Rice OsCMPG1 gene and application thereof in rice disease resistance

Abstract

The invention discloses a rice OsCMPG1 gene and application thereof in rice disease resistance, and belongs to the technical field of molecular biological agriculture. The gene OsCMPG1 is knocked out through a CRISPR / Cas9 technology, and a knockout mutant oscmpg1 is obtained; it is found through rice blast resistance identification that compared with wild type rice, the mutant oscmpg1 is more resistant to diseases and small in disease spot area, the number of pyricularia grisea carried by diseased leaves is small, and it is indicated that the OsCMPG1 negatively regulates the resistance of rice to rice blast. The bacterial leaf blight resistance identification finds that compared with wild rice, the mutant oscmpg1 is more resistant to diseases and shorter in scabs, which indicates that the OsCMPG1 negatively regulates the resistance of the rice to the bacterial leaf blight.

Description

Technical Field

[0001] The invention belongs to the technical field of biological agriculture, and particularly relates to the application of rice OsCMPG1 gene and encoded protein in improving rice disease resistance. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop. More than half of the world's population relies on rice as their staple food. However, the yield and quality of rice are threatened by various pathogens. Rice blast and bacterial blight, caused by Pyricularia oryzae and Xanthomonas oryzae pv. oryzae, are the main diseases in rice production. Rice blast and bacterial blight are often prevalent in rice-growing areas in my country and around the world, causing a significant reduction in rice production. They have become the main restrictive factor in the rice production process and a major hidden danger to global food security. When rice is infected by rice blast or bacterial blight, the normal growth and development of rice will be affected, and severe outbreaks can lead to a significant reduction in rice production.

[0003] There are many ways to prevent and control rice diseases. Long-term production practice has proved that breeding and promoting new disease-resistant varieties is the most economical, effective and environmentally friendly way to prevent and control diseases such as rice blast and bacterial blight. Therefore, identifying genes related to rice resistance to rice blast and bacterial blight and analyzing their molecular mechanisms are of great significance for breeding new disease-resistant rice varieties and developing disease prevention and control strategies. At present, some disease-resistant genes have been applied in production practice, but due to the complex and changeable pathogen populations in the natural environment, disease-resistant varieties are generally planted 3-5 years later, and resistance is easily lost. Therefore, continuously exploring new disease-resistant genes is a top priority for breeding disease-resistant rice varieties and ensuring national food security. Summary of the invention

[0004] The purpose of the present invention is to solve the technical difficulties of traditional disease-resistant breeding and to provide OsCMPG1 gene and encoded protein and their application in improving rice resistance.

[0005] The rice OsCMPG1 gene, whose nucleotide sequence is shown in the sequence list SEQ ID NO.1, and whose encoded amino acid sequence is shown in the sequence list SEQ ID NO.2.

[0006] Application of the rice OsCMPG1 gene as shown in SEQ ID NO.1 in treating rice blast and bacterial blight.

[0007] A rice disease resistance breeding method is achieved by knocking out the OsCMPG1 gene of a rice variety as shown in SEQ ID NO.1 in the sequence table;

[0008] The knockout is achieved by using CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the knockout target of the OsCMPG1 gene is: CGTCTCAGCAACGATATCTCtgg.

[0009] A gene knockout vector, which inserts the target nucleotide sequence of the OsCMPG1 gene: CGTCTCAGCAACGATATCTCtgg into the vector pYLCRISPR / Cas9P ubi -H built.

[0010] The present invention provides an application of rice OsCMPG1 gene and encoded protein in improving rice disease resistance, which is achieved by knocking out rice OsCMPG1 gene; the OsCMPG1 gene, its nucleotide sequence is shown in SEQ ID NO.1; the knockout is knocked out by CRISPR / Cas9 gene editing technology; the target nucleotide sequence of the OsCMPG1 gene is: CGTCTCAGCAACGATATCTCtgg. The present invention knocks out the gene OsCMPG1 by CRISPR / Cas9 technology to obtain a knockout mutant oscmpg1. Through the identification of rice blast resistance, it is found that compared with wild-type rice, the knockout mutant oscmpg1 is more disease-resistant, has a smaller lesion area, and carries less rice blast fungi on diseased leaves, indicating that the OsCMPG1 gene negatively regulates rice resistance to rice blast. The knockout mutant oscmpg1 lacks the OsCMPG1 gene and exhibits enhanced resistance to rice blast. Through the identification of rice bacterial blight resistance, it was found that compared with wild-type rice, the knockout mutant oscmpg1 was more resistant to the disease, and the lesion length was significantly smaller than that of the wild type, indicating that the OsCMPG1 gene negatively regulates the resistance of rice to rice bacterial blight. The knockout mutant oscmpg1 lacks the OsCMPG1 gene and shows enhanced resistance to rice bacterial blight, which can be promoted for practical application. The present invention is conducive to the cultivation of rice varieties resistant to rice blast and bacterial blight, and provides a basis for the later screening of rice varieties with high resistance and broad-spectrum resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Schematic diagram of knocking out the gene OsCMPG1 in the rice Nipponbare (NIP) background using CRISPR / Cas9 gene editing technology;

[0012] Figure 2Analysis of the resistance of the oscmpg1 mutant to rice blast after spray inoculation; A represents the phenotype of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with rice blast fungus; B represents the statistical results of the lesion area on the leaves of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with rice blast fungus; C represents the detection results of the bacterial quantity of rice blast fungus in the leaves of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with rice blast fungus;

[0013] Figure 3 Analysis of the resistance of the oscmpg1 mutant to rice blast after punch inoculation; A shows the phenotypes of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with rice blast fungus; B shows the statistical results of the lesion area on the leaves of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with rice blast fungus;

[0014] Figure 4 Analysis of the resistance of the oscmpg1 mutant to bacterial blight after leaf cut inoculation; A shows the phenotypes of the wild-type Nipponbare (NIP) and the oscmpg1 mutant after inoculation with bacterial blight pathogen; B shows the statistical results of the leaf spot length of the wild-type Nipponbare (NIP) and the oscmpg1 mutant after inoculation with bacterial blight pathogen. DETAILED DESCRIPTION

[0015] Example 1 Cloning of OsCMPG1 gene

[0016] Primer Premier 5.0 software was used to design cloning primers for the target gene OsCMPG1 (base sequence as shown in the sequence table SEQ ID NO.1), and the specific sequence is as follows. RNA was extracted from the rice variety Oryza sativa L. var. Nipponbare (deposited by Jilin Agricultural University), and cDNA was obtained by reverse transcription. This cDNA was used as a template, and PCR amplification was performed using the designed cloning primers to obtain a PCR product with a length of 1362 bp, which has nucleotides 1 to 1362 of the sequence shown in SEQ ID NO:1.

[0017] OsCMPG1-F: ATGGTTTTGCCGATGTCTCG;

[0018] OsCMPG1-R: TCAGAATGGCCTCTTGAGACCC.

[0019] The PCR amplification system was prepared according to the instruction manual of Phusion DNA Polymerase, specifically: 2×PhantaMax Buffer 10 μL, dNTP Mix 0.4 μL, upstream primer (10 μM) 0.8 μL, downstream primer (10 μM) 0.8 μL, cDNA template 400 ng, Phusion DNA Polymerase 0.4 μL, and ddH2O to 20 μL.

[0020] The PCR reaction system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min24 s, 32 cycles; and full extension at 72°C for 5 min.

[0021] Example 2 Construction of OsCMPG1 gene mutant

[0022] 1. Construction of OsCMPG1 gene mutants using CRISPR / Cas9 gene editing technology

[0023] Using the website http: / / skl.scau.edu.cn / , the editing target site of the target gene OsCMPG1 (the base sequence is shown in the sequence table SEQ ID NO.1) was designed. The target site location is as follows: Figure 1 As shown in the figure, the target nucleotide sequence is: CGTCTCAGCAACGATATCTCtgg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and then the OsU6a-target-sgRNA fragment was inserted into the final vector pYLCRISPR / Cas9P using the BsaI restriction site through Golden Gate cloning. ubi-H (for specific construction steps, please refer to: MaXingliang, Zhang Qunyu, Zhu Qinlong, Liu Wei, Chen Yan, Qiu Rong, Wang Bin, Yang Zhongfang, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 8(8), 1274-1284.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced by immature embryos of wild-type Nipponbare by Agrobacterium-mediated method, and positive transgenic plants were obtained by hygromycin screening.

[0024] 2. Molecular identification of editing forms in positive transgenic plants

[0025] Primer 5 software was used to design primers for identifying oscmpg1 mutants. The genomic DNA of rice leaves was used as a template and PCR amplification was performed with the following identification primers. The amplified products were sequenced by Sanger sequencing to analyze the editing form of the mutant.

[0026] The primers for identifying OsCMPG1 gene mutants are:

[0027] OsCMPG1-CRISPR-F:CCAAGCCATTCAACGGTCAACA;

[0028] OsCMPG1-CRISPR-R:ACGCACCAGTCCTGGATCATC.

[0029] The PCR amplification system was prepared according to the instruction manual of 2×Es Taq MasterMix (Dye), specifically: 2×Es Taq MasterMix (Dye) 12.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, DNA template 1.5 μg, and ddH2O to 25 μL.

[0030] The PCR reaction system was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 41 s, 35 cycles; and extension at 72°C for 2 min.

[0031] The results are as follows Figure 1As shown, two homozygous knockout mutant lines, oscmpg1-5 and oscmpg1-7, were obtained. In the oscmpg1-5 mutant, two bases AT were deleted 57 bp downstream of the start codon ATG of the OsCMPG1 gene, resulting in a frameshift mutation, which led to the premature formation of a stop codon at 154-156 bp. In the oscmpg1-7 mutant, five bases GAGAT were deleted 52 bp downstream of the start codon ATG of the OsCMPG1 gene, resulting in a frameshift mutation, which led to the premature formation of a stop codon at 151-153 bp.

[0032] Example 3 Identification of Rice Blast Resistance by Spray Inoculation

[0033] The seeds of wild-type Nipponbare (NIP) and knockout mutant line oscmpg1-7 were soaked in 50% sodium hypochlorite solution for 20 min for disinfection. The disinfected seeds were soaked in distilled water, cultured in a 37°C incubator until germination, planted in seedling trays, and inoculated with rice blast when they grew to the five-leaf stage.

[0034] Prepare tomato oatmeal culture medium. Take 30 g of oats and add 500 mL of distilled water and boil for 10 min. Cool to 30-40°C and filter to remove the oats and retain the filtrate. Crush 100 g of tomatoes with a juicer and add to the filtrate. Add distilled water to 1 L, stir well and dispense into conical flasks. Add 2 g of agar powder per 100 mL of culture medium and sterilize at 121°C for 20 min.

[0035] The rice blast fungus TCB-M strain stored on the filter paper was inoculated on a tomato oatmeal solid medium plate and cultured in a 28°C incubator for activation. After the mycelium grew, it was scraped and transferred to a new tomato oatmeal solid medium plate for expansion. The mycelium was cut with a sterilized cotton swab dipped in ddH2O and placed in a 28°C black light incubator to induce spore production. The plate was washed with 0.1% Tween and filtered to obtain a rice blast spore suspension. The spore concentration was adjusted to 3.0×10 5 / mL, set aside.

[0036] During inoculation, 0.1% Tween was evenly sprayed on the rice leaves, and the rice blast spore eluate was evenly sprayed on the rice leaves. After inoculation, the leaves were kept moisturized in the dark for 24 hours. After the shade cloth was removed, the normal light culture was continued. After 7 days of inoculation, the leaves were cut and photographed to record the disease situation. The area of ​​lesions on the inoculated leaves was counted using Photoshop software. At the same time, the amount of bacteria on the diseased leaves was detected by real-time fluorescence quantitative PCR. Equal amounts of leaves of wild-type Nipponbare (NIP) and knockout mutant oscmpg1 were taken, genomic DNA was extracted, and fluorescence quantitative PCR was performed with the following primers to compare the amount of rice blast carried by the leaves of wild-type NIP and knockout mutant oscmpg1, thereby completing the evaluation of the resistance of the knockout mutant to rice blast.

[0037] Real-time fluorescence quantitative PCR primers are:

[0038] MoPot2-F: ACGACCCGTCTTTACTTATTTGG;

[0039] MoPot2-R:AAGTAGCGTTGGTTTTGTTGGAT;

[0040] OsUbi-F:GCCCAAGAAGAAGATCAAGAAC;

[0041] OsUbi-R: AGATAACAACGGAAGCATAAAAGTC.

[0042] The fluorescence quantitative PCR amplification system was prepared according to the instruction manual of 2×SYBR qPCR Mixture, specifically: 5 μL of 2×SYBR qPCR Mixture, 0.2 μL of upstream primer (10 μM), 0.2 μL of downstream primer (10 μM), 0.6 μL of DNA template, and ddH2O to 10 μL. Each sample was repeated 3 times.

[0043] The fluorescence quantitative PCR reaction system was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing at 60°C for 1 min, 40 cycles; and extension at 72°C for 2 min.

[0044] The results are as follows Figure 2 As shown, compared with the wild type, the lesion area and the amount of rice blast in the leaves of the homozygous knockout mutant line oscmpg1-7 were significantly lower than those of the wild type, indicating that after the OsCMPG1 gene was knocked out, the wild type's resistance to rice blast was significantly enhanced.

[0045] Example 4 Identification of Rice Blast Resistance Using Punch Inoculation Method

[0046] The seeds of wild-type Nipponbare (NIP) and knockout mutant line oscmpg1-7 were soaked and disinfected, and the disinfected seeds were soaked in distilled water, cultured in a 37°C incubator until germination, planted in seedling pots, cultured in greenhouses, and inoculated with rice blast fungi when they grew to the six-leaf stage.

[0047] Prepare tomato oatmeal culture medium. Take 30 g oats and add 500 mL distilled water and boil for 10 min. Cool to 30-40°C and filter to remove the oats and retain the filtrate. Crush 100 g tomatoes with a juicer and add to the filtrate. Add distilled water to 1 L, stir well and dispense into conical flasks. Add 2 g agar powder per 100 mL culture medium and sterilize at 121°C for 20 min.

[0048] The TCB-M strain of rice blast fungus stored on filter paper was inoculated on a tomato oatmeal solid medium plate and cultured in a 28°C incubator for activation. After the mycelium grew, it was scraped and transferred to a new tomato oatmeal solid medium plate for expansion. The mycelium was cut with a sterilized cotton swab dipped in ddH2O and placed in a 28°C black light incubator to induce spore production. The plate was washed with 0.1% Tween and filtered to obtain the rice blast fungus spore eluate. The spore concentration was adjusted to 3.0×10 5 / mL, set aside.

[0049] During inoculation, select the second leaf of the rice plant 7 cm away from the tip of the leaf, stick a 5 cm long transparent tape on the back of the leaf, use a 2 mm diameter mouse ear clamp to make a wound on the epidermis on the left side of the rice vein, add 5 μL of rice blast spore eluate to the wound, and stick the transparent tape obliquely to form an air chamber to wrap the bacterial solution. After inoculation, culture in the dark for 24 hours. After removing the shade cloth, continue to culture under normal light. After 7 days of inoculation, cut the leaves and take pictures to record the disease situation. Use Photoshop software to count the area of ​​lesions on the inoculated leaves, so as to complete the evaluation of the knockout mutant's resistance to rice blast.

[0050] The results are as follows Figure 3 As shown, compared with the wild type, the lesion area in the leaves of the homozygous knockout mutant line oscmpg1-7 was significantly lower than that of the wild type, indicating that after the OsCMPG1 gene was knocked out, the wild type's resistance to rice blast was significantly enhanced.

[0051] Example 5 Identification of resistance to bacterial blight using the leaf clipping inoculation method

[0052] The wild-type Nipponbare (NIP) and knockout mutant lines oscmpg1-5 and oscmpg1-7 were planted in a greenhouse, and the rice grown for 6 weeks was inoculated with bacterial blight pathogen.

[0053] First, the PXO99A strain of Xanthomonas spp. frozen at -80°C was streaked on a beef extract peptone solid medium plate containing cephalexin antibiotics and cultured at 28°C for one day. A single colony was picked and added to a beef extract peptone liquid medium containing cephalexin antibiotics, and after shaking at 28°C for 48 hours, the bacteria were collected by centrifugation at 9000 rpm for 3 min. The bacteria were resuspended in 0.1 M MgCl2 solution, centrifuged at 9000 rpm for 3 min, and the supernatant was discarded. Repeat once, and finally the bacteria were resuspended in 0.1 M MgCl2 solution. The OD600 of the bacterial suspension was adjusted to 1.0 using a spectrophotometer and set aside.

[0054] During inoculation, the rice grown for 6 weeks was moved to a place with suitable light and no rain. The bacterial suspension was dipped into sterilized scissors and cut about 10 cm below the tip of the penultimate leaf of each rice plant. The leaves were left for two weeks, and the leaves were sprayed with distilled water regularly to keep them moist. The length of the diseased spots was measured after two weeks, and the length of the lesions on the leaves of the wild-type NIP and the knockout mutant lines oscmpg1-5 and oscmpg1-7 was compared to complete the evaluation of the knockout mutant's resistance to bacterial blight.

[0055] The results are as follows Figure 4 As shown, compared with the wild type, the length of lesions on the leaves of the knockout mutant lines oscmpg1-5 and oscmpg1-7 was significantly shorter than that of the wild type, indicating that the knockout mutant lines oscmpg1-5 and oscmpg1-7 had significantly enhanced resistance to bacterial blight.

Claims

1. Rice OsCMPG1 gene, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO.

1.

2. Use of the rice OsCMPG1 gene as shown in SEQ ID NO.1 in the preparation of rice varieties resistant to rice blast and rice bacterial blight.

3. A method for breeding rice for disease resistance, characterized in that: The OsCMPG1 gene of the knockout rice variety is shown in SEQ ID NO.1 in the sequence list.

4. A rice disease resistance breeding method according to claim 3, characterized in that: The knockout is achieved using CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the knockout target is: CGTCTCAGCAACGATATCTCtgg.

5. A gene knockout vector, characterized in that : A vector obtained by inserting the target nucleotide sequence CGTCTCAGCAACGATATCTCtgg of the OsCMPG1 gene into the vector pYLCRISPR / Cas9Pubi-H.

Images