Biological detoxification strain for degrading high-concentration inhibitor and vitality maintaining method of biological detoxification strain

Abstract

The invention belongs to the field of microbiology application, and relates to a strain capable of degrading a high-concentration lignocellulose source inhibitor and an activity maintaining method of the strain. According to the method, microorganisms in industrial corncob-sourced furfural residues containing high-concentration furfural and acetic acid inhibitors are separated and purified to obtain a fungus strain with certain metabolic capability on various lignocellulose-sourced inhibitors, and the fungus strain is identified as Paecilomyces variotii through ITS sequence comparison. In order to improve the metabolic capability of the inhibitor, the strain is continuously transferred and cultured for 70 generations in a synthetic culture medium containing a high-concentration inhibitor. The finally obtained stably evolved bacterial strain is named as Paecilomyces variotii ZW70, and the Paecilomyces variotii ZW70 is named as Paecilomyces variotii ZW70. The invention provides a stable detoxification strain capable of efficiently degrading a high-concentration inhibitor for a lignocellulose biorefinery process.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial application, and relates to a strain capable of degrading high-concentration lignocellulose-derived inhibitors and a method for maintaining its vitality. The strain has great potential for application in the detoxification process of lignocellulose biorefining. Background Art

[0002] Lignocellulosic biorefining usually includes pretreatment, saccharification, detoxification and fermentation. Pretreatment can break the natural dense structure of lignocellulosic biomass, which is beneficial to the subsequent enzymatic hydrolysis. However, a large number of microbial growth inhibitors will be produced during the pretreatment process, mainly including furfural produced by excessive degradation of xylose, 5-hydroxymethylfurfural produced by excessive degradation of glucose, and acetic acid released by hydration of hemicellulose acetyl groups.

[0003] Generally speaking, increasing the intensity of pretreatment can significantly increase the yield of enzymatic hydrolysis, but it will also increase the generation of inhibitors. In addition, some industrial and agricultural wastes, such as corn cob residues, a byproduct of furfural production, also contain high concentrations of inhibitors (acetic acid content exceeds 5%, w / w). These inhibitors will seriously inhibit the normal growth and metabolism of subsequent fermentation strains. Therefore, if these biomasses need to be subjected to subsequent biotransformation, effective detoxification methods must be used to remove the inhibitors.

[0004] Specific microorganisms can be used to remove inhibitors in lignocellulose hydrolysate. Compared with physical and chemical methods, biological detoxification has the advantages of mild reaction conditions, low energy consumption, few toxic byproducts, and high selectivity. However, existing biological detoxification strains are still difficult to meet the requirements for effective removal of inhibitors in high-intensity pretreated raw materials and furfural residue raw materials. For example, Zhang Hourui et al. of Tangchuan Biotechnology Co., Ltd. (CN 101735958, CN 102010833) disclosed a method of culturing oriental Issatchengen or western Issatchengen in hemicellulose hydrolysate to partially degrade furfural and acetic acid, but the degradation capacity is limited and can only be carried out in the pretreatment solution (hemicellulose hydrolysate). Zuo Zhenyu et al. from Wuhan University of Science and Technology (CN118086415 A) disclosed a method for biological detoxification of biomass hydrolysate using Trichosporon dermatophyte, but Trichosporon dermatophyte can only convert some specific inhibitors into low-toxic compounds (Journal of Biotechnology, 2022, 343: 32-37); in addition, the method was only implemented at low solid content (less than 15%, w / w), and the sugar concentration was low, which also meant that the strain could not tolerate high concentrations of inhibitors. Bao Jie et al. from East China University of Science and Technology (CN 102191279) disclosed a method for biodegrading inhibitors in solid lignocellulosic materials after pretreatment using Resin Cladosporium, but the method is only for solid raw materials and cannot achieve detoxification of hydrolysate, limiting its large-scale application. Bao Jie et al. from East China University of Science and Technology (CN

[0005] 110713939B) further discovered that the wild-type biological detoxification strain Paecilomyces variotii FN89, which can completely degrade multiple lignocellulose-derived inhibitors, can only achieve the degradation of low-concentration mixed inhibitors (furfural is only 0.1 g / L, acetic acid is only 4.0 g / L). The existing biological detoxification strains must adopt effective means to improve their inhibitor tolerance in order to achieve effective biological detoxification of biomass containing high concentrations of inhibitors and promote their bioconversion.

[0006] The information disclosed in this technical background section is only intended to enhance the overall understanding of the background of the invention and should not be regarded as any form of admission or suggestion that the information constitutes the prior art known to a person skilled in the art. Summary of the invention

[0007] In view of the shortcomings of the biological detoxification strains reported above, the present invention uses a strain of Paecilomyces variotii isolated from industrial corncob furfural residue containing high concentrations of inhibitors as the starting strain. After 70 generations (210 days in total) of adaptive evolution in a culture medium containing high concentrations of mixed inhibitors, an evolved strain that stably metabolizes high concentrations of mixed inhibitors is obtained, named Paecilomyces variotii ZW70. Compared with previous biological detoxification strains, this strain has a stronger ability to metabolize high concentrations of mixed lignocellulose-derived inhibitors. In order to avoid the degradation of the activity of the strain after long-term use or storage, the method also establishes a strain activation method to ensure the stability of its ability to metabolize high concentrations of inhibitors during long-term use in industrial applications.

[0008] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0009] First, a filamentous fungus with a certain ability to degrade lignocellulose raw materials was isolated from furfural residues from industrial corn cobs. It was identified as Paecilomyces variotii by ITS sequence. Subsequently, the strain was subjected to a long period of adaptive evolution in a synthetic medium containing inhibitors, and finally the detoxified strain Paecilomyces variotii ZW70 (Paecilomyces variotiiZW70) with the ability to stably degrade high-concentration lignocellulose-derived inhibitors was obtained. Given that the detoxified strain is very likely to degrade in detoxification performance after long-term use or long-term storage in the refrigerator,

[0010] The filamentous fungus isolated from the furfural residue raw material from industrial corn cobs of the present invention was identified as Paecilomyces variotii after ITS sequence comparison.

[0011] Furthermore, the long-term adaptive evolution method of the filamentous fungi isolated from the industrial corncob-derived furfural residue raw material comprises the following steps:

[0012] (1) Preparation of spore solution: streak wild-type Paecilomyces variotii on a PDA plate and culture at 37°C for 4 days to produce a large number of gray-yellow spores; wash the plate with 0.05% (w / w) Tween 80 and collect the spore solution for subsequent subculture; the spore solution concentration is 10 8 -10 9 Pieces / mL;

[0013] (2) Preparation of medium for long-term evolution: The basic medium contains 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2 and 15g / L glucose; the evolution process was divided into five stages, and different concentrations of acetic acid, 5-hydroxymethylfurfural and furfural mixed inhibitors were added to the culture medium at different stages. In the first stage, acetic acid 5g / L, 5-hydroxymethylfurfural 0.5g / L, furfural 0.5g / L; in the second stage, acetic acid 7.0g / L, 5-hydroxymethylfurfural 1.0g / L, furfural 0.5g / L; in the third stage, acetic acid 9.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fourth stage, acetic acid 11.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fifth stage, acetic acid 15.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L;

[0014] (3) Evolution during the long-term adaptation period: 1% (v / v) of the spore solution of Paecilomyces variotii was inoculated into 100 mL of the first-stage evolution medium, the initial pH was adjusted to 4.5, and the culture was carried out at 37°C and 300 rpm for 3 days; then, the culture was continuously subcultured 70 times at a 10% (v / v) inoculation amount;

[0015] (4) Single colony isolation: The subculture medium was separated by streaking on a PDA plate to obtain a single colony.

[0016] The biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors described in the present invention is deposited in the China Center for Type Culture Collection on August 28, 2024, and the deposit number is CCTCC M 20241863.

[0017] The present invention also provides a method for maintaining the activity of the biological detoxification strain that degrades high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors, including the following steps:

[0018] (1) Preparation of activation medium: Add 2 g / L KH2PO4, 1 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 1 g / L yeast extract, 0.5 g / L CaCl2, 15 g / L glucose, 15.0 g / L acetic acid, 1.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural to PDA medium to prepare a solid plate for activation;

[0019] (2) Activation of bacterial strains: Use an inoculation loop to directly scrape the plates, glycerol stocks, or long-term bacterial strains stored in the refrigerator, streak them on the activated culture plates, and culture them at 37°C for 3-5 days. Pick out larger single colonies each time and perform streak culture three times.

[0020] (3) The evolved strains activated by subculture can still achieve efficient degradation of high concentrations of inhibitors in synthetic culture medium and lignocellulose hydrolysate.

[0021] The method provided by the present invention for restoring the detoxification activity of the strain and performing biological detoxification on a lignocellulose hydrolyzate containing a high concentration of inhibitors more specifically comprises the steps of:

[0022] (1) Preparation of a culture medium for restoring the activity of the strain: The activated strain is further cultured in a PDA solid culture medium plate containing a high concentration of mixed inhibitors of lignocellulose to restore its ability to metabolize the high concentration inhibitors. Preferably, the mixed inhibitors added to the culture medium are 15.0 g / L acetic acid, 1.5 g / L 5-hydroxymethylfurfural, and 0.5 g / L furfural.

[0023] (2) Restoration of bacterial activity: Streak Paecilomyces variotii ZW70, which has detoxified after long-term use or has been stored in a refrigerator for a long time, on a PDA plate containing inhibitors and culture at 37°C for 3-4 days. Select larger colonies and repeat subculture 3-4 times.

[0024] (3) Biological detoxification seed liquid culture: Add 10 mL of 0.05% (v / v) Tween80 aqueous solution to the passage plate covered with fungal spores, and then scrape and collect the spore liquid with a sterilized cell spreader. Inoculate 1 mL of the spore liquid into 100 mL of inhibitor-free fungal basal culture medium and culture at a constant temperature of 37°C and a speed of 300 rpm for 24 hours. Preferably, the basal culture medium contains 2 g / L KH2PO4, 1 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 1 g / L yeast extract, 0.5 g / L CaCl2 and 15 g / L glucose.

[0025] (4) Biological detoxification: The seed culture solution was inoculated into the lignocellulose hydrolysate containing inhibitors at an inoculum amount of 10% (v / v).

[0026] The cellulose raw material in step (4) includes, but is not limited to, common cellulose raw materials such as straw, sawdust, and corncob furfural residue. Preferably, wheat straw

[0027] The detoxification conditions in step (4) are 28-48°C, 200-750 rpm, 0.5-2.0 vvm. Preferably, the culture conditions are 37°C, 750 rpm, and 1 vvm.

[0028] During the biological detoxification in step (4), the activity of genes related to the degradation of acetic acid and phenolic aldehyde inhibitors such as alcohol dehydrogenase and aldehyde dehydrogenase in the evolved strain ZW70 in the presence of inhibitors is significantly increased compared to the starting strain. Preferably, the up-regulated expression of adh, acs, ach1, and ackA genes is the most significant.

[0029] At the end of the biological detoxification in step (4), no lignocellulose-derived inhibitors are detected in the lignocellulose hydrolysate. Preferably, the concentrations of acetic acid, 5-hydroxymethylfurfural and furfural inhibitors are reduced to a level that they are undetectable in the liquid phase, and the loss of fermentable sugars is less than 5%.

[0030] The lignocellulose hydrolysate that has been biologically detoxified in step (4) can be used for the fermentation production of a variety of bio-based chemicals, preferably including but not limited to lactic acid, ethanol, oil, sugar acid, amino acid, etc.

[0031] The evolved strain of the present invention has the ability to stably degrade high concentrations of lignocellulose-derived inhibitors due to the following points:

[0032] (1) The evolved strain can achieve stable growth and rapid degradation of high concentrations of inhibitors in a synthetic culture medium containing high concentrations of inhibitors.

[0033] (2) The evolved strains can achieve rapid degradation of high concentrations of inhibitors in various types of lignocellulose hydrolysates, including but not limited to common lignocellulose raw materials such as straw, sawdust, and corncob furfural residue.

[0034] The present invention provides a strain capable of degrading high-concentration lignocellulose-derived inhibitors and a method for maintaining its activity. By isolating and purifying microorganisms in furfural residues derived from industrial corn cobs containing high concentrations of furfural and acetic acid inhibitors, a fungus with a certain metabolic ability for various lignocellulose-derived inhibitors was obtained, which was identified as Paecilomyces variotii by ITS sequence alignment. In order to improve its inhibitor metabolism ability, it was continuously transferred and cultured for up to 70 generations (a total of 210 days) in a synthetic culture medium containing high concentrations of inhibitors. The stable evolution strain finally obtained was named Paecilomyces variotii ZW70 (deposited in the China Center for Type Culture Collection, with a preservation date of August 28, 2024, and a preservation number of CCTCC M 20241863). The degradation capacity of the obtained evolved strain for mixed inhibitors of lignocellulose origin increases from the initial concentrations of 5 g / L sodium acetate, 0.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural to 15 g / L sodium acetate, 1.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural, respectively. In order to prevent the degradation of the detoxification performance of the strain during long-term subculture or storage, a method for maintaining the activity of the strain by continuous subculture in a solid culture medium containing high concentrations of inhibitors is further proposed. The present invention provides a stable and efficient detoxification strain for degrading high concentrations of inhibitors in the lignocellulose biorefining process, and can effectively prevent strain degradation, which has great potential for industrial application.

[0035] Compared with the prior art, the present invention has the following positive effects:

[0036] The Paecilomyces variotii ZW70 provided by the present invention has stronger tolerance and degradation ability to high concentration inhibitors from wood fiber sources than the starting strain and other detoxified strains. The invention also proposes a method to deal with the phenomenon that industrial application strains are unstable during long-term use and storage, which can effectively prevent strain degradation. The detoxification process does not require the addition of exogenous nutrients and there is almost no loss of fermentable sugars, which has significant potential for industrial application.

[0037] Description of biological deposit:

[0038] The strain was named Paecilomyces variotii ZW70 and was deposited in the China Center for Type Culture Collection on August 28, 2024, with the deposit number CCTCC M 20241863. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1The adaptive evolution of Paecilomyces variotii in culture medium containing inhibitors.

[0040] Figure 2 The diagram shows the biodetoxification of wheat straw hydrolysate containing high concentrations of inhibitors by Paecilomyces variotii ZW70 and the original strain; (a) the degradation of acetic acid; (b) the degradation of 5-hydroxymethylfurfural; (c) the degradation of furfural;

[0041] (d) Consumption of fermentable sugars during the biodetoxification process. DETAILED DESCRIPTION

[0042] The following examples are provided for a better understanding of the present invention and are not intended to limit the present invention. The experimental methods in the following implementation methods are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0043] The filamentous fungus isolated from furfural residue raw materials from industrial corn cobs is identified as Paecilomyces varioti after ITS sequence comparison. The long-term adaptive evolution method comprises the following steps:

[0044] (1) Preparation of spore solution: streak wild-type Paecilomyces variotii on a PDA plate and culture at 37°C for 4 days to produce a large number of gray-yellow spores; wash the plate with 0.05% (w / w) Tween 80 and collect the spore solution for subsequent subculture; the spore solution concentration is 10 8 -10 9 Pieces / mL;

[0045] (2) Preparation of medium for long-term evolution: The basic medium contains 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2 and 15g / L glucose; the evolution process was divided into five stages, and different concentrations of acetic acid, 5-hydroxymethylfurfural and furfural mixed inhibitors were added to the culture medium at different stages. In the first stage, acetic acid 5g / L, 5-hydroxymethylfurfural 0.5g / L, furfural 0.5g / L; in the second stage, acetic acid 7.0g / L, 5-hydroxymethylfurfural 1.0g / L, furfural 0.5g / L; in the third stage, acetic acid 9.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fourth stage, acetic acid 11.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fifth stage, acetic acid 15.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L;

[0046] (3) Evolution during the long-term adaptation period: 1% (v / v) of the spore solution of Paecilomyces variotii was inoculated into 100 mL of the first-stage evolution medium, the initial pH was adjusted to 4.5, and the culture was carried out at 37°C and 300 rpm for 3 days; then, the culture was continuously subcultured 70 times at a 10% (v / v) inoculation amount;

[0047] (4) Single colony isolation: The subculture medium was separated by streaking on a PDA plate to obtain a single colony.

[0048] The biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors described in the present invention is deposited in the China Center for Type Culture Collection on August 28, 2024, and the deposit number is CCTCC M 20241863.

[0049] The method for maintaining the activity of a biological detoxification strain that degrades high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors comprises the following steps:

[0050] (1) Preparation of activation medium: Add 2 g / L KH2PO4, 1

[0051] g / L(NH4)2SO4,1g / L MgSO4·7H2O,1g / L yeast extract,0.5g / L CaCl2,15g / L glucose,15.0

[0052] g / L acetic acid, 1.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural to prepare a solid plate for activation;

[0053] (2) Activation of bacterial strains: Use an inoculation loop to directly scrape the plates, glycerol stocks, or long-term bacterial strains stored in the refrigerator, streak them on the activated culture plates, and culture them at 37°C for 3-5 days. Pick out larger single colonies each time and perform streak culture three times.

[0054] (3) Biological detoxification seed liquid culture: Add 10 mL of 0.05% (v / v) Tween 80 aqueous solution to the subculture plate covered with fungal spores, and then scrape and collect the spore liquid with a sterilized cell spreading rod. Inoculate 1 mL of the spore liquid into 100 mL of inhibitor-free fungal basal culture medium and culture at a constant temperature of 37°C and a rotation speed of 300 rpm for 24 hours. Preferably, the basal culture medium contains 2 g / L KH2PO4, 1 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 1 g / L yeast extract, 0.5 g / LCaCl2 and 15 g / L glucose;

[0055] (4) Biological detoxification: The seed culture solution was inoculated into the lignocellulose hydrolysate containing inhibitors at an inoculum amount of 10% (v / v).

[0056] Example 1: Biodetoxification of Paecilomyces variotii AZW70 in liquid synthetic medium

[0057] A synthetic medium containing high concentration of inhibitors was prepared to test the detoxification ability of the evolved strain Paecilomyces variotii ZW70 and compare it with the original strain Paecilomyces variotii. The synthetic medium contained 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / LMgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2, 40g / L glucose, 20g / L xylose, 15.0g / L acetic acid, 1.5g / L 5-hydroxymethylfurfural and 0.5g / L furfural. The evolved strain Paecilomyces variotii ZW70 and the original strain were inoculated at 10% (v / v) inoculation and cultured at 37℃, 750rpm, and 1vvm ventilation. The results showed that Paecilomyces variotii ZW70 could rapidly degrade all 5-hydroxymethylfurfural and furfural within 24 hours, and 57.3% of acetic acid within 48 hours; while the original strain needed 48 hours to degrade all 5-hydroxymethylfurfural and furfural, and only degraded 33.0% of acetic acid within 48 hours. The degradation ability of the evolved strain Paecilomyces variotii ZW70 on high-concentration lignocellulose-derived inhibitors was significantly stronger than that of the original strain.

[0058] Example 2: Use of Paecilomyces variotii ZW70 for efficient biodetoxification of wheat straw hydrolysate containing high concentrations of inhibitors

[0059] Wheat straw was harvested in Taiyuan, Shanxi in 2023 and subjected to dilute acid pretreatment. The pretreatment conditions were a solid-liquid ratio of 2:1, a temperature of 170°C, a pressure of 1.0 MPa, an acid dosage of 5% (w / w, dry basis raw material), and a pretreatment time of 5 min. The obtained pretreated wheat straw was neutralized to pH 4.8 using calcium carbonate, and then a hydrolyzate was prepared. When preparing the hydrolyzate, the amount of cellulase was 4 mg protein / g dry basis, the solid content was 25% (w / w), the temperature was 50°C, the stirring was 200 rpm, and the time was 12 h. This wheat straw hydrolyzate contains 9.7 g / L acetic acid, 1.4 g / L 5-hydroxymethylfurfural, and 1.7 g / L furfural. The evolved strain Paecilomyces variotii ZW70 and the original strain were inoculated into the wheat straw hydrolysate at an inoculation rate of 10% (v / v) and cultured at 37°C, 750rpm, and 1vvm ventilation. The results showed that Paecilomyces variotii ZW70 could completely degrade all acetic acid, 5-hydroxymethylfurfural, and furfural within 36h; while the original strain still had 43.0% acetic acid remaining. This indicates that the evolved strain Paecilomyces variotii ZW70 has a significantly stronger ability to degrade inhibitors in lignocellulose hydrolysate than the original strain.

[0060] Example 3: Use of Paecilomyces variotii ZW70 for efficient biodetoxification of corncob furfural residue hydrolysate containing high concentrations of inhibitors

[0061] Corncob furfural residue was provided by a domestic furfural manufacturer. Corncob furfural residue is the main byproduct in the furfural production process, which contains a large amount of high-concentration organic acid inhibitors. The furfural residue was directly saccharified, and the results showed that the furfural residue hydrolyzate with a solid content of 25% (w / w) contained 13.9g / L acetic acid, 2.4g / L 5-hydroxymethylfurfural and 2.5g / L formic acid. The evolved strain Paecilomyces variotii ZW70 and the original strain were inoculated in the wheat straw hydrolyzate at an inoculation rate of 10% (v / v), and cultured at 37℃, 750rpm, and 1vvm ventilation. The results showed that Paecilomyces variotii ZW70 could completely degrade all acetic acid, 5-hydroxymethylfurfural and formic acid within 34h; while the original strain still had 35.0% acetic acid left. This shows that the evolved strain Paecilomyces variotii ZW70 has a significantly stronger biological detoxification ability for industrial and agricultural byproduct hydrolyzates containing high concentrations of inhibitors than the original strain.

[0062] Example 4: Restoration of the ability of the evolved strain ZW70 of Paecilomyces variotii to degrade high concentration inhibitors after freezing

[0063] The spore solution of the evolved strain of Paecilomyces variotii ZW70 was prepared into a 30% (v / v) glycerol solution and then stored in a -80°C refrigerator for 180 days. The glycerol seed was taken out and streaked three times on a PDA solid medium containing 15.0 g / L acetic acid, 1.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural to restore the activity of the strain. The restored activity of Paecilomyces variotii ZW70 and the long-term frozen ZW70 were cultured in seed liquid and used for biological detoxification of 25% (w / w) solid content of corncob furfural residue hydrolyzate. The results showed that the detoxification performance of Paecilomyces variotii ZW70 after the activity was restored was similar to that of the strain before long-term storage (Example 3); its acetic acid removal rate was significantly higher than that of the strain after long-term freezing. This shows that long-term freezing has a negative impact on the detoxification performance of Paecilomyces variotii ZW70, but its ability to degrade high concentration inhibitors can be effectively restored by continuous subculturing and activation on a solid plate containing inhibitors.

[0064] Partial ITS sequence of isolated Paecilomyces variotii:

[0065] TATGCTTAAGTTCAGCGGGTATCCCTAACCTGATCCGAGGTCAACCTAAGAGAAAGATATAGGTGACCCGTGAAGGTCGTGTGGCCAGCAAGCCGGCCGGTTCTACTGAAGCGTGTGACAGAGCCCCATACGCTCGAGGACCGGACG CGACGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGAGGGGGGACGGCGGCCCAACACACCAGCCGGGCTGGAGGGTTAGCAATGACGCTCGGACAGGCATGCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCG ATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTGATTGATTGTATACTCAGACGGCAACCTTCCAGGCAGCGTTCCAGGGG TCTTCGGCGGGCGCGGGCCCGGGGGCGTGAACCCCCCGGCGGCCGGGGCGTGAACCACGGCGGGCCCGCCGAAGCAACAGGTGTCAGGACAACACGGATGGGAGGTTGGGCCCCGAGGGACCCTCACTCGGTAATGATCCTTCCGG

[0066] The above description only represents the preferred implementation of the present invention. It should be noted that a person skilled in the art can make various modifications and improvements without departing from the conceptual framework disclosed in the present invention. These modifications and improvements should also be considered within the scope of protection of the present invention.

Claims

1. A biodetoxification strain for degrading high concentrations of wood fiber-derived inhibitors, characterized in that: First, a filamentous fungus with a certain ability to degrade lignocellulosic raw materials was isolated from furfural residue raw materials derived from industrial corn cobs containing high concentrations of inhibitors; then, the strain was subjected to a long period of adaptive evolution in a synthetic culture medium containing inhibitors, and finally a detoxified strain with the ability to stably degrade high concentrations of lignocellulosic source inhibitors was obtained.

2. A biodetoxification strain for degrading high-concentration wood fiber-derived inhibitors according to claim 1, characterized in that: The filamentous fungus isolated from furfural residue raw materials derived from industrial corn cobs was identified as Paecilomyces variotii after ITS sequence alignment.

3. A biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors according to claim 1, characterized in that: The long-term adaptive evolution method of filamentous fungi separated from furfural residue raw materials from industrial corn cobs comprises the following steps: (1) Preparation of spore solution: streak wild-type Paecilomyces variotii on a PDA plate and culture at 37°C for 4 days to produce a large number of gray-yellow spores; wash the plate with 0.05% (w / w) Tween 80 and collect the spore solution for subsequent subculture; the spore solution concentration is 10 8 -10 9 Pieces / mL; (2) Preparation of medium for long-term evolution: The basic medium contains 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2 and 15g / L glucose; the evolution process was divided into five stages, and different concentrations of acetic acid, 5-hydroxymethylfurfural and furfural mixed inhibitors were added to the culture medium at different stages. In the first stage, acetic acid 5g / L, 5-hydroxymethylfurfural 0.5g / L, furfural 0.5g / L; in the second stage, acetic acid 7.0g / L, 5-hydroxymethylfurfural 1.0g / L, furfural 0.5g / L; in the third stage, acetic acid 9.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fourth stage, acetic acid 11.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fifth stage, acetic acid 15.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; (3) Evolution during the long-term adaptation period: 1% (v / v) of the spore solution of Paecilomyces variotii was inoculated into 100 mL of the first-stage evolution medium, the initial pH was adjusted to 4.5, and the culture was carried out at 37°C and 300 rpm for 3 days; then, the culture was continuously subcultured 70 times at a 10% (v / v) inoculation amount; (4) Single colony isolation: The subculture medium was separated by streaking on a PDA plate to obtain a single colony.

4. A biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors according to claim 1, which is deposited in the China Center for Type Culture Collection on August 28, 2024, and the deposit number is CCTCCM20241863.

5. A method for maintaining the activity of a biological detoxification strain that degrades high-concentration wood fiber-derived inhibitors according to claim 1, characterized in that: Including the following points: (1) Preparation of activation medium: Add 2 g / L KH2PO4, 1 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 1 g / L yeast extract, 0.5 g / L CaCl2, 15 g / L glucose, 15.0 g / L acetic acid, 1.5 g / L 5-hydroxymethylfurfural and 0.5 g / L furfural to PDA medium to prepare a solid plate for activation; (2) Activation of bacterial strains: Use an inoculation loop to directly scrape the plates, glycerol stocks, or long-term bacterial strains stored in the refrigerator, streak them on the activated culture plates, and culture them at 37°C for 3-5 days. Pick out larger single colonies each time and perform streak culture three times. (3) The evolved strains activated by subculture can still achieve efficient degradation of high concentrations of inhibitors in synthetic culture medium and lignocellulose hydrolysate.

6. The method for maintaining the activity of a biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors according to claim 5, characterized in that: The method further comprises: (1) culturing a biological detoxified seed solution: adding 10 mL of a 0.05% (v / v) Tween 80 aqueous solution to a passage plate covered with fungal spores, and then scraping and collecting the spore solution with a sterilized cell spreading stick; inoculating 1 mL of the spore solution into 100 mL of a fungal basal culture medium free of inhibitors, and culturing at a constant temperature of 37° C. and a rotation speed of 300 rpm for 24 hours; (2) Biological detoxification: The seed culture solution was inoculated into the lignocellulose hydrolysate containing inhibitors at an inoculum amount of 10% (v / v).

7. The method for maintaining the activity of a biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors according to claim 6, characterized in that: The basic culture medium in step (1) contains 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2 and 15g / L glucose.

8. The method for maintaining the activity of a biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors according to claim 6, characterized in that: The cellulose raw materials include but are not limited to straw, wood chips, corn cob furfural residues and other common cellulose raw materials.

9. The method for maintaining the activity of a biological detoxification strain for degrading high-concentration wood fiber-derived inhibitors in metabolizing high-inhibitors according to claim 6, characterized in that: The detoxification conditions in step (2) are 28-48°C, 200-750rpm, and 0.5-2.0vvm. Preferably, the culture conditions are 37°C, 750rpm, and 1vvm.

10. A long-term adaptive evolution method of filamentous fungi isolated from industrial corncob furfural residue raw materials according to claim 2, comprising the following steps: (1) Preparation of spore solution: streak wild-type Paecilomyces variotii on a PDA plate and culture at 37°C for 4 days to produce a large number of gray-yellow spores; wash the plate with 0.05% (w / w) Tween 80 and collect the spore solution for subsequent subculture; the spore solution concentration is 10 8 -10 9 Pieces / mL; (2) Preparation of medium for long-term evolution: The basic medium contains 2g / L KH2PO4, 1g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 1g / L yeast extract, 0.5g / L CaCl2 and 15g / L glucose; the evolution process was divided into five stages, and different concentrations of acetic acid, 5-hydroxymethylfurfural and furfural mixed inhibitors were added to the culture medium at different stages. In the first stage, acetic acid 5g / L, 5-hydroxymethylfurfural 0.5g / L, furfural 0.5g / L; in the second stage, acetic acid 7.0g / L, 5-hydroxymethylfurfural 1.0g / L, furfural 0.5g / L; in the third stage, acetic acid 9.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fourth stage, acetic acid 11.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; in the fifth stage, acetic acid 15.0g / L, 5-hydroxymethylfurfural 1.5g / L, furfural 0.5g / L; (3) Evolution during the long-term adaptation period: 1% (v / v) of the spore solution of Paecilomyces variotii was inoculated into 100 mL of the first-stage evolution medium, the initial pH was adjusted to 4.5, and the culture was carried out at 37°C and 300 rpm for 3 days; then, the culture was continuously subcultured 70 times at a 10% (v / v) inoculation amount; (4) Single colony isolation: The subculture medium was separated by streaking on a PDA plate to obtain a single colony.

Images