Primer probe combination and kit for detecting acinetobacter baumannii, stenotrophomonas maltophilia and burkholderia cepacia

Abstract

The invention provides a primer probe combination and a kit for detecting acinetobacter baumannii, stenotrophomonas maltophilia and burkholderia cepacia, and relates to the technical field of biology. The primer probe combination provided by the invention comprises a primer and a probe for detecting the acinetobacter baumannii, the stenotrophomonas maltophilia and the burkholderia cepacia, and can be used for accurately and quickly identifying the acinetobacter baumannii, the stenotrophomonas maltophilia and the burkholderia cepacia in a reaction system at the same time; and the kit has good specificity and sensitivity (the lowest detection limit on acinetobacter baumannii, stenotrophomonas maltophilia and burkholderia cepacia is 50 CFU / mL).

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer-probe combination and a kit for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia. Background Art

[0002] Acinetobacter baumannii (Aba) is a Gram-negative bacillus that is widely distributed in the environment and is a conditional pathogen in the human body. The bacterium is widely distributed in hospital environments and mainly causes respiratory tract infections. It poses a great threat to critically ill patients and patients in CCU and ICU, and its drug resistance is becoming increasingly serious.

[0003] Stenotrophomonas maltophilia (Sma) is a non-fermenting, aerobic, non-spore-forming Gram-negative bacillus that is widely found in nature and hospital environments. It has become an important opportunistic pathogen. It can cause lower respiratory tract infections, acute exacerbations of chronic obstructive pulmonary disease, and promote the occurrence and development of certain cancers, such as obstructive lung cancer.

[0004] Burkholderia cepacia (Bcc) is a Gram-negative, motile, aerobic bacterium with non-fermenting properties. It is an opportunistic pathogen that causes disease primarily in immunocompromised individuals. More serious illnesses caused by it include pneumonia or other bacterial infections.

[0005] Acinetobacter baumannii, Stenotrophomonas maltophilia, and Burkholderia cepacia are all common in hospitalized patients, and the symptoms of infection are the same, but the medication is different. If the type of pathogen cannot be identified in time, it is easy to be misdiagnosed or ignored, resulting in delayed treatment of the disease. At present, microbial culture is the "gold standard" for detection, but the culture method is complicated and time-consuming, and is affected by factors such as patient medication, resulting in a low detection rate; fluorescent quantitative PCR detection technology has strong specificity and high sensitivity, and implements a completely closed-tube operation, which reduces the cross-contamination of amplification products. In recent years, this technology has been widely used in various fields such as biology, medicine, and in vitro diagnosis. There are relevant detection reagents for pathogens such as Acinetobacter baumannii, Stenotrophomonas maltophilia, and Burkholderia cepacia, but due to the unreasonable selection of gene fragments and the design of primers and probes, most detection reagents cannot achieve accurate, rapid, and sensitive detection.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The first objective of the present invention is to provide a primer-probe combination to solve the above technical problems.

[0008] The second object of the present invention is to provide the use of the above primer-probe combination in the preparation of products for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0009] The third object of the present invention is to provide a kit for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0010] The fourth object of the present invention is to provide a method for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia for non-disease diagnosis and treatment purposes.

[0011] In order to achieve the above objectives, the following technical solutions are adopted:

[0012] In a first aspect, the present invention provides a primer-probe combination, comprising primers and probes for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia;

[0013] The primers for detecting Acinetobacter baumannii have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe for detecting Acinetobacter baumannii has the nucleotide sequence shown in SEQ ID NO.3;

[0014] The primers for detecting Stenotrophomonas maltophilia have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe for detecting Stenotrophomonas maltophilia has the nucleotide sequence shown in SEQ ID NO.6;

[0015] The primers used to detect Burkholderia cepacia have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe used to detect Burkholderia cepacia has a nucleotide sequence as shown in SEQ ID NO.9.

[0016] As a further technical solution, it also includes an internal standard primer and an internal standard probe;

[0017] The nucleotide sequences of the internal standard primers are shown in SEQ ID NO.10 and SEQ ID NO.11;

[0018] The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.12.

[0019] As a further technical solution, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;

[0020] The fluorescent reporter group includes FAM, ROX, CY5 or HEX;

[0021] The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.

[0022] As a further technical solution, the fluorescent reporter groups of the various probes are different from each other.

[0023] In a second aspect, the present invention provides the use of the above primer-probe combination in the preparation of products for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0024] In a third aspect, the present invention provides a kit for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, comprising the above-mentioned primer-probe combination and PCR premix.

[0025] As a further technical solution, the PCR premix includes dNTPs, rTth enzyme, manganese acetate, Mg 2+ and buffer.

[0026] As a further technical solution, negative and positive controls are also included;

[0027] The negative control includes water;

[0028] The positive controls were Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0029] In a fourth aspect, the present invention provides a method for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia for non-disease diagnosis and treatment purposes, comprising the following steps:

[0030] The genomic DNA of the sample to be tested is used as a template, and the above primer probe combination or the above kit is used to perform a PCR reaction, and whether the sample to be tested contains Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia is determined according to the amplified Ct value.

[0031] As a further technical solution, when the primers used to detect Acinetobacter baumannii do not amplify, and the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Acinetobacter baumannii;

[0032] When the primers used to detect Acinetobacter baumannii amplify and the Ct value is ≤35, the sample to be tested is positive for Acinetobacter baumannii;

[0033] When the primers used to detect Stenotrophomonas maltophilia do not amplify, and the internal standard primers amplify with a Ct value ≤ 35, the sample to be tested is negative for Stenotrophomonas maltophilia;

[0034] When the primers used to detect Stenotrophomonas maltophilia amplify and the Ct value is ≤34, the sample to be tested is positive for Stenotrophomonas maltophilia;

[0035] When the primers used to detect Burkholderia cepacia do not amplify, but the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Burkholderia cepacia;

[0036] When the primers used to detect Burkholderia cepacia amplify and the Ct value is ≤34, the sample to be tested is positive for Burkholderia cepacia;

[0037] When the internal standard primer does not amplify or the Ct value is >35, the test result is invalid.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The primer-probe combination provided by the present invention can accurately and quickly identify Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia in one reaction system, and has good specificity and sensitivity (the minimum detection limit for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia is 50 CFU / mL). BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 is the amplification curve of the kit of the present invention for Acinetobacter baumannii;

[0042] Figure 2 This is the amplification curve of patent CN106434996 A for Acinetobacter baumannii;

[0043] Figure 3 is the amplification curve of the kit of the present invention for Stenotrophomonas maltophilia;

[0044] Figure 4 This is the amplification curve of patent CN117210586 A for Stenotrophomonas maltophilia;

[0045] Figure 5 is the amplification curve of the kit of the present invention for Burkholderia cepacia;

[0046] Figure 6 This is the amplification curve of patent CN116064866 A for Burkholderia cepacia;

[0047] Figure 7 It is the non-specific amplification detection result of the kit of the present invention;

[0048] Figure 8 This is the result of non-specific amplification detection in the control scheme. DETAILED DESCRIPTION

[0049] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0050] Generally, the nomenclature and its technology used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally carried out according to conventional methods as well-known in the art, and as described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's specifications, as generally achieved in the art, or as described herein. The nomenclature and its laboratory procedures and technology used in conjunction with analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0051] In a first aspect, the present invention provides a primer-probe combination, comprising primers and probes for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia;

[0052] The primers for detecting Acinetobacter baumannii have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe for detecting Acinetobacter baumannii has the nucleotide sequence shown in SEQ ID NO.3;

[0053] The primers for detecting Stenotrophomonas maltophilia have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe for detecting Stenotrophomonas maltophilia has the nucleotide sequence shown in SEQ ID NO.6;

[0054] The primers used to detect Burkholderia cepacia have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe used to detect Burkholderia cepacia has a nucleotide sequence as shown in SEQ ID NO.9.

[0055] The primer-probe combination provided by the present invention can accurately, quickly and sensitively identify Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, and has good specificity and sensitivity (the minimum detection limit for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia is 50 CFU / mL).

[0056] In the present invention, the amplified fragment of the primer used to detect Acinetobacter baumannii is shown in SEQ ID NO.13:

[0057] tgttgagtttggccttgttggataactaaaacacccgtagtgtgtgcttcgttaaataaatttttaattttctctgctttttcatcagattttgaagcactgtgatttggattagcagacactataaaggtgagcaggctgaaataaaa (SEQ ID NO. 13).

[0058] The amplified fragment of the primer used to detect Stenotrophomonas maltophilia is shown in SEQ ID NO.14:

[0059] gccccactattgagctcttggcgcatgacggaacaactagtcgttcaccggtacgaacaacccgatgacaa ggggctgagctggcctcgcatcgtcggcatcgcgtttgtaatcg (SEQ ID NO. 14).

[0060] The amplified fragment of the primer used to detect Burkholderia cepacia is shown in SEQ ID NO.15:

[0061] cacctcgtgtgcctcgattgcggccgcgtcgaggaattcttcgatgccgagatcgaaggccgccagcagg cgatcgcgaaggaacgcggcttccggctgcaggagcactcgctcgc (SEQ ID NO. 15).

[0062] In some optional embodiments, it further comprises an internal standard primer and an internal standard probe;

[0063] The nucleotide sequences of the internal standard primers are shown in SEQ ID NO.10 and SEQ ID NO.11;

[0064] The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.12.

[0065] In some optional embodiments, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;

[0066] The fluorescent reporter group includes but is not limited to FAM, ROX, CY5 or HEX, or other fluorescent reporter groups known to those skilled in the art;

[0067] The fluorescence quenching group includes, but is not limited to, TAMRA, BHQ1 or BHQ2, or other fluorescence quenching groups known to those skilled in the art.

[0068] In some optional embodiments, the fluorescent reporter groups of each probe are different.

[0069] In a second aspect, the present invention provides the use of the above primer-probe combination in the preparation of products for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0070] The primer-probe combination provided by the present invention can specifically identify and amplify the gene sequence of Acinetobacter baumannii, Stenotrophomonas maltophilia or Burkholderia cepacia, and can be used to prepare products for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0071] In a third aspect, the present invention provides a kit for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, comprising the above-mentioned primer-probe combination and PCR premix.

[0072] The kit includes the primer-probe combination of the present invention, and can therefore be used to detect Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, solving the technical problems of low efficiency, poor specificity and low sensitivity of existing kits, and has low cost.

[0073] In some optional embodiments, the PCR premix includes dNTPs, rTth enzyme, manganese acetate, Mg 2+ and buffer.

[0074] In some optional embodiments, negative controls and positive controls are also included;

[0075] The negative control includes water;

[0076] The positive controls are Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, preferably at a concentration of 1×10 6 CFU / ml of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0077] In a fourth aspect, the present invention provides a method for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia for non-disease diagnosis and treatment purposes, comprising the following steps:

[0078] The genomic DNA of the sample to be tested is used as a template, and the above primer probe combination or the above kit is used to perform a PCR reaction, and whether the sample to be tested contains Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia is determined according to the amplified Ct value.

[0079] This detection method is simple and can achieve rapid, accurate and sensitive detection of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

[0080] In some optional embodiments, when the primers used to detect Acinetobacter baumannii do not amplify, and the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Acinetobacter baumannii;

[0081] When the primers used to detect Acinetobacter baumannii amplify and the Ct value is ≤35, the sample to be tested is positive for Acinetobacter baumannii;

[0082] When the primers used to detect Stenotrophomonas maltophilia do not amplify, and the internal standard primers amplify with a Ct value ≤ 35, the sample to be tested is negative for Stenotrophomonas maltophilia;

[0083] When the primers used to detect Stenotrophomonas maltophilia amplify and the Ct value is ≤34, the sample to be tested is positive for Stenotrophomonas maltophilia;

[0084] When the primers used to detect Burkholderia cepacia do not amplify, but the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Burkholderia cepacia;

[0085] When the primers used to detect Burkholderia cepacia amplify and the Ct value is ≤34, the sample to be tested is positive for Burkholderia cepacia;

[0086] When the internal standard primer does not amplify or the Ct value is >35, the test result is invalid.

[0087] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0088] Example 1 Preparation of a triple nucleic acid detection kit for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia

[0089] The primer and probe sequences in the kit are shown in Table 1 below.

[0090] Table 1: Primer and probe sequences

[0091] name Sequence number Nucleotide sequence Aba upstream primer SEQ ID NO: 1 tgttgagtttggccttgttg Aba downstream primer SEQ ID NO: 2 ttttatttcagcctgctcacc Aba probe SEQ ID NO: 3 aaacacccgtagtgtgtgcttcg Sma upstream primer SEQ ID NO: 4 gccccactattgagctcttg Sma downstream primer SEQ ID NO: 5 cgattacaaacgcgatgc Sma probe SEQ ID NO: 6 ggctgagctggcctcgcatc Bcc upstream primer SEQ ID NO: 7 cacctcgtgtgcctcgatt Bcc downstream primer SEQ ID NO: 8 gcgagcgagtgctcctg Bcc probe SEQ ID NO: 9 ccgccagcaggcgatcgc Internal standard upstream primer SEQ ID NO: 10 tggttgggataaggctggat Internal standard downstream primer SEQ ID NO: 11 cactggtggggtgaattctt Internal standard probe SEQ ID NO: 12 cctcccacagctcctgggca

[0092] Wherein, the 5' end of the probe as shown in SEQ ID NO.3 is connected to a FAM fluorescent group;

[0093] The 5' end of the probe as shown in SEQ ID NO.6 is connected to a ROX fluorescent group;

[0094] The 5' end of the probe as shown in SEQ ID NO.9 is connected to the CY5 fluorescent group;

[0095] As shown in SEQ ID NO. 12, the 5' end of the probe is connected to a HEX fluorescent group.

[0096] The kit also includes: 20mM dNTPs, 5u / μl rTth enzyme, 20mM MgCl2, 1M Tricine buffer. The kit also includes a negative control (sterile water) and a positive control (artificially synthesized concentration of 1×10 5 CFU / mL of engineered bacteria).

[0097] Example 2 Detection method of the kit of the present invention

[0098] The detection method of the present invention is Real Time RT-PCR, and the Real Time RT-PCR reaction process is (1) pre-denaturation, the time and length depend on the length and base composition of the target nucleic acid, the pre-denaturation temperature is generally 90°C to 105°C, the time is generally 2 to 10 minutes, and the purpose of pre-denaturation is to completely separate the double-stranded nucleic acid sequence into a single strand; (2) denaturation, the temperature is generally 90°C to 100°C, and the time is generally 10s to 5min; (3) annealing, annealing each primer to the target sequence of Acinetobacter baumannii, Stenotrophomonas maltophilia, and Burkholderia cepacia or the internal standard quality control nucleic acid. The annealing temperature is generally 50°C to 65°C, and the annealing time can be 10s to 120s; (4) extension, the primer binds to the template and starts to synthesize a new DNA double strand, the extension temperature is generally 55°C to 75°C, and the extension time can be 10s to 2min.

[0099] The composition of each detection system is shown in Table 2:

[0100] Table 2: Detection system

[0101]

[0102] The reagent can be stored at 2-8℃ for 1 year.

[0103] Fluorescence detection channel selection: (1) Select the FAM channel to detect Acinetobacter baumannii; (2) Select the ROX channel to detect Stenotrophomonas maltophilia; (3) Select the CY5 channel to detect Burkholderia cepacia; (4) Select the HEX channel to detect the internal standard. The fluorescence quantitative real-time reaction conditions are shown in Table 3.

[0104] Table 3: Fluorescence quantitative real-time PCR reaction conditions

[0105]

[0106] After the reaction is completed, the instrument automatically saves the results, uses the instrument's own software to automatically analyze, and then records the sample CT value and fixed value results. The specific test results are analyzed as follows:

[0107] The probe channel shown in SEQ ID NO.3 has no fluorescence value, and the CT value of the probe channel shown in SEQ ID NO.12 is ≤35, and the test result is reported as negative;

[0108] The CT value of the probe channel shown in SEQ ID NO. 3 is ≤35, which is reported as positive for Acinetobacter baumannii;

[0109] The probe channel shown in SEQ ID NO.6 has no fluorescence value, and the CT value of the probe channel shown in SEQ ID NO.12 is ≤35, and the test result is reported as negative;

[0110] The CT value of the probe channel shown in SEQ ID NO. 6 is ≤34, and it is reported as Stenotrophomonas maltophilia;

[0111] The probe channel shown in SEQ ID NO.9 has no fluorescence value, and the CT value of the probe channel shown in SEQ ID NO.12 is ≤35, and the test result is reported as negative;

[0112] The CT value of the probe channel shown in SEQ ID NO. 9 is ≤34, and it is reported as Burkholderia cepacia;

[0113] When the CT value of the probe channel shown in SEQ ID NO. 12 is greater than 35, the test result is invalid, the cause should be found and eliminated, and the test should be repeated.

[0114] Example 3 Feasibility test of the kit of the present invention

[0115] 1. Limit of Detection (LOD) Test

[0116] (1) Preparation of triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia: The triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia was prepared by the method of Example 1.

[0117] (2) Bacterial sample extraction

[0118] The bacterial solutions of 5 different concentrations of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia in the tube were mixed with a pipette, 800 μl was taken out and put into a new sample tube, and the nucleic acid extraction or purification reagent (Yu Zheng Xie Bei No. 20180037) produced by Antu Bioengineering Co., Ltd. was used for extraction.

[0119] (3) Sample testing

[0120] 40 μl of the treated nucleic acid was added to the triple nucleic acid detection reagent reaction tube of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, with 21 replicate wells for each concentration. At the same time, 40 μl of pure water was added to the detection solution as a negative control, and the detection was performed according to the detection method in Example 2.

[0121] (4) Results analysis

[0122] By using the kit prepared in Example 1 and the detection method of Example 2, samples of each concentration gradient of the triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia were detected, indicating that the detection sensitivity (LOD) of the detection method for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia was 50 CFU / mL. The specific data are shown in Tables 4, 5 and 6.

[0123] Table 4: Confirmation of detection limit of Acinetobacter baumannii

[0124] Sample concentration (CFU / ml) Detection of repeat count Number of positive tests Positive detection rate 6 21 3 14.29％ 12 21 7 33.33％ 25 21 16 76.19％ 50 21 20 95.00％ 100 21 21 100.00％

[0125] Table 5: Confirmation of detection limits for Stenotrophomonas maltophilia

[0126] Sample concentration (CFU / ml) Detection of repeat count Number of positive tests Positive detection rate 6 21 2 9.52％ 12 21 6 28.57％ 25 21 15 71.43％ 50 21 20 95.00％ 100 21 21 100.00％

[0127] Table 6: Confirmation of detection limits for Burkholderia cepacia

[0128] Sample concentration (CFU / ml) Detection of repeat count Number of positive tests Positive detection rate 6 21 4 19.05％ 12 21 9 42.86％ 25 21 18 85.71％ 50 21 20 95.00％ 100 21 21 100.00％

[0129] 2. Cross-reactions with other diseases

[0130] (1) Preparation of triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia: The triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia was prepared by the method of Example 1.

[0131] (2) Cross-pathogen sample extraction

[0132] The Escherichia coli, Serratia marcescens, Enterococcus faecalis, Candida albicans, Streptococcus pyogenes, Micrococcus luteus, Rhodococcus equi, Acinetobacter junii, Enterobacter aerogenes, Haemophilus haemolyticus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Candida glabrata, Candida tropicalis, Acinetobacter lwoffi, Acinetobacter haemolyticus, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Haemophilus influenzae, Streptococcus pneumoniae, Legionella pneumophila, and Moraxella catarrhalis in the tube were mixed with a pipette, 800 μl was taken out and put into a new sample tube, and the nucleic acid extraction or purification reagent (Yu Zheng Equipment No. 20180037) produced by Antu Bioengineering Co., Ltd. was used for extraction.

[0133] (3) Sample testing

[0134] 40 μl of the treated nucleic acid was added to the triple nucleic acid detection reagent reaction tube of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia. At the same time, 40 μl of pure water was added to the detection solution as a negative control. The extracted Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia were used as positive control tests, and the detection was carried out according to the detection method in Example 2.

[0135] (4) Results analysis

[0136] By using the kit prepared in Example 1 and the detection method of Example 2, other pathogens other than Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia were detected. The results showed that the kit of the present invention was positive for the positive controls of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, and negative for the negative control. There was no cross reaction with pathogen infection samples such as Escherichia coli, Serratia marcescens, Enterococcus faecalis, Candida albicans, Streptococcus pyogenes, Micrococcus luteus, Rhodococcus equi, Acinetobacter junii, Enterobacter aerogenes, Haemophilus haemolyticus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Candida glabrata, Candida tropicalis, Acinetobacter lwoffii, Acinetobacter haemolyticus, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Haemophilus influenzae, Streptococcus pneumoniae, Legionella pneumophila, Moraxella catarrhalis and the like, indicating that it has high specificity. The specific results are shown in Table 7.

[0137] Table 7: Cross-reactivity experiments

[0138] Sample name Test results Sample name Test results Acinetobacter baumannii Positive Haemophilus hemolyticus Negative Stenotrophomonas maltophilia Positive Mycoplasma pneumoniae Negative Burkholderia cepacia Positive Chlamydia pneumoniae Negative Escherichia coli Negative Neisseria meningitidis Negative Serratia marcescens Negative Candida glabrata Negative Enterococcus faecalis Negative Candida tropicalis Negative Candida albicans Negative Acinetobacter lwoffii Negative Streptococcus pyogenes Negative Acinetobacter hemolyticus Negative Micrococcus luteus Negative Staphylococcus aureus Negative Rhodococcus equi Negative Methicillin-resistant Staphylococcus aureus Negative Acinetobacter junii Negative Klebsiella pneumoniae Negative Enterobacter aerogenes Negative Pseudomonas aeruginosa Negative Haemophilus influenzae Negative Legionella pneumophila Negative Streptococcus pneumoniae Negative Moraxella catarrhalis Negative

[0139] 3. Anti-interference to potential interfering substances

[0140] (1) Preparation of triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia: The triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia was prepared by the method of Example 1.

[0141] (2) Sample processing

[0142] The high and low concentration values ​​of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia were selected. The two concentration values ​​of Acinetobacter baumannii were 1×10 8 CFU / ml and 100 CFU / ml, the two concentration values ​​of Stenotrophomonas maltophilia are 1×10 8 CFU / ml and 100 CFU / ml, the two concentration values ​​of Burkholderia cepacia were 1×10 8 CFU / ml and 100 CFU / ml. At the same time, the interfering substances were added to the corresponding samples at 3 times the peak concentration (Cmax), the samples were treated with the cross-reaction method in Example 3, and the detection was performed according to the detection method in Example 2.

[0143] (3) Results analysis

[0144] Interference judgment: If the interference rate % is less than the accuracy bias allowed by the industry standard of the project (set to 10%), it can be judged as passed.

[0145] The interference rate calculation formula is: (interference sample concentration × control sample concentration) / control sample concentration × 100%.

[0146] The test shows that when the sample contains common drugs and endogenous interfering substances such as meropenem, imipenem, cefoperazone sulbactam, moxifloxacin, amikacin, linezolid, vancomycin, sodium chloride, human whole blood, purified mucin, heme, dexamethasone, histamine hydrochloride, menthol, oseltamivir, mupirocin, etc., the detection sensitivity of the kit of the present invention will not be significantly interfered, as shown in Table 8 for details.

[0147] Table 8: Anti-interference experiment of interfering substances

[0148] Drug Name Interference rate (%) Drug Name Interference rate (%) Meropenem 1.5％ Sodium chloride 0.7％ Imipenem 0.8* Human whole blood 2.6％ Cefoperazone and sulbactam 1.2％ Purification of mucin 2.3％ Moxifloxacin 1.9％ Heme 1.2％ Amikacin 2.1％ Dexamethasone 1.4％ Linezolid 3.5％ Histamine hydrochloride 0.8％ Vancomycin 0.5％ Menthol 3.7％ Oseltamivir 0.6％ Mupirocin 1.8％

[0149] 3. Detection of Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia in environmental water samples.

[0150] (1) Preparation of triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia: The triple nucleic acid detection reagent for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia was prepared by the method of Example 1.

[0151] (2) Sample extraction from water bodies

[0152] Water samples from three different hospital environments were collected using sterile glass tubes and numbered P1 and P3 respectively. 800 μl was taken out and placed in a new sample tube. The nucleic acid extraction or purification reagent produced by Antu Bioengineering Co., Ltd. (Yu Zheng Xie Bei No. 20180037) was used for extraction.

[0153] (3) Sample testing

[0154] 40 μl of the processed sample nucleic acid was added to the reaction tubes of nucleic acid detection reagents for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, and 40 μl of pure water was added to the detection solution as a negative control. The detection was performed according to the detection method in Example 2.

[0155] (4) Results analysis

[0156] By using the kit prepared in Example 1 and the detection method of Example 2, the triple nucleic acid detection reagents for Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia were used to detect three water samples from different hospital environments. The results showed that water sample P1 was positive for Acinetobacter baumannii and Burkholderia cepacia, P2 was positive for Stenotrophomonas maltophilia, P3 was positive for Burkholderia cepacia, and the rest of the results were negative. The specific data are shown in Table 9.

[0157] Table 9: Detection experiments of pathogens in water samples

[0158] Sample No. Acinetobacter baumannii Stenotrophomonas maltophilia Burkholderia cepacia P1 Positive Negative Positive P2 Negative Positive Negative P3 Negative Negative Positive

[0159] Example 4 Comparison of the kit of the present invention with existing kits

[0160] (1) Sensitivity comparison

[0161] The kit of Example 1 and the method of Example 2 were used to treat 5×10 4 CFU / mL, 5×10 3 CFU / mL, 5×10 2 The results of the tests were as follows: Figure 1 , 3 , as shown in Figure 5.

[0162] The primers, probes and methods in patents CN106434996 A (reference document 1), CN117210586 A (reference document 2) and CN116064866 A (reference document 3) were used to detect 5×10 4 CFU / mL, 5×10 3 CFU / mL, 5×10 2The results of the tests were as follows: Figure 2 , 4 , as shown in Figure 6.

[0163] (2) Specificity comparison

[0164] The specificity of the kit and method of the present invention was compared with the kit composed of primers and probes in patents CN106434996 A, CN117210586 A and CN116064866 A. The results showed that (such as Figure 7 and Figure 8 As shown in the figure, when the blank control (water) is amplified in the present invention, the detection result is No Ct value and the amplification curve is a flat line. However, when the primer-probe combination in the patent is used for testing, the blank control will show a value, indicating that non-specific amplification occurs when the primer-probe combination in the comparative document is used, while the method of the present invention does not find the same problem, indicating that the primer-probe and kit of the present invention have good specificity and non-specific amplification will not occur in the system.

[0165] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe combination, characterized in that: Includes primers and probes for detection of Acinetobacter baumannii, Stenotrophomonas maltophilia, and Burkholderia cepacia; The primers for detecting Acinetobacter baumannii have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe for detecting Acinetobacter baumannii has the nucleotide sequence shown in SEQ ID NO.3; The primers for detecting Stenotrophomonas maltophilia have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe for detecting Stenotrophomonas maltophilia has the nucleotide sequence shown in SEQ ID NO.6; The primers used to detect Burkholderia cepacia have nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe used to detect Burkholderia cepacia has a nucleotide sequence as shown in SEQ ID NO.

9.

2. The primer-probe combination according to claim 1, characterized in that: Also included are internal standard primers and internal standard probes; The nucleotide sequences of the internal standard primers are shown in SEQ ID NO.10 and SEQ ID NO.11; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.

12.

3. The primer-probe combination according to claim 1 or 2, characterized in that: The 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group; The fluorescent reporter group includes FAM, ROX, CY5 or HEX; The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.

4. The primer-probe combination according to claim 3, characterized in that: The fluorescent reporter groups of each probe are different.

5. Use of the primer-probe combination according to any one of claims 1 to 4 in preparing a product for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

6. A kit for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia, characterized in that: It comprises the primer-probe combination and PCR premix according to any one of claims 1 to 4.

7. The kit according to claim 6, characterized in that The PCR premix includes dNTPs, rTth enzyme, manganese acetate, Mg 2+ and buffer.

8. The kit according to claim 7, characterized in that Negative and positive controls were also included; The negative control includes water; The positive controls were Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia.

9. A method for detecting Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia for non-disease diagnosis and treatment purposes, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, a PCR reaction is performed using the primer-probe combination described in any one of claims 1 to 4 or the kit described in any one of claims 6 to 8, and judging whether the sample to be tested contains Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia based on the amplified Ct value.

10. The method according to claim 9, characterized in that When the primers used to detect Acinetobacter baumannii do not amplify, but the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Acinetobacter baumannii; When the primers used to detect Acinetobacter baumannii amplify and the Ct value is ≤35, the sample to be tested is positive for Acinetobacter baumannii; When the primers used to detect Stenotrophomonas maltophilia do not amplify, and the internal standard primers amplify with a Ct value ≤ 35, the sample to be tested is negative for Stenotrophomonas maltophilia; When the primers used to detect Stenotrophomonas maltophilia amplify and the Ct value is ≤34, the sample to be tested is positive for Stenotrophomonas maltophilia; When the primers used to detect Burkholderia cepacia do not amplify, but the internal standard primers amplify and the Ct value is ≤35, the sample to be tested is negative for Burkholderia cepacia; When the primers used to detect Burkholderia cepacia amplify and the Ct value is ≤34, the sample to be tested is positive for Burkholderia cepacia; When the internal standard primer does not amplify or the Ct value is >35, the test result is invalid.

Images