrhea, and induction of neurosis through the blood-brain barrier. The disease often presents as an invisible infection and non-specific clinical symptoms, so it is difficult to make an accurate clinical diagnosis. At present, there is no vaccine or drug with significant therapeutic effect on toxoplasmosis, and the therapeutic drugs for toxoplasmosis have strong toxic side effects, and there is no effective treatment for special populations such as pregnant women. Therefore, early diagnosis and prevention of toxoplasmosis are crucial.

[0004] At present, the commonly used detection methods for Toxoplasma gondii mainly include etiological detection, immunological detection and molecular biological detection. Among them, the most classic detection method is etiological detection, but it has the disadvantages of low sensitivity, long time consumption, large workload and high technical requirements for detection personnel. The clinical diagnosis of toxoplasmosis mainly relies on immunological diagnosis. Although this diagnostic method has the characteristics of simple operation and high specificity, it still has the disadvantages of low sensitivity and cannot detect early Toxoplasma infection in time. Molecular detection technology has the advantages of strong specificity and high sensitivity, but it has the disadvantages of long time consumption, complex operation, and dependence on large instruments. It is difficult to carry out in some grassroots laboratories or on-site. Therefore, it is of great significance to develop a detection method with strong specificity, high sensitivity, convenience and fastness for the monitoring and prevention of EHDV.

[0005] The CRISPR-Cas system is a new type of nucleic acid detection technology that has been developed in recent years and has been widely used in pathogen detection. It uses specific crRNA to bind to the target, activating the Cas protein's flanking cleavage activity, indiscriminately cleaving the surrounding DNA or RNA, including the target and the reporter group. The reporter group emits fluorescence after being cut, and at least 10 4 The signal is amplified by 10 times, thus realizing the signal conversion from target recognition to fluorescence change. Compared with other PCR-based detection technologies, the nucleic acid detection technology based on CRISPR / Cas12 is convenient, fast, low-cost, and does not require expensive equipment and professionals. It has the potential to be developed into an on-site detection tool. Summary of the invention

[0006] In view of the defects of the prior art, the present invention provides an RPA-CRISPR / Cas12a detection kit for rapid on-site detection of Toxoplasma gondii, which has low instrument dependence, fast and simple operation, high sensitivity and good specificity. The sensitivity of Toxoplasma gondii detection is further improved by combining RPA with CRISPR technology, and screening and optimizing RPA primers and crRNA (CRISPR RNA) sequences for detection.

[0007] The present invention first provides a crRNA sequence for Toxoplasma gondii detection, which has excellent detection effect, high sensitivity and good specificity. Specifically, the crRNA sequence for specific detection of Toxoplasma gondii is SEQ ID NO.7, SEQ ID NO.11, SEQID NO.17, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.23, or SEQ ID NO.30; or a nucleotide sequence that differs therefrom by no more than 2 bases.

[0008] Preferably, the crRNA sequence differs by 1 base from SEQ ID NO.7, SEQ ID NO.11, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.23, or SEQ ID NO.30.

[0009] A second aspect of the present invention provides an RPA primer pair for Toxoplasma gondii nucleic acid detection, which has high amplification efficiency and good specificity. The RPA primer pair comprises an upstream primer RPA-F and a downstream primer RPA-R, and the RPA primer pair is: SEQ ID NO.36 / SEQ ID NO.39; SEQ ID NO.36 / SEQ ID NO.42; SEQ ID NO.46 / SEQ ID NO.51; SEQ ID NO.46 / SEQ ID NO.53; SEQ ID NO.46 / SEQ ID NO.54; SEQ ID NO.55 / SEQ ID NO.56; SEQ ID NO.55 / SEQ ID NO.58; or SEQ ID NO.55 / SEQ ID NO.59,

[0010] Or a nucleotide sequence pair that differs from it by no more than 2 bases.

[0011] A third aspect of the present invention provides a kit for Toxoplasma gondii nucleic acid detection, the kit comprising an RPA-CRISPR / Cas12a system, the RPA-CRISPR / Cas12a system comprising the crRNA sequence as described above, and / or the RPA primer pair as described above.

[0012] Furthermore, the kit also includes Cas12a protein and single-stranded DNA marked with a fluorescent signal.

[0013] Furthermore, the kit also includes A buffer and B buffer.

[0014] Furthermore, the single-stranded DNA is a ssDNA FQ-labeled reporter, and the specific sequence is: 5′-FAM-TTATT-BHQ-3′.

[0015] Furthermore, the RPA-CRISPR / Cas12a system also includes other reagents required for the RPA amplification system and the CRISPR / Cas12a detection system.

[0016] Furthermore, all components in the kit are reacted in one reaction container.

[0017] The fourth aspect of the present invention provides a method for rapid detection of Toxoplasma gondii nucleic acid for non-diagnostic purposes, which is based on the RPA-CRISPR / Cas12a detection system, and ensures the Toxoplasma gondii nucleic acid detection effect by designing high-specificity, high-efficiency and high-sensitivity high-quality crRNA, and high-specificity and high-amplification efficiency RPA primers. Specifically, the method is performed using the kit as described above.

[0018] Furthermore, the method includes a constant temperature amplification reaction, and the reaction temperature is 37°C.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) The present invention provides a crRNA and RPA primer pair for Toxoplasma gondii detection, wherein the crRNA has good specificity and the RPA primer pair has high amplification efficiency, both of which are directly related to the sensitivity and accuracy of the detection. The present invention also performs a joint screening of crRNA and RPA primers, further improving the sensitivity and accuracy of the method of the present invention, and can detect a minimum of 10 copies of target DNA, and there is no cross reaction with other parasites such as Toxocara, Neospora caninum, etc., which is conducive to the rapid detection and prevention of early infection of Toxoplasma gondii.

[0021] (2) The present invention also provides a one-tube detection technology based on the RPA-CRISPR / Cas12a system for Toxoplasma gondii detection, in which all components complete the detection reaction in one reaction container, reducing the steps of liquid transfer and the risk of aerosol contamination.

[0022] (3) The detection method of the present invention is low-cost and does not require a professional and standardized laboratory or expensive instruments and equipment (fluorescence quantitative PCR instrument, etc.). It only requires a water bath or a constant temperature incubator and a fluorescence detector, which is suitable for front-line use and reduces the detection cost.

[0023] (4) The detection method of the present invention has a short detection time. During the isothermal amplification, CRISPR-Cas12a exerts its cutting activity and detects the fluorescence change. The detection can be completed in only 30-60 minutes. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0025] Figure 1 AE is the fluorescence value measurement result of CRISPR / Cas12a detection for 30 min when 35 crRNAs were screened;

[0026] Figure 2 AB is the fluorescence value measurement result of 30min detection of CRISPR / Cas12a when 11 crRNAs were screened;

[0027] Figure 3AC is the agarose gel nucleic acid electrophoresis result of 32 pairs of RPA amplification primers at 10 min of amplification;

[0028] Figure 4 AB is the fluorescence value measurement result of 30 min of RPA-CRISPR / Cas12a detection when RPA primer and crRNA are combined in one reaction system;

[0029] Figure 5 AB is the fluorescence curve analysis result of RPA-CRISPR / Cas12a detection of Toxoplasma nucleic acid sensitivity after 10-fold dilution of Toxoplasma RR sequence plasmid standard;

[0030] Figure 6 AB is the terminal fluorescence histogram analysis result of Toxoplasma gondii detection by RPA-CRISPR / Cas12a after 10-fold dilution of Toxoplasma RNA standard;

[0031] Figure 7 AC is the fluorescence curve analysis result of RPA-CRISPR / Cas12a detection of Toxoplasma gondii stability analysis;

[0032] Figure 8 The terminal fluorescence histogram analysis results of RPA-CRISPR / Cas12a detection of Toxoplasma gondii stability analysis;

[0033] Fig. 9 Fluorescence curve analysis results of RPA-CRISPR / Cas12a detection of Toxoplasma gondii specific analysis;

[0034] Fig.10 The final fluorescence histogram analysis results of RPA-CRISPR / Cas12a detection of Toxoplasma gondii specific analysis;

[0035] Fig.11 UV irradiation results of the RPA-CRISPR / Cas12a detection method for Toxoplasma gondii-specific analysis;

[0036] Fig.12 Fluorescence curve analysis results of the RPA-CRISPR / Cas12a detection method for 20 samples;

[0037] Fig.13 The final fluorescence histogram analysis results of the RPA-CRISPR / Cas12a detection method for 20 samples;

[0038] Fig.14 These are the UV irradiation results of the RPA-CRISPR / Cas12a detection method for 20 samples. DETAILED DESCRIPTION

[0039] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer, the present invention is further described in detail below in conjunction with the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The present invention is specifically introduced below in conjunction with the specific embodiments.

[0040] Early detection and prevention and control technologies for Toxoplasma infection have disadvantages such as being time-consuming, highly dependent on expensive instruments, and requiring professional personnel to operate, and cannot meet the requirements for rapid on-site testing.

[0041] The embodiment of the present invention provides a technology for rapid on-site detection of Toxoplasma nucleic acid with low instrument dependence, fast and simple operation, high sensitivity and good specificity. The technology is based on the RPA-CRISPR / Cas12a detection system, combining RPA with CRISPR technology to play a role, amplifying the Toxoplasma nucleic acid sequence in the sample by RPA technology, and then using CRISPR technology for detection. The inventor found that when Cas12a, crRNA and Toxoplasma DNA form a ternary complex, Cas12a in the complex is activated and exercises DNase activity, which can cut single-stranded DNA labeled with a fluorescent group, so it can be determined by detecting the fluorescent signal whether the sample to be tested contains Toxoplasma DNA. Based on the above technical principles, a suitable Toxoplasma target is selected, the RPA primers and crRNA sequences for detection are screened and optimized, and they are jointly screened to further improve the sensitivity of detecting Toxoplasma, which is of great significance for early detection, diagnosis and prevention and control of Toxoplasma infection.

[0042] The embodiment of the present invention first provides a crRNA sequence for Toxoplasma gondii detection, which has excellent detection effect, high sensitivity and good specificity.

[0043] Specifically, the crRNA sequence used in this application is R7 (SEQ ID NO.7), R11 (SEQ ID NO.11), R17 (SEQ ID NO.17), R18 (SEQ ID NO.18), R21 (SEQ ID NO.21), R23 (SEQ ID NO.23), or R30 (SEQ ID NO.30).

[0044] Specifically, the above-mentioned crRNA sequence is designed and prepared in the target region by analyzing and selecting suitable targets, and the above-mentioned target region is obtained by performing specificity and conservation analysis on the sequence of Toxoplasma gondii using BLAST and MEGA software.

[0045] Specifically, the target is a repeat region in the Toxoplasma gondii gene, and the repeat region sequence has a high copy characteristic (200-300 copies / genome) and has strong inter-species specificity and strong intra-species conservation.

[0046] Specifically, the repeat region has the nucleotide sequence described in SEQ ID NO.65: gagaccgcggagccgaagtgcgttttctttttttgattttttttttgtttttttcacaggcgagctcgcctgtgcttggagccacagaagggacagaagtcgaaggggactacagacgcgatgccgctcctccagccgtcttggaggagagatatcaggactgtagatgaaggcgasggtgaggatgagggggtggcgt ggttgggaagcgacgagagtcggagaggggagaagatgtttccggcttggctgcttttcctggagggtggaaaagagacaccggaatgcgatctagacgagacgac gctttcctcgtggtgatggcggagagaattgaagagtggagaagagggcgaggggagacagtcggaggcttggacgaagggaggaggaggcgtaggagagg(SEQ ID NO.65).

[0047] A second aspect of an embodiment of the present invention provides an RPA primer pair for Toxoplasma gondii nucleic acid detection, which has high amplification efficiency and good specificity.

[0048] Specifically, the RPA amplification primers include an upstream primer RPA-F and a downstream primer RPA-R. The RPA primer pairs used in the embodiment of the present invention are any group of 1-F1 (SEQ ID NO.36) / R3 (SEQ ID NO.39), 1-F1 (SEQ ID NO.36) / R6 (SEQID NO.42), 2-F3 (SEQ ID NO.46) / R13 (SEQ ID NO.51), 2-F3 (SEQ ID NO.46) / R15 (SEQ ID NO.53), 2-F3 (SEQ ID NO.46) / R16 (SEQ ID NO.54), 3-F3 (SEQ ID NO.55) / R17 (SEQ ID NO.56), 3-F3 (SEQ ID NO.55) / R19 (SEQ ID NO.58), and 3-F3 (SEQ ID NO.55) / R20 (SEQ ID NO.59).

[0049] Specifically, the RPA primer pair has high efficiency in amplifying the target and specifically amplifies the Toxoplasma RR sequence.

[0050] A third aspect of an embodiment of the present invention provides a kit for detecting Toxoplasma gondii nucleic acid, the kit comprising an RPA-CRISPR / Cas12a system.

[0051] Specifically, the RPA-CRISPR / Cas12a system comprises a combination of the above-mentioned RPA primer pair and crRNA.

[0052] Specifically, the RPA-CRISPR / Cas12a system also includes a ssDNAFQ-labeled reporter, the sequence of which is: 5′-FAM-TTATT-BHQ-3′.

[0053] Specifically, the RPA-CRISPR / Cas12a system also includes other reagents required for the RPA amplification system and the CRISPR / Cas12a detection system.

[0054] Specifically, the RPA amplification system is shown in Table 6.

[0055] Specifically, the CRISPR / Cas12a detection system is shown in Table 8.

[0056] Specifically, the RPA-CRISPR / Cas12a system provided by the present invention can realize integrated detection, reduce the liquid transfer steps, and avoid aerosol contamination that may be generated by opening the lid midway.

[0057] A fourth aspect of the embodiments of the present invention provides a method for rapid detection of Toxoplasma gondii nucleic acid.

[0058] Specifically, the method is based on the RPA-CRISPR / Cas12a detection system, which ensures the Toxoplasma gondii nucleic acid detection effect by designing high-specificity, high-efficiency and high-sensitivity high-quality crRNA, and high-specificity and high-amplification efficiency RPA primers.

[0059] Specifically, the detection principle of the detection method is: when the target nucleic acid sequence of Toxoplasma gondii combines with Cas12a protein and specific crRNA to form a ternary complex, Cas12a protein will be activated, exerting the non-specific single-stranded DNA cutting function, and cutting the single-stranded DNA (ssDNA reporter) marked with a fluorescent signal. By detecting the fluorescence, it can be known whether the sample to be tested is Toxoplasma positive.

[0060] Compared with the traditional PCR method, this method greatly shortens the time and is particularly suitable for grassroots units and on-site detection. At the same time, the cutting activity of Cas12a also plays a role in signal amplification, so the RPA-CRISPR / Cas12a technology has a very high sensitivity for the detection of Toxoplasma gondii, which can reach 10 copies. In addition, the crRNA-guided Cas protein activation process is a sequence-specific recognition process, so non-specific amplification products will not activate the activity of Cas protein, which determines the detection specificity of this method and has no cross-reaction with other parasites.

[0061] The present application is further explained below with reference to specific embodiments:

[0062] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified, and the techniques not described in detail are all performed according to standard methods well known to those skilled in the art.

[0063] Statistical analysis used in the examples of the present invention: All experiments were repeated at least 3 times independently, and the results were expressed as mean values ​​and standard deviations, using one-way analysis of variance. All statistical analyses used P < 0.05 as the test standard for significant statistical differences, and the analysis software was SPSS 16.0 and GraphPad Prism 5.

[0064] Example 1 Synthesis of Toxoplasma gondii plasmid standard

[0065] In order to establish the RPA-CRISPR / Cas12a detection method for Toxoplasma gondii, the present invention targets the Toxoplasma gondii repeat region and selects it as the target region for detection through specificity and conservation analysis. The inventors insert the Toxoplasma gondii repeat region into the PU19 plasmid as a target standard for detection.

[0066] Example 2 Design of crRNA

[0067] The core of the RPA-CRISPR / Cas12a detection method lies in crRNA, so the quality of crRNA is directly related to the sensitivity and accuracy of the detection method. In order to screen for more efficient crRNA, 35 crRNAs were designed for the repeat region of Toxoplasma gondii, and their sequences are shown in Table 1.

[0068] Table 1 crRNA sequence table

[0069]

[0070]

[0071] The inventors prepared these 35 crRNAs by the following method:

[0072] S1: Use two complementary primers to synthesize the DNA template of crRNA sequence, and the PCR reaction system is as shown in Table 2.

[0073] Table 2 PCR reaction system

[0074]

[0075] Add the above components to a 200 μL centrifuge tube, mix well and centrifuge. Place in a PCR instrument for PCR reaction. The PCR reaction program is set as follows:

[0076] Pre-denaturation at 95°C for 1 min; denaturation at 95°C for 10 s, annealing at 55°C for 20 s, extension at 72°C for 6 s, repeat 35 cycles; and finally extension at 72°C for 3 min to obtain the template of crRNA sequence. The primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0077] S2: crRNA was transcribed in vitro using the New England Biolabs T7 transcription kit. The transcription system is shown in Table 3.

[0078] Table 3 Transcription system

[0079]

[0080] Add the above components to a 1.5 mL centrifuge tube, flick to mix and centrifuge. Incubate overnight in a 37°C incubator; then add 2 μL DNase I and incubate at 37°C for 15 min to obtain crRNA. Purify RNA using the Trizol method, measure the concentration on Qubit 3.0, and store the purified crRNA in a -80°C refrigerator.

[0081] Example 3 Screening of highly efficient crRNA

[0082] Using the synthetic target DNA standard and crRNA, high-quality crRNA with good efficiency was screened out. The 35 crRNAs prepared in Example 2 were used in the reaction system, the reaction time was set to 30 min, and the real-time fluorescence value was read using the Suzhou Krui constant temperature amplification instrument. The reaction system is shown in Table 4.

[0083] Table 4 Reaction system

[0084]

[0085] The experimental results are as follows Figure 1 , Figure 2 As shown, Figure 1 AE is the fluorescence value measurement result of CRISPR / Cas12a detection for 30 min when 35 crRNAs were screened; Figure 2 AB is the result of fluorescence value determination of 30min in CRISPR / Cas12a detection when 11 crRNAs were screened; NC in the figure represents negative control, and Rx represents crRNAs with different numbers. Within the 30min reaction time, 7 crRNA fluorescence curves were higher: R7 (SEQ ID NO.7), R11 (SEQ ID NO.11), R17 (SEQ ID NO.17), R18 (SEQ ID NO.18), R21 (SEQ ID NO.21), R23 (SEQ ID NO.23), and R30 (SEQ ID NO.30), indicating that among the 35 crRNAs synthesized in Example 2, these 7 crRNAs have the best effect and the highest sensitivity.

[0086] Example 4 Screening of efficient RPA primers

[0087] RPA-F (forward) / RPA-R (reverse) designed for RPA amplification, the sequence of which is shown in Table 5.

[0088] Table 5 RPA amplification primer sequences

[0089]

[0090] The above RPA primers were used for amplification. The RPA amplification system is shown in Table 6.

[0091] Table 6 RPA amplification system

[0092]

[0093] Use DNA Constant Temperature Rapid Amplification Kit (solid-based type) to prepare the premix system, mix well, observe the position of the band and the bright position, and screen out 8 pairs of efficient RPA primers. The agarose gel nucleic acid electrophoresis results at 10 minutes of amplification are as follows Figure 3 As shown in the figure, NC represents negative control, DL2000 represents Marker, and the circled part represents the primer pairs with higher efficiency: 1-F1 (SEQ ID NO.36) / R3 (SEQ ID NO.39), 1-F1 (SEQ ID NO.36) / R6 (SEQ ID NO.42), 2-F3 (SEQ ID NO.46) / R13 (SEQ ID NO.51), 2-F3 (SEQ ID NO.46) / R15 (SEQ ID NO.53), 2-F3 (SEQ ID NO.46) / R16 (SEQ ID NO.54), 3-F3 (SEQ ID NO.55) / R17 (SEQ ID NO.56), 3-F3 (SEQ ID NO.55) / R19 (SEQ ID NO.58), 3-F3 (SEQ ID NO.55) / R20 (SEQ ID NO.59), DNA constant temperature rapid amplification box (solid-based type) was purchased from Anpu Future.

[0094] Example 5 Establishment of RPA-CRISPR / Cas12a method for detecting Toxoplasma gondii

[0095] Further screening of the combination of RPA primers and crRNA. The above 8 pairs of RPA primers and 7 crRNAs were combined in a one-tube reaction system for joint screening.

[0096] The RPA-CRISPR / Cas12a detection system is shown in Tables 7 and 8.

[0097] Table 7 RPA-CRISPR / Cas12a detection system (Part I)

[0098]

[0099] Table 8 Detection system (Part 2)

[0100]

[0101] The above components were added to 8 tubes in sequence, centrifuged, and then placed in the Suzhou Krui constant temperature amplification instrument, and the FAM channel was selected. After reacting for 30 minutes, the fluorescence data was exported. The results are as follows Figure 4 , as shown in Table 9 and Table 10. Figure 4AB is the fluorescence value measurement result of RPA-CRISPR / Cas12a detection for 30 minutes after RPA primers and crRNA are integrated into a reaction system. In this example, the combination of primers 1-F1 / R6 and crRNA11 was screened for the highest cutting efficiency. The synthesized FAM-BHQ reporter sequence is: 5′-FAM-TTATT-BHQ1-3′, and its detection conditions are top cover temperature 37°C, well temperature 37°C, reaction 30 minutes, and fluorescence reading every 1 minute.

[0102] Table 9 SLOPE value

[0103]

[0104] Table 10 SLOPE value

[0105]

[0106] Example 6 RPA-CRISPR / Cas12a sensitivity analysis for detecting Toxoplasma gondii

[0107] The DNA positive standard with known copy number was diluted 10 times in a gradient ratio to 0 / 10 / 100 / 1000 / 10000 copies, and the RPA amplification system was prepared according to Table 6 in Example 4, and then the reaction was carried out according to the method and conditions for RPA-CRISPR / Cas12a detection of Toxoplasma gondii in Example 5. The RPA-CRISPR / Cas12a templates in the reaction system were the DNA positive standard with different copies diluted above, and the fluorescence value was read using Suzhou Crui constant temperature amplification instrument. The results are shown in the figure. Figure 5 , Figure 6 As shown, it can be seen that the system of the present invention can detect samples with a minimum of 10 copies, indicating that it has excellent detection sensitivity and has good application prospects in early detection of infection.

[0108] Example 7 Stability analysis of RPA-CRISPR / Cas12a detection of Toxoplasma gondii

[0109] Three independent RPA-CRISPR / Cas12a detection experiments were performed using a 3.33 copy / μL Toxoplasma standard. Stability analysis was performed according to the RPA-CRISPR / Cas12a detection method in Example 5, and the fluorescence value was read using a Suzhou CRISPR constant temperature amplification instrument.

[0110] The results are as follows Figure 7 , Figure 8As shown: the fluorescence of the control group of the three experiments remained at a very low level within 60 minutes of the reaction, and there was no obvious upward trend, while the fluorescence of the experimental group had an obvious upward trend within 60 minutes and the fluorescence values ​​of the three experimental groups were close at 60 minutes, which was statistically significantly different from the control group. The above results show that the method for detecting Toxoplasma gondii nucleic acid constructed by the present invention has strong stability.

[0111] Example 8 RPA-CRISPR / Cas12a Detection of Toxoplasma Gondii Specificity Analysis

[0112] The inventors selected two other parasites: Toxocara canis and Neospora caninum. The operation steps were the same as those for Toxoplasma gondii. The specificity analysis was performed according to the RPA-CRISPR / Cas12a detection method in Example 5, and the fluorescence value was read using Suzhou CRISPR constant temperature amplification instrument.

[0113] The results are as follows Fig. 9 , Fig.10 , Fig.11 As shown in the figure, the fluorescence values ​​of Toxocara canis and N. caninum showed no obvious upward trend and remained at a very low level within 60 minutes, while the fluorescence value of the Toxoplasma sample remained at about 50000 within 60 minutes. The above results show that the method for detecting Toxoplasma nucleic acid constructed by the present invention has strong specificity and no cross reaction with other parasites.

[0114] Example 9 Analysis of the accuracy of RPA-CRISPR / Cas12a in detecting Toxoplasma gondii

[0115] The inventors used the RPA-CRISPR / Cas12a detection method in Example 5 to detect 20 clinical samples to be tested, and compared them with the currently recognized relatively sensitive and accurate qPCR detection results to verify the accuracy of the detection method of the present invention.

[0116] The results are shown in Table 11. Fig.12 , Fig.13 , Fig.14 As shown in Table 11, N or N / A represents Toxoplasma negative, and P represents positive. It can be seen from the RPA-CRISPR / Cas12a detection fluorescence curve graph, bar graph and Table 11 data that samples 1, 2 and 7 are negative in the two detection methods, and the remaining samples are positive. The RPA-CRISPR / Cas12a detection method of the present invention is consistent with the qPCR result, that is, the method of the present invention is accurate and effective, and the sensitivity is highly close to qPCR.

[0117] Table 1 Comparison of RPA-CRISPR / Cas12a and qPCR detection of 1120 clinical samples

[0118]

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any other changes, modifications, substitutions, combinations and simplifications made within the spirit and principles of the present invention should be regarded as equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A crRNA sequence for Toxoplasma gondii nucleic acid detection, the crRNA sequence is SEQ ID NO.7, SEQ ID NO.11, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.21, SEQ ID NO.23, or SEQ ID NO.30; or a nucleotide sequence that differs from it by no more than 2 bases.

2. An RPA primer pair for detecting Toxoplasma gondii nucleic acid, the RPA primer pair comprising an upstream primer RPA-F and a downstream primer RPA-R, the RPA primer pair being: SEQ ID NO.36 / SEQ ID NO.39; SEQ ID NO.36 / SEQ ID NO.42; SEQ ID NO.46 / SEQ ID NO.51; SEQ ID NO.46 / SEQ ID NO.53; SEQ ID NO.46 / SEQ ID NO.54; SEQ ID NO.55 / SEQ ID NO.56; SEQ ID NO.55 / SEQ ID NO.58; or SEQ ID NO.55 / SEQ ID NO.59, Or a nucleotide sequence pair that differs from it by no more than 2 bases.

3. A kit for Toxoplasma gondii nucleic acid detection, the kit comprising the crRNA sequence as claimed in claim 1, and / or the RPA primer pair as claimed in claim 2.

4. The kit according to claim 3, characterized in that The kit also includes Cas12a protein and single-stranded DNA marked with a fluorescent signal.

5. The kit according to claim 3, characterized in that The kit also includes A buffer and B buffer.

6. The kit according to claim 4, characterized in that The single-stranded DNA with a fluorescent signal marker is 5′-FAM-TTATT-BHQ-3′.

7. The kit according to any one of claims 3 to 6, characterized in that All components in the kit are reacted in one reaction vessel.

8. A method for detecting Toxoplasma gondii for non-diagnostic purposes, performed using the kit according to any one of claims 3 to 7.

9. The detection method according to claim 8, characterized in that: The method comprises a constant temperature amplification reaction, wherein the temperature of the reaction is 37°C.

Images