Allium fistulosum double haploid breeding method

Abstract

The invention discloses a vegetable breeding method, particularly relates to a green Chinese onion double haploid breeding method, and belongs to the technical field of biotechnology and double haploid breeding. A green Chinese onion double haploid breeding method comprises the following steps: (1) field planting and sampling; (2) carrying out in-vitro gynogenesis culture to induce the embryoid, and taking MS, 1.0 mg.L <-12 >, 4-D, 0.04 mg.L <-1 > NAA, 2.5 mg.L <-16 >-BA, 10% sucrose and 7g.L <-1 > agar as an induction culture medium; (3) culturing embryos and obtaining regenerated plants; (4) cultivation of green Chinese onion seeds. According to the breeding method, the breeding process is accelerated, the pure line is rapidly obtained, the highly homozygous DH line can be obtained only through one generation, the situation that 4-5 generations of continuous selfing are generally needed for breeding of the pure line in a traditional breeding method is changed, the breeding period is remarkably shortened, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to a vegetable breeding method, in particular to a double haploid breeding method for green onions, and belongs to the technical field of biotechnology and double haploid breeding. Background Art

[0002] Welsh onion is a variant of the Allium fistulosum species in the Amaryllidaceae family. It is a two- to three-year-old herbaceous plant that produces thick pseudostems and tender leaves composed of leaf sheaths. It is native to my country and has a long history of cultivation and rich varieties. It is one of the earliest important vegetable crops cultivated and utilized, and is also a very important seasoning vegetable. Welsh onion is a typical cross-pollinated crop with very obvious hybrid vigor. As a cross-pollinated plant, the parent used to prepare hybrids needs to be self-pollinated for many generations to purify and select inbred lines. It generally takes 4-5 generations of self-pollination and selection to cultivate a stable and inherited excellent inbred line. Not only is the breeding cycle long, but continuous self-pollination will lead to a decline in vitality. Therefore, the rapid cultivation of excellent homozygous inbred lines is the key to the technology of utilizing the heterosis of welsh onions.

[0003] Haploid plants must double their chromosomes to become double haploids before they can be used in genetics and breeding research. It is known that in the unfertilized ovary or ovule culture of some plants, in addition to producing haploids, a certain proportion of spontaneously doubled double haploids will be obtained, such as beet, melon, and gerbera. In breeding technology, double haploid refers to pure lines, referred to as DH lines. The pure line offspring homozygosity rate obtained by double haploid breeding is 100%, and the pure line homozygosity rate obtained by self-pollination does not reach 100% no matter how many generations. Therefore, hybrid breeding requires that the parent pure line is as pure as possible. For green onions, there is no report on double haploid breeding. Therefore, developing a double haploid breeding method for green onions to improve the homozygosity rate and breeding speed has become a technical problem that those skilled in the art urgently need to solve. Summary of the invention

[0004] The purpose of the present invention is to solve the above technical problems and provide a double haploid breeding method for green onions, which can shorten the breeding period and improve the breeding efficiency.

[0005] In order to achieve the above object, the present invention is achieved through the following technical solutions: A double haploid breeding method for green onions, comprising the following steps: (1) Field planting and sampling: Take green onion seeds, sow and raise seedlings in a greenhouse, and when the green onion buds open, remove the green onion flower balls that are one quarter open and store them in a refrigerator at 3-5°C for 15-24 hours. Select the flower buds that open the next day, clean, disinfect, and sterilize them for later use; (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-1 6-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH value of the induction medium was adjusted. The induction medium was then placed in a culture vessel. After sterilization, the flower buds disinfected in step (1) were inoculated into the culture vessel containing the induction medium using sterilized tweezers. One flower bud was cultivated for every 1.3-1.7 mL of culture medium. After inoculation, the culture vessel was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , culture in a culture room at a temperature of 22-25°C for 30-35 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at a temperature of 23-27°C for 12 h / d. -1 Cultivate in a lighted culture room, grow embryoids into seedlings after 30-50 days of culture, transfer the seedlings to MS+2% sucrose+7% agar rooting medium, grow multiple roots after 15-20 days, and obtain rooted seedlings, harden and transplant the rooted seedlings, take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, transfer them into the matrix, and place them in a culture environment nutrient soil with a relative humidity of 80-90% and a temperature of 15-24°C for growth for 25-30 days, and finally obtain regenerated green onion plants; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom the next year, separate the plants into bags, pollinate them, and harvest them according to the seed maturity standards to obtain double haploid green onion seeds.

[0006] Preferably, the sowing and raising of seedlings in the greenhouse in step (1) is specifically as follows: sowing and raising seedlings in the greenhouse in mid-April, transplanting in mid-June, managing under conventional cultivation conditions, harvesting the green onion plants in mid-to-late October, storing under well-ventilated conditions, and transplanting the green onion plants in the greenhouse in mid-January of the following year.

[0007] Preferably, the cleaning and disinfection of the flower buds in step (1) above specifically comprises rinsing with running water for 25-35 minutes and surface disinfection with 75% ethanol solution on a clean bench for 30 seconds.

[0008] Preferably, the sterilization in step (1) is performed by using 0.1% mercuric chloride for 5 minutes and rinsing with sterile water for 3 to 5 times.

[0009] Preferably, the pH of the induction medium in step (2) is adjusted to 5.8 using 1% NaOH solution before packaging.

[0010] Preferably, the sterilization in step (2) is to sterilize the culture vessel and the induced culture in a high pressure automatic sterilizer at 121° C. for 20 min.

[0011] Preferably, the rooting seedling hardening and transplanting described in step (3) above specifically comprises first opening the sealing film, injecting distilled water into the culture bottle, and hardening the seedlings for 3 to 5 days so as not to submerge the seedlings, and replenishing water in time when water is lacking during this period.

[0012] Preferably, the matrix described in step (3) above is a matrix having a mass ratio of peat to perlite of 1:1.

[0013] Due to the adoption of the above technical solution, the present invention has the following advantages and effects: The breeding method of the present invention accelerates the breeding process, quickly obtains pure lines, and only needs one generation to obtain highly homozygous DH lines, which changes the traditional breeding method that generally requires continuous self-pollination for 4-5 generations for pure line selection, significantly shortens the breeding period, and improves breeding efficiency. The double haploid breeding method of green onions of the present invention can simplify the breeding procedure in the early stage of selection, that is, it reduces the workload of breeding compared with conventional breeding; DH lines can be used to preserve heterogeneous germplasm resources for a long time without the risk of genetic drift and other changes in gene frequency, and can also be used to deeply explore the breeding potential of each collected heterogeneous germplasm, evaluate each DH line in repeated tests in different environments, and help to effectively select quantitative traits in breeding; DH lines fix rare alleles and eliminate unfavorable recessive genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a graph showing the results of ploidy identification of green onion seed plants. DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to examples. It should be understood that the examples described herein are only used to explain the present invention and are not used to limit the present invention.

[0016] Unless otherwise specified, the following examples are all based on conventional methods or room temperature. Example 1

[0017] A double haploid breeding method for green onions, comprising the following specific steps: (1) Field planting and sampling: Take hybrid onion seeds, sow and raise seedlings in a greenhouse, sow and raise seedlings in a greenhouse in mid-April 2018, transplant in mid-June, and manage under conventional cultivation conditions. Harvest onion plants in mid-to-late October and store under well-ventilated conditions. Transplant the onion plants in a greenhouse in mid-January of the following year, and plant 1,000 square meters. When the onion buds open in late February, remove the onion flower balls that are one-quarter open and store them in a 3°C refrigerator for 24 hours. Select the flower buds that open the next day and rinse them with running water for 25 minutes. Disinfect the surface with 75% ethanol solution on a clean bench for 30 seconds, sterilize with 0.1% mercuric chloride for 5 minutes, rinse with sterile water three times, absorb the surface moisture, and set aside. (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-16-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH of the induction medium was adjusted to 5.8 with 1% NaOH solution before packaging. The induction medium was placed in a culture dish and sealed with a vinyl film. The culture dish and induction culture were sterilized in a high-pressure automatic sterilizer at 121°C for 20 min. The disinfected flower buds were inoculated into the culture dish containing the induction medium with sterilized tweezers. One flower bud was cultivated for every 1.3 mL of culture medium. After inoculation, the dish was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , cultured in a culture room at 23°C for 35 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at 23°C for 12 h / d. -1 Cultivate in a lighted culture room, and after 30 days of embryoid culture, grow into seedlings. The seedlings are transferred to MS+2% sucrose+7% agar rooting medium. After 15 days, multiple roots grow out, and rooted seedlings are obtained, with a rooting rate of 100%; harden the rooted seedlings and transplant them: first open the sealing film, inject distilled water into the culture bottle, and use the standard of not submerging the seedlings. Harden the seedlings for 3 days. If there is water shortage during this period, replenish water in time. Take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, and move them into a matrix with a mass ratio of peat and perlite of 1:1. Put it in a culture environment nutrient soil with a relative humidity of 80% and a temperature of 15°C for 25 days to obtain regenerated onion plants, with a survival rate of 78.2%; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom in January or February of the following year, isolate and bag the individual plants, pollinate the individual plants, and harvest them in early March according to the seed maturity standard to obtain double haploid green onion seeds. Example 2

[0018] A double haploid breeding method for green onions, comprising the following specific steps: (1) Field planting and sampling: Take hybrid onion seeds, sow and raise seedlings in a greenhouse, sow and raise seedlings in a greenhouse in mid-April 2018, transplant in mid-June, and manage under conventional cultivation conditions. Harvest onion plants in mid-to-late October and store under well-ventilated conditions. Transplant the onion plants in a greenhouse in mid-January of the following year, and plant 1,000 square meters. When the onion buds open in late February, remove the onion flower balls that are one-quarter open and store them in a 5°C refrigerator for 15 hours. Select the flower buds that open the next day and rinse them with running water for 35 minutes. Disinfect the surface with 75% ethanol solution on a clean bench for 30 seconds, sterilize with 0.1% mercuric chloride for 5 minutes, rinse with sterile water 5 times, dry the surface moisture, and set aside. (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-16-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH of the induction medium was adjusted to 5.8 with 1% NaOH solution before packaging. The induction medium was placed in a culture dish and sealed with a vinyl film. The culture dish and induction culture were sterilized in a high-pressure automatic sterilizer at 121°C for 20 min. The disinfected flower buds were inoculated into the culture dish containing the induction medium with sterilized tweezers. One flower bud was cultivated for every 1.7 mL of culture medium. After inoculation, the dish was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , cultured in a culture room at 25°C for 30 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at 27°C for 12 h / d. -1 Cultivate in a lighted culture room, and after 50 days of embryoid culture, grow into seedlings. The seedlings are transferred to MS+2% sucrose+7% agar rooting medium. After 20 days, multiple roots grow out, and rooted seedlings are obtained, with a rooting rate of 100%; train the rooted seedlings and transplant them: first open the sealing film, inject distilled water into the culture bottle, and use the standard of not submerging the seedlings. The seedlings are trained for 5 days. During the period of water shortage, water is replenished in time. Take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, and move them into a matrix with a mass ratio of peat and perlite of 1:1. Put it in a culture environment nutrient soil with a relative humidity of 90% and a temperature of 24°C for 25-30 days to obtain regenerated onion plants with a survival rate of 80.2%; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom in January or February of the following year, isolate and bag the individual plants, pollinate the individual plants, and harvest them in early March according to the seed maturity standard to obtain double haploid green onion seeds. Example 3

[0019] A double haploid breeding method for green onions, comprising the following specific steps: (1) Field planting and sampling: Take hybrid onion seeds, sow and raise seedlings in the greenhouse, sow and raise seedlings in the greenhouse in mid-April 2019, transplant in mid-June, and manage under conventional cultivation conditions. Harvest the onion plants in mid-to-late October and store them under well-ventilated conditions. In mid-January of the following year, transplant the onion plants in the greenhouse and plant 1,000 square meters. In late February, the onion buds open. Remove the onion flower balls that are one-quarter open and store them in a 4°C refrigerator for 20 hours. Select the flower buds that open the next day and rinse them with running water for 30 minutes. Disinfect the surface with 75% ethanol solution on a clean bench for 30 seconds, sterilize with 0.1% mercuric chloride for 5 minutes, rinse with sterile water 4 times, dry the surface moisture, and set aside. (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-16-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH of the induction medium was adjusted to 5.8 with 1% NaOH solution before packaging. The induction medium was placed in a culture dish and sealed with a vinyl film. The culture dish and induction culture were sterilized in a high-pressure automatic sterilizer at 121°C for 20 min. The disinfected flower buds were inoculated into the culture dish containing the induction medium with sterilized tweezers. One flower bud was cultivated for every 1.5 mL of culture medium. After inoculation, the dish was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , cultured in a culture room at 22°C for 32 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at 25°C for 12 h / d. -1 Cultivate in a lighted culture room, and after 40 days of embryoid culture, grow into seedlings. The seedlings are transferred to MS+2% sucrose+7% agar rooting medium. After 17 days, multiple roots grow out, and rooted seedlings are obtained, with a rooting rate of 100%; harden the rooted seedlings and transplant them: first open the sealing film, inject distilled water into the culture bottle, and use the standard of not submerging the seedlings. Harden the seedlings for 4 days. If there is a lack of water during this period, replenish water in time. Take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, and move them into a matrix with a mass ratio of peat and perlite of 1:1. Put it in a culture environment nutrient soil with a relative humidity of 85% and a temperature of 21°C for 27 days to grow. The regenerated plants of green onions are obtained, and the survival rate reaches 85.7%; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom in January or February of the following year, isolate and bag the individual plants, pollinate the individual plants, and harvest them in early March according to the seed maturity standard to obtain double haploid green onion seeds. Example 4

[0020] A double haploid breeding method for green onions, comprising the following specific steps: (1) Field planting and sampling: Take hybrid onion seeds, sow and raise seedlings in the greenhouse, sow and raise seedlings in the greenhouse in mid-April 2020, transplant in mid-June, manage under conventional cultivation conditions, harvest onion plants in mid-to-late October, store under well-ventilated conditions, and transplant onion plants in the greenhouse in mid-January of the following year, planting 800 square meters. In late February, when the onion buds open, remove the onion flower balls that are one-quarter open and store them in a 3.5℃ refrigerator for 22 hours. Select the flower buds that open the next day and rinse with running water for 33 minutes. Disinfect the surface with 75% ethanol solution on a clean bench for 30 seconds, sterilize with 0.1% mercuric chloride for 5 minutes, rinse with sterile water 5 times, dry the surface moisture, and set aside; (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-16-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH of the induction medium was adjusted to 5.8 with 1% NaOH solution before packaging. The induction medium was placed in a culture dish and sealed with a vinyl film. The culture dish and induction culture were sterilized in a high-pressure automatic sterilizer at 121°C for 20 min. The disinfected flower buds were inoculated into the culture dish containing the induction medium with sterilized tweezers. One flower bud was cultivated for every 1.6 mL of culture medium. After inoculation, the dish was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , cultured in a culture room at 24.5°C for 30-35 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at 26°C for 12 h / d. -1 Cultivate in a lighted culture room, and after 45 days of embryoid culture, grow into seedlings. The seedlings are transferred to MS+2% sucrose+7% agar rooting medium. After 18 days, multiple roots grow out, and rooted seedlings are obtained, with a rooting rate of 100%; harden and transplant the rooted seedlings: first open the sealing film, inject distilled water into the culture bottle, and use the standard of not submerging the seedlings. Generally, the seedlings are hardened for 5 days. During the period, water is replenished in time when there is a lack of water. Take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, and move them into a matrix with a mass ratio of peat and perlite of 1:1. Put it in a culture environment nutrient soil with a relative humidity of 88% and a temperature of 22°C for 28 days to obtain regenerated onion plants, with a survival rate of 83.6%; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom in January or February of the following year, isolate and bag the individual plants, pollinate the individual plants, and harvest them in early March according to the seed maturity standard to obtain double haploid green onion seeds. Example 5

[0021] A double haploid breeding method for green onions, comprising the following specific steps: (1) Field planting and sampling: Take hybrid onion seeds, sow and raise seedlings in the greenhouse, sow and raise seedlings in the greenhouse in mid-April 2019, transplant in mid-June, and manage under conventional cultivation conditions. Harvest onion plants in mid-to-late October and store under well-ventilated conditions. In mid-January of the following year, transplant the onion plants in the greenhouse and plant 800 square meters. In late February, the onion buds open, and remove the onion flower balls that are one-quarter open, store in a 4.5℃ refrigerator for 19 hours, select the flower buds that open the next day, rinse with running water for 28 minutes, disinfect with 75% ethanol solution on the clean bench for 30 seconds, sterilize with 0.1% mercuric chloride for 5 minutes, rinse with sterile water three times, dry the surface moisture, and set aside; (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-16-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH of the induction medium was adjusted to 5.8 with 1% NaOH solution before packaging. The induction medium was placed in a culture dish and sealed with a vinyl film. The culture dish and induction culture were sterilized in a high-pressure automatic sterilizer at 121°C for 20 min. The disinfected flower buds were inoculated into the culture dish containing the induction medium with sterilized tweezers. One flower bud was cultivated for every 1.4 mL of culture medium. After inoculation, the dish was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , cultured in a culture room at 24°C for 32 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at 24°C for 12 h / d. -1Cultivate in a lighted culture room, and after 37 days of embryoid culture, grow into seedlings. The seedlings are transferred to MS+2% sucrose+7% agar rooting medium. After 16 days, multiple roots grow out, and rooted seedlings are obtained, with a rooting rate of 100%; harden and transplant the rooted seedlings: first open the sealing film, inject distilled water into the culture bottle, and use the standard of not submerging the seedlings. Generally, the seedlings are hardened for 3 days. During the period of water shortage, water is replenished in time. Take out the onion seedlings with tweezers, clean the culture medium at the root of the onion, and move them into a matrix with a mass ratio of peat and perlite of 1:1. Put it in a culture environment nutrient soil with a relative humidity of 82% and a temperature of 15-24℃ for 26 days, and finally obtain the regenerated plants of green onion, with a survival rate of 82.7%; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom in January or February of the following year, isolate and bag the individual plants, pollinate the individual plants, and harvest them in early March according to the seed maturity standard to obtain double haploid green onion seeds. Test Example 1

[0022] Ploidy identification

[0023] The ploidy identification of green onion seed strains (cultivated by the method of Example 1-5) was performed using flow cytometry, and the steps were as follows: 1. Take 0.2g of fresh sample to be tested and place it in a culture dish; 2. Take 500ul of cell nuclear lysis solution and add it around the sample. Use a sharp blade to chop it up to fully extract the complete cell nucleus. The extraction time is 60 seconds. 3. Filter the liquid in the culture dish into the sample tube using a 50um filter; 4. Add 2000ul of DAPI fluorescent dye to the sample tube and stain for 2 minutes in the dark; 5. Test on the machine. The instrument used in this experiment is the Sysmex Partec brand CyFlow Space flow cytometer; 6. Identification results: The identification results of the tested green onion strains are as follows: Figure 1 As shown, all are diploid, that is, double haploid. Test Example 2

[0024] 1. Effects of culture medium components on induction of female nucleus embryos Different concentration levels of 6-BA 1 (1.5 mg / L), A 2 (2.0 mg / L), A 3 (2.5 mg / L); different concentration levels of NAA B 1 (0 mg / L)、B 2 (0.04 mg / L), B 3(0.4 mg / L); 2,4-D at different concentration levels C 1 (0.5 mg / L), C 2 (1.0 mg / L), C 3 (1.5 mg / L). The results of two repetitions are shown in Table 1. In order to explore the effects of the main hormone factors and their interactions on the induction of gynogenetic embryos, variance analysis was performed on the above-mentioned embryo index data. The variance analysis results showed that 6-BA, NAA and 2,4-D had extremely significant effects on the induction of gynogenetic embryos (Table 2). Therefore, in the process of inducing gynogenetic development into embryos, these three factors are the main factors for embryonic development. It is necessary to further compare the significance of the differences among the various levels of 6-BA, NAA and 2,4-D.

[0025] Table 1 Effects of culture medium components on induction of gynogenetic embryos

[0026] Table 2 Analysis of variance of the effects of culture medium components on induction of gynogenetic embryos

[0027] 2. Effects of different concentrations of 6-BA on induction of gynogenetic embryos Comparison of different concentrations of 6-BA showed that 6-BA was the main factor, and there were significant differences in the embryo emergence rates among the three 6-BA concentrations. The induction rate was low at 1.5 mg / L, and this concentration was not suitable. The embryo emergence rate was highest at 2.5 mg / L, which was significantly higher than 2.0 mg / L and 1.5 mg / L, and was the appropriate induction concentration for embryo emergence.

[0028] Table 3 Effect of 6-BA concentration on induction of gynogenetic embryos

[0029] 3. Effects of different NAA concentrations on induction of gynogenetic embryogenesis Comparing the different concentrations of NAA, it can be seen from Table 1 and Table 4 that NAA is not the main factor. There are extremely significant differences in the embryo emergence rate among the three NAA concentrations, with the third level 0.04 mg / L having the highest embryo emergence rate, averaging 3.99%, which is extremely significantly higher than 0 mg / L and 0.4 mg / L. It is the appropriate induction concentration that affects embryo emergence.

[0030] Table 4 Effect of NAA concentration on induction of gynogenetic embryos

[0031] 4. Effects of different concentrations of 2,4-D on induction of gynogenetic embryogenesis Duncan's comparison of different concentrations of 2,4-D was performed. It can be seen from Table 1 and Table 5 that 2,4-D is not the main factor. There are extremely significant differences in the embryo emergence rate among the three 2,4-D concentrations. The second level 1.0 mg / L has the highest embryo emergence rate, with an average of 4.00%, which is extremely significantly higher than 0.5 mg / L and 1.5 mg / L, and is the appropriate induction concentration that affects embryo emergence.

[0032] Table 5 Effect of 2,4-D concentration on induction of gynogenetic embryos

[0033] Test Example 3

[0034] a. Extract DNA from 300 onion strains to be tested (cultivated using the method of Example 1-5); b. Dilute the sample DNA concentration to 30 ng / ul, and transfer the sample DNA from the 96-well plate to the 384 PCR plate in the workstation; c. Prepare KASP PCR reaction system with a total volume of 5ul, including 2ul DNA, 2ul 2×PARMS PROMIX, 0.056ul KASP assay mix, and ddH20 to make up to 1ul; d. Place the prepared KASP PCR reaction system into the 384PCR plate in step b, centrifuge rapidly, and heat seal; e. Place the 384PCR plate in a PCR instrument for PCR reaction. The reaction procedure includes pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 61-55°C for 45 s, decreasing 0.6°C for each cycle, 10 cycles; denaturation at 95°C for 15 s, annealing at 55°C for 45 s, 35 cycles; f. After the reaction is completed, the PCR plate is quickly centrifuged, and the plate is dried and cooled, and then read on the microplate reader Pherastar to identify the green onion sample to be tested.

[0035] The nucleotide sequence of the primer for KASP labeling is: No.182(F1), and the sequences of primers No.182(F1), No.182(F2) and No.182(R) are as follows: No.182(F1): The underlined part is the HEX fluorescent label sequence, GAAGGTCGGAGTCAACGGATT TGCCGCCCTCTCTGTGTAA; No.182(F2): The underlined part is the FAM fluorescent label sequence, GAAGGTGACCAAGTTCATGCT TGCCGCCCTCTCTGTGTAG; No.182(R): GCATTTCGTCATGGAGCTTTG.

[0036] The identification results are as follows: The KASP marker method was used to identify 300 green onion samples, and the PCR results were consistent with the genetic analysis results, indicating the effectiveness of the marker.

[0037] The fluorescent reporter group A used in the method of the present invention is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching group is BHQ. Fluorescent probe A, fluorescent probe B, quenching probe A, and quenching probe B are from 2×Master Mix (produced by LGC).

[0038] The genotype result was: double haploid (DH line).

Claims

1. A double haploid breeding method for green onions, characterized in that Here are the steps: (1) Field planting and sampling: Take green onion seeds, sow and raise seedlings in a greenhouse, and when the green onion buds open, remove the green onion flower balls that are one quarter open and store them in a refrigerator at 3-5°C for 15-24 hours. Select the flower buds that open the next day, clean, disinfect, and sterilize them for later use; (2) In vitro female nucleus culture to induce embryoids: MS + 1.0 mg·L-1 2,4-D + 0.04 mg·L-1 NAA + 2.5 mg·L-1 6-BA + 10% sucrose + 7 g·L-1 agar was used as the induction medium. The pH value of the induction medium was adjusted. The induction medium was then placed in a culture vessel. After sterilization, the flower buds disinfected in step (1) were inoculated into the culture vessel containing the induction medium using sterilized tweezers. One flower bud was cultivated for every 1.3-1.7 mL of culture medium. After inoculation, the culture vessel was placed under a light intensity of 2000 lux and a light duration of 12 h·d. -1 , culture in a culture room at a temperature of 22-25°C for 30-35 days to induce embryoids; (3) Embryo culture and regeneration of plants: The induced embryoids were transferred to a seedling medium consisting of MS + 3% sucrose + 7% agar and placed at a temperature of 22-25°C for 12 h / d. -1 Cultivate in a lighted culture room, grow embryoids into seedlings after 30-50 days of culture, transfer the seedlings to MS+2% sucrose+7% agar rooting medium, grow multiple roots after 15-20 days, and obtain rooted seedlings, harden the rooted seedlings and transplant them: use tweezers to take out the onion seedlings, clean the culture medium at the root of the onion, transfer them into the matrix, put them into the culture environment nutrient soil with a relative humidity of 80-90% and a temperature of 15-24°C for growth for 25-30 days, and finally obtain the regenerated plants of green onion; (4) Cultivation of green onion seeds: Take the regenerated green onion plants and plant them in the greenhouse. Follow the conventional green onion field cultivation and management. When they bloom the next year, separate the plants into bags, pollinate them, and harvest them according to the seed maturity standards to obtain double haploid green onion seeds.

2. A double haploid breeding method for green onions according to claim 1, characterized in that The step (1) of sowing and raising seedlings in the greenhouse specifically comprises: sowing and raising seedlings in the greenhouse in mid-April, transplanting in mid-June, managing under conventional cultivation conditions, harvesting the green onion plants in mid-to-late October, storing under well-ventilated conditions, and transplanting the green onion plants in the greenhouse in mid-January of the following year.

3. A double haploid breeding method for green onions according to claim 1, characterized in that The flower buds are cleaned and disinfected in step (1) by rinsing them with running water for 25-35 minutes and disinfecting their surfaces with 75% ethanol solution on a clean bench for 30 seconds.

4. A double haploid breeding method for green onions according to claim 1, characterized in that The sterilization in step (1) is performed by using 0.1% mercuric chloride for 5 minutes and rinsing with sterile water for 3 to 5 times.

5. A double haploid breeding method for green onions according to claim 1, characterized in that Before packaging, the induction medium described in step (2) was adjusted to pH 5.8 using 1% NaOH solution.

6. A double haploid breeding method for green onions according to claim 1, characterized in that The sterilization described in step (2) is to sterilize the culture vessel and the induced culture in a high pressure automatic sterilizer at 121° C. for 20 min.

7. A double haploid breeding method for green onions according to claim 1, characterized in that The rooting seedling hardening and transplanting described in step (3) is specifically to first open the sealing film, inject distilled water into the culture bottle, and harden the seedlings for 3 to 5 days, and replenish water in time when water is scarce during this period.

8. A double haploid breeding method for green onions according to claim 1, characterized in that The matrix described in step (3) is a matrix with a mass ratio of peat to perlite of 1:1.

Images