Molecular marker of female sturgeon egg laying amount related gene npffr1 and application

Abstract

The invention discloses a molecular marker of a female sturgeon egg laying amount related gene npffr1 and application of the molecular marker, and belongs to the field of sturgeon genetic breeding and sturgeon molecular marker-assisted breeding. The SNP molecular marker for identifying the egg laying amount of the sturgeons is located at the 78bp position of the npffr1 gene nucleotide sequence fragment; the polymorphic form is A / G, and the genotype of a base mutation site comprises AA, AG or GG. Wherein the female individuals with the genotype of AA belong to high-egg-laying-amount individuals, and the female individuals with the genotypes of AG and GG belong to low-egg-laying-amount individuals. The molecular marker provided by the invention can be used for early breeding of female sturgeon egg laying quantity characters, can be used for screening in multiple female sturgeon groups such as acipenser schustatus, Huso dauricus, acipenser sibiricum and hybrid sturgeon, and can remarkably accelerate the artificial breeding process of breeding of sturgeon varieties with high egg laying quantity.

Description

Technical Field

[0001] The invention belongs to the field of sturgeon genetic breeding and sturgeon molecular marker assisted breeding, and specifically relates to a molecular marker of a gene npffr1 related to egg laying amount of female sturgeons and an application thereof. Background Art

[0002] Caviar is made from salted sturgeon eggs. It has extremely high nutritional and economic value and is known as "black gold". It is one of the world's three major delicacies along with truffles and foie gras. It has always been a traditional luxury delicacy in Europe and the United States. Therefore, the fertility of female sturgeons is a key factor in determining the industrial development of caviar. Early selection of female sturgeons with high egg-laying traits is the main task of sturgeon genetic breeding. Neuropeptide FF receptor 1 (npffr1) is the main receptor of gonadotropin inhibitory hormone (GnIH) and plays an important role in regulating animal reproductive physiology. GnIH is a hypothalamic neuropeptide and the only neuropeptide found to inhibit ovarian development. After binding to the G protein-coupled receptor npffr1, it directly participates in reproductive physiological processes such as sexual behavior, estrous cycle regulation, estrogen circulation and follicle development through the "hypothalamus-pituitary-ovary" axis.

[0003] In recent years, with the rapid development of modern molecular biology technology and the advent of the post-genomic era, single nucleotide polymorphism (SNP) has been widely used as the third-generation molecular marker technology in molecular breeding research of aquatic animals, and also plays an important role in the selection and breeding of excellent varieties. It can be seen that the development of molecular markers related to economic traits is of great significance for shortening the generation interval and improving the efficiency / accuracy of early selection of excellent traits. So far, there is no record in the prior art that there are SNP molecular markers related to the spawning quantity trait of sturgeon in the regulatory region of the npffr1 gene. Summary of the invention

[0004] In order to facilitate the identification of the spawning amount trait of female sturgeons, the present invention provides a molecular marker of a gene npffr1 related to the spawning amount trait of female sturgeons and its application in artificial breeding, and the spawning amount trait of female sturgeons can be identified by using the SNP molecular marker. This SNP site has a significant correlation with the spawning amount trait of female sturgeons, so by identifying the genotype of the SNP site of female sturgeons, early selection of female sturgeons with high spawning amount traits can be achieved.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The invention provides a molecular marker of a gene npffr1 related to the egg production of female sturgeons. The SNP molecular marker for identifying the egg production of female sturgeons is located at the 78 bp of the nucleotide sequence fragment of the npffr1 gene (SEQ ID NO: 1); its polymorphism form is A / G, wherein the genotype of the base mutation site includes AA, AG or GG.

[0007] Furthermore, the nucleotide sequence of the primer pair for detecting the above SNP molecular marker is:

[0008] Forward primer F: 5'-TTCAACACAGCCTTCGCTTAC-3', i.e., SEQ ID NO: 2;

[0009] Reverse primer R: 5'-CGGCATTACAGAATAGCAA-3', ie, SEQ ID NO:3.

[0010] An application of the molecular marker or the primer pair in identifying the amount of eggs laid by female sturgeons comprises the following steps:

[0011] Step 1, extracting genomic DNA from the fin tissue of the sturgeon to be tested;

[0012] Step 2: using the above primers to perform PCR amplification on sturgeon genomic DNA to obtain a nucleotide sequence fragment of the npffr1 gene, namely, SEQ ID NO: 1;

[0013] Step 3, detect the genotype at the 78th bp of the PCR amplification product; among them, female individuals with genotype AA are high-egg-laying individuals (egg weight / body weight>0.2), and female individuals with genotypes AG and GG are low-egg-laying individuals (egg weight / body weight<0.15).

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The invention provides a SNP molecular marker associated with the spawning amount trait of female sturgeons. The SNP molecular marker is located at the 11249bp of the npffr1 gene on chromosome No. NC_081234.1 of the sturgeon, that is, the 78bp of the nucleotide sequence fragment (SEQ ID NO: 1) of the npffr1 gene. An A / G base mutation exists on the molecular marker, which has a significant correlation with the spawning amount trait of female sturgeons, wherein the spawning amount trait of individuals with the AA genotype is significantly higher than that of individuals with the AG and GG genotypes. At the same time, the matching rate between the genotyping result of the SNP molecular marker site and the actual spawning amount trait can be as high as 81.16%. The molecular marker provided by the present invention can be used for early breeding of the spawning quantity trait of female sturgeons, and can be screened in a variety of female sturgeon individuals such as Acipenser schrenckii, Acipenser dabryanus, Acipenser siberianus and hybrid sturgeon. The SNP molecular marker of the gene npffr1 related to the spawning quantity trait of sturgeon lays the foundation for molecular marker-assisted selection of sturgeon strains with high spawning quantity traits, and can significantly accelerate the artificial breeding process of selecting high spawning quantity varieties.

[0016] The present invention can significantly shorten the breeding time of artificially selected high-spawning female sturgeons by detecting the dominant allele genotype of SNP molecular markers, thereby reducing breeding costs, effectively improving the economic benefits of sturgeon farming, and promoting the progress of genetic improvement of sturgeon fertility traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the three genotype sequencing peak diagrams of the PCR amplification products in Example 1 of the present invention. DETAILED DESCRIPTION

[0018] The technical solution of the present invention will be clearly and completely described below in conjunction with the drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0019] Embodiment 1:

[0020] Identification of polymorphic loci in the npffr1 gene of female sturgeon

[0021] 1. Acquisition of high and low spawning female sturgeon test samples: The fish used in this experiment were all from Hangzhou Qiandao Lake Sturgeon Technology Co., Ltd. 69 strong, undamaged, and energetic female adult individuals were selected, with a body length of 143.60±40.62cm and a weight of 29.26±5.25kg. After dissection, egg collection, and weighing, 20 female fish with an spawning rate higher than 20% were used as the high spawning rate group, and 49 female fish with an spawning rate lower than 15% were used as the low spawning rate group. The above sturgeon fins were cut as test samples for extracting genomic DNA and stored at -20°C.

[0022] 2. Extract genomic DNA from the fin tissue of the female sturgeon to be tested: Use a column-type animal tissue genomic DNA extraction kit to extract the fin genomic DNA. Then use 1% agarose gel electrophoresis to detect the quality and integrity of the DNA sample; use NanoDrop2000 ultra-micro spectrophotometer to determine the DNA concentration, and store the genomic DNA samples that meet the concentration requirements and have good integrity in a -20℃ refrigerator for future use.

[0023] 3. Amplify the nucleotide fragment containing the SNP site

[0024] 3.1 Primer design: The DNA sequence corresponding to the npffr1 gene (NCBI accession number: LOC117966090) was downloaded from the sturgeon reference genome database (https: / / www.ncbi.nlm.nih.gov / ), and the detection primers were designed based on the partial nucleotide sequence of the npffr1 gene, including:

[0025] Forward primer F: 5'-TTCAACACAGCCTTCGCTTAC-3' (SEQ ID NO: 2);

[0026] Reverse Primer R: 5'-CGGCATTACAGAATAGCAA-3' (SEQ ID NO: 3).

[0027] The amplification product of the primer is 485 bp in length, and the sequence is shown in SEQ ID NO: 1, which contains a molecular marker site with an A / G mutation at the 78 bp position.

[0028] SEQ ID NO:1

[0029] CGTGTCGGCAGTTTGTCTCTTTAGCACACTTCAGCCTTTTGATGACAGCACAGTTTGGCCCCCGTTGGGGATGAGAT[G / A]CGAAACTGTACAGTCTGAGCGTCAGTGGAAACCC CCTCCAGCTACACCTCGCCCAGCCTGGCCAGCTGAGCTAGACCAGGGACAGGCAGTGGAAACGAAGCATATGTGACCTGATCTGGACGGGTCTGGAAAAAACCCTTGGAAAGGGTTTATATCAATCAGTGCGGTACTGAATTGCTCACCATTGCAAAAAACAAGTCTGAACAGGCTAAGGTAAAAA AAAAAACAAAATGTTCCATGTCTCAATCCTCCTGCAAAACACTTAAGGTTATCTCTGCCCCTGCCGGAAGGATCGCTCACTGAAATGCATGCATTTGAAAAACGTTATCAATGCAAAAACCGATCTGCCCGGAAGGTGAATGTGAAGGTTATATAAAACTTGCTCGGGGGCAGCGCACGCCCCCCCG

[0030] 3.2 PCR amplification: The PCR reaction system was 20 μL, including: 10 μL 2× TSINGKE Master Mix (Blue), 0.8 μL forward primer (10 μmol / L), 0.8 μL reverse primer (10 μmol / L), 1.0 μL template DNA (≥100 ng / μL) and 7.4 μL ddH2O. The PCR reaction conditions were: 95°C pre-denaturation for 5 min, [95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s] 35 amplification cycles, and finally 72°C extension for 10 min.

[0031] 4. Detect PCR amplified fragments and identify SNP molecular marker genotypes: The PCR amplified product obtained in step 3 was subjected to Sanger sequencing using the ABI 3730XL sequencing platform. The genotype at the 78th bp of the PCR amplified product was the genotype of the SNP molecular marker. The sequencing peaks of the three genotypes are shown in Figure 2. Figure 1 shown.

[0032] Embodiment 2:

[0033] The polymorphic sites of the npffr1 gene of 69 samples to be tested were analyzed in an expanded population. The association analysis between SNP molecular markers and the spawning quantity trait was performed on 69 female sturgeons in the high spawning quantity group and the low spawning quantity group using a general linear model (Table 1), which verified that the genotype of the SNP molecular marker at this location was significantly positively correlated with the spawning quantity trait of sturgeon (P<0.05), and the matching rate between the genotyping results of this SNP molecular marker site and the actual spawning quantity trait was 81.16%.

[0034] Table 1 Genotype frequencies of SNP loci in high and low spawning groups of sturgeon

[0035]

[0036] Note: * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0037] In the process of artificially breeding female sturgeon varieties with high spawning capacity, individuals with genotype AA can be selected and retained, while individuals with genotypes AG and GG can be eliminated.

[0038] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A molecular marker for the gene npffr1 related to the spawning amount of female sturgeons, characterized in that: The SNP molecular marker for identifying the high or low spawning amount of sturgeon is located at the 78th bp of the nucleotide sequence fragment of the npffr1 gene SEQ ID NO: 1; its polymorphism form is A / G, wherein the genotype of the base mutation site includes AA, AG or GG.

2. A primer pair for detecting the molecular marker npffr1 gene related to the spawning amount of female sturgeon according to claim 1, characterized in that: The nucleotide sequence of the primer pair for detecting the above SNP molecular marker is: Forward primer F: 5'-TTCAACACAGCCTTCGCTTAC-3', i.e., SEQ ID NO: 2; Reverse primer R: 5'-CGGCATTACAGAATAGCAA-3', ie, SEQ ID NO:

3.

3. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in identifying the amount of eggs laid by female sturgeons.

4. The use according to claim 3, characterized in that: The following steps are involved: Step 1, extracting genomic DNA from the fin tissue of the sturgeon to be tested; Step 2: using the above detection primers to perform PCR amplification on the genomic DNA of sturgeon to obtain a nucleotide sequence fragment of the npffr1 gene, namely, SEQ ID NO: 1; Step 3, detecting the genotype at the 78 bp of the PCR amplification product; among them, female individuals with genotype AA are high-egg-laying individuals, and female individuals with genotype AG and GG are low-egg-laying individuals.

Images