RBM-CeO2 nano-drug as well as preparation method and application thereof

Abstract

The invention relates to an RBM-coated CeO2 nano-drug and a preparation method and application thereof.CeO2 nano-particles are wrapped with RBM, then diabetic nephropathy is relieved with the nano RBM drug, and the treatment effect is evaluated; the RBM-CeO2 is passively targeted to the kidney after intravenous injection and releases CeO2 in glomerulus, the RBM-CeO2 enters cells and can inhibit expression of HGMB1 protein, phosphorylation of NF-kB protein is weakened by down-regulation of expression of the HGMB1 protein, glomerular inflammation can be relieved by reduction of phosphorylation of NF-kB, the treatment effect of RBM-CeO2 on relieving of a molecular mechanism of diabetic nephropathy is revealed, and the RBM-CeO2 can be used for treating diabetic nephropathy. The invention aims to provide feasible prevention and treatment measures for patients with diabetic nephropathy.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomaterials, and relates to a RBM@CeO2 nanomedicine and a preparation method and application thereof, and in particular to an application of the RBM@CeO2 nanomedicine in treating diabetic nephropathy. Background Art

[0002] Diabetes is a metabolic disease characterized by chronic high blood sugar levels caused by defective insulin secretion, impaired insulin action, or both. Diabetes affects how the body uses blood sugar (glucose), the body's main energy source. Long-term high blood sugar levels can lead to a variety of serious health problems affecting the heart, blood vessels, eyes, kidneys, and nervous system. There are several main types of diabetes:

[0003] Type 1 diabetes: Formerly known as juvenile diabetes, it can occur at any age. In this type, the body's immune system mistakenly attacks and destroys the insulin-producing pancreatic beta cells, resulting in an absolute insulin deficiency. Patients need to rely on exogenous insulin injections for life to survive.

[0004] Type 2 diabetes: This is the most common type and is associated with excess weight, poor diet, lack of exercise and genetic factors. In type 2 diabetes, the body cannot use insulin effectively (insulin resistance) or the pancreas does not produce enough insulin to maintain normal blood sugar levels.

[0005] Gestational diabetes: This is an abnormality in sugar metabolism that occurs during pregnancy and usually disappears after delivery, but increases the risk of developing type 2 diabetes later in life.

[0006] Other special types of diabetes: including diabetes caused by specific diseases, drugs or gene mutations, such as pancreatic diseases, endocrine diseases, drug-induced (such as glucocorticoids) or single gene mutation diabetes. Although there is a lot of promising experimental data showing that renal fibrosis can be alleviated, the currently available clinical treatment strategies are to improve or delay diabetic nephropathy, but cannot reverse it. One of the main obstacles to translating new anti-fibrosis strategies from the laboratory to the clinic is the complexity of the drug delivery process and the discovery of new therapeutic targets, so new therapeutic targets and delivery methods are urgently needed.

[0007] Diabetic nephropathy (DKD), as one of the most serious microvascular complications of diabetes, focuses on the progressive damage of the glomerular and tubular structures, which is characterized by significant fibrosis. This complex process starts with biochemical disorders induced by hyperglycemia, and then gradually progresses to thickening of the glomerular basement membrane, dysfunction of the glomerular filtration barrier, and extensive fibrosis of the tubulointerstitium. With these structural changes, the glomerulus begins to experience ultrafiltration, resulting in increased leakage of trace albumin in the urine, which is one of the early signs of DKD. Hyperglycemia not only directly damages renal blood vessels and filtration units, but also accelerates the inflammatory response in the kidney by activating multiple pathological pathways. For example, persistent hyperglycemia can stimulate the proliferation of glomerular mesangial cells and deposition of extracellular matrix, causing glomerular sclerosis. At the same time, it can also promote the enhancement of oxidative stress response in renal tissue, release a large amount of reactive oxygen species, further damage renal cells, and promote the fibrosis process. Hypertension, as an important coexisting factor of DKD, not only aggravates the abnormality of renal hemodynamics, but also directly promotes the increase of glomerular capsule pressure and glomerular sclerosis, accelerating the process of fibrosis. The cumulative effect of this series of pathological and physiological changes gradually reduces the kidney's ability to remove waste and excess water from the body, which is manifested as a continuous decrease in eGFR and irreversible damage to renal function.

[0008] The relationship between diabetic nephropathy (DKD) and nuclear factor κB (NF-κB) reveals an important pathophysiological mechanism that plays a central role in the progression of DKD. NF-κB is a transcription factor complex that is widely present in various cells. When activated, it can regulate the expression of many genes and participate in regulating various biological processes such as cell proliferation, apoptosis, inflammatory response, and immune response. In the context of DKD, abnormal activation of NF-κB is closely related to the following aspects: Inflammatory response: Under hyperglycemic conditions, oxidative stress in renal cells is enhanced, activating the NF-κB signaling pathway, leading to excessive production of inflammatory factors (such as TNF-α and IL-6). These inflammatory factors can promote inflammatory responses in the glomeruli and tubulointerstitium and accelerate the process of fibrosis. Fibrosis: NF-κB activation can promote glomerular sclerosis and tubulointerstitial fibrosis, which are key pathological changes in the progression of DKD to end-stage renal disease. By regulating the imbalance between the synthesis and degradation of extracellular matrix (ECM) components, NF-κB promotes the accumulation of fibrous components such as collagen, leading to the gradual loss of renal function. Apoptosis: In DKD, factors such as hyperglycemia and hypertension can promote apoptosis of renal cells, especially glomerular endothelial cells and tubular epithelial cells, through NF-κB activation, which further aggravates the damage of renal function. Vascular dysfunction: NF-κB activation is also associated with vascular endothelial dysfunction, which worsens the blood supply to the kidney and promotes the development of DKD by affecting vasoconstriction and increasing platelet aggregation. Given the key role of NF-κB in the pathological process of DKD, it is regarded as a potential therapeutic target. Studies have shown that specifically inhibiting the activity of NF-κB, such as reducing its nuclear translocation or downregulating the expression of its downstream target genes through drug intervention, can effectively slow the progression of DKD in experimental models, reduce inflammation and fibrosis, and protect renal function. Therefore, reducing the phosphorylation of the NF-κB signaling pathway in DKD is of great significance for the development of new therapeutic drugs. Summary of the invention

[0009] In view of this, one of the objects of the present invention is to provide a method for preparing RBM@CeO2 nanodrug, a second object of the present invention is to provide a RBM@CeO2 nanodrug prepared by the preparation method, a third object of the present invention is to provide the application of the RBM@CeO2 nanodrug in the treatment of diabetic nephropathy, and a fourth object of the present invention is to provide a pharmaceutical preparation containing RBM@CeO2 nanodrug and the application of the pharmaceutical preparation in the treatment of diabetic nephropathy.

[0010] In order to achieve the above object, the present invention provides the following technical solutions:

[0011] A method for preparing RBM@CeO2 nanomedicine comprises the following steps:

[0012] S1. Mix a CeCl3 solution with a concentration of 0.008 mol / L and a Na3C6H5O7 solution in a volume ratio of 1:1, and stir with a magnetic stirrer at room temperature for 1-30 min to obtain a mixed solution of CeCl3·7H2O and Na3C6H5O7;

[0013] S2, adding a (CH2)6N4 solution having a volume ratio of 1:1 and a concentration of 0.08-0.16 mol / L to the mixed solution prepared in step S1, and stirring with a magnetic stirrer at room temperature for 1-6 hours, and then stirring at 60-80°C for 0.5-2 hours; when the solution turns saturated yellow, adding 0.8 ml NH4OH and 1.4 ml H2O2;

[0014] S3, placing the solution prepared in step S2 into a round-bottom flask with a reflux condenser, and boiling for 4 to 6 hours to finally obtain a clear and colorless solution;

[0015] S4, concentrating the solution prepared in step S3 by vacuum rotary evaporation in a water bath at 60-70°C;

[0016] S5, adding 1-5 mol / L CaCl2 solution to the concentrated solution in step S4 several times and centrifuging and washing to separate the solid phase;

[0017] S6. After the last centrifugation in step S5, a Na3C6H5O7 solution with a molar ratio of 1:1 is added to the precipitate to obtain a transparent solution without impurities and dialyze;

[0018] S7. Filter the dialyzed solution in step S6 through a membrane filter with a pore size of 0.1-0.15 µm to obtain RBM@CeO2 nanomedicine containing CeO2-wrapped RBM spheres.

[0019] Further, in step S1, 200 ml of a 0.008 mol / L CeCl3 solution and 200 ml of a 0.008 mol / L Na3C6H5O7 solution are uniformly mixed.

[0020] Furthermore, in step S2, when the size of the (CH2)6N4 solution nanoparticles is 2 nm, the solution concentration is selected to be 0.16 mol / L, and when the size of the (CH2)6N4 solution nanoparticles is 10 nm, the solution concentration is selected to be 0.08 mol / L.

[0021] Further, the steps of adding calcium chloride solution and centrifuging in step S5 are repeated three times in total.

[0022] Furthermore, in step S6, a dialysis membrane with a molecular weight cutoff of 3.5 kDa is used for dialysis, and deionized water is replaced every 12 hours.

[0023] RBM@CeO2 nanomedicine prepared by the above-mentioned RBM@CeO2 nanomedicine preparation method.

[0024] The application of the above RBM@CeO2 nanomedicine in the preparation and treatment of diabetic nephropathy.

[0025] A RBM@CeO2 nanomedicine preparation comprises the above RBM@CeO2 nanomedicine and one or more pharmaceutically acceptable drug carriers or compounds.

[0026] Application of the above RBM@CeO2 nanodrug preparation in the preparation and treatment of diabetic nephropathy.

[0027] The beneficial effects of the present invention are:

[0028] 1. The RBM@CeO2 nanomedicine disclosed in the present invention has been determined through animal experiments that the optimal concentration of RBM@CeO2 for treating diabetes in mice is 5 mg / kg. The results of the toxicity experiment of RBM@CeO2 show that there is no significant difference between normal mice and the control group after four weeks of administration (10 mg / kg). The results show that the RBM@CeO2 nanomedicine has no obvious toxicity to mice when administered intravenously at 10 mg / kg, which indicates that RBM@CeO2 nanomedicine is a nanomaterial that can be safely used for intravenous injection. The RBM@CeO2 nanomedicine synthesized by the present invention can repair diabetic nephropathy induced by SYZ, and is intended to allow RBM@CeO2 to be released in the kidneys after diabetic nephropathy induced by SYZ, thereby treating or delaying the development of diabetic nephropathy.

[0029] 2. The RBM@CeO2 nanomedicine disclosed in the present invention uses RBM to wrap CeO2 nanoparticles, and then uses this nano RBM@CeO2 drug to alleviate diabetic nephropathy, and implements a treatment effect evaluation; RBM@CeO2 passively targets the kidneys after intravenous injection, and releases RBM@CeO2 in kidney cells. RBM@CeO2 enters the cells and can inhibit the expression of HGMB1 protein. The downregulation of HGMB1 protein expression weakens the phosphorylation of NF-κB protein. The reduction in NF-κB phosphorylation can alleviate renal inflammation, revealing the molecular mechanism therapeutic effect of RBM@CeO2 on alleviating diabetic nephropathy, aiming to provide feasible prevention and treatment measures for patients with chronic renal fibrosis.

[0030] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0032] Figure 1 A is a transmission electron microscope image of RBM@CeO2 nanoparticles of the present invention;

[0033] Figure 1 B is an image of podocytes taken using a confocal laser scanning microscope, in which RBM@CeO2 nanoparticles were labeled with red fluorescence;

[0034] Figure 1 C compares the average particle sizes of three different batches and at 1, 3, and 7 days of standing;

[0035] Figure 1 D shows the temporal trend of the Zeta potential of nanoparticles in three different batches and after 1, 3, and 7 days of standing;

[0036] Figure 1 E shows the temporal trends of DPI of nanoparticles in three different batches and after 1, 3, and 7 days of standing;

[0037] Figure 2 A shows the changes in kidney tissue structure after HE staining. From left to right, they are the unintervention control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model.

[0038] Figure 2 B shows the changes in kidney tissue structure after PAS staining, from left to right: the unintervention control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0039] Figure 2C shows the changing trends of blood glucose levels over time in the control group (Control), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0040] Figure 2D shows the changing trends of serum creatinine levels over time in the control group (Control), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0041] Figure 2E shows the changes in the percentage of glomerular sclerosis area in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0042] Figure 2F shows the changes in the thickness of the glomerular capillary wall in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0043] Figure 2G shows the comparison of podocyte process fusion index in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0044] Figure 2H shows the comparison of the proportion of podocytes to the total number of cells in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0045] Figure 2J shows the comparison of podocyte Nephrin and Podocin protein expressions in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0046] Figure 2I shows the comparison of the width of the podocyte foot process in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0047] Figure 3 A shows the comparison of gene expression patterns between the STZ model group and the treatment group receiving RBM@CeO2 treatment under the STZ model;

[0048] Figure 3 B shows the comparison of proteomic sequencing results between the STZ model group and the treatment group receiving RBM@CeO2 treatment under the STZ model;

[0049] Figure 3 C is the result of the combined analysis of genomics and proteomics, showing the enrichment of disease and functional classification;

[0050] Figure 3D shows the inflammation-related results of GWAS analysis;

[0051] Figure 4A shows the bar graph of the mRNA expression of IL-1β in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0052] Figure 4 B shows the bar graph of mRNA expression of TNF-α in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0053] Figure 4 C shows the bar graph of the mRNA expression of IL-6 in the control group (Sham), STZ model group, and the treatment group treated with RBM@CeO2 under STZ model;

[0054] Figure 4 D shows the bar graph of mRNA expression of HMGB1 in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0055] Figure 4 E shows the comparison of Western Blotting results of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0056] Figure 4 F shows the relative expression of IL-1β protein in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0057] Figure 4 G shows the relative expression of protein expression under TNF-α in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0058] Figure 4 H shows the relative expression of protein expression of HMGB1 in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0059] Figure 4 I shows the relative expression of protein expression of p-NF-ΚB / NF-ΚB in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0060] Figure 5A shows the bar graph of mRNA expression of fibronectin in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0061] Figure 5 B shows the bar graph of mRNA expression levels of α-SMA in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0062] Figure 5 C shows the bar graph of the mRNA expression of collagen I in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0063] Figure 5 D shows the percentage of positive areas of Masson-stained sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0064] Figure 5 E shows the Masson staining sections, Fibronectin, α-SMA immunohistochemical section staining and fibrosis comparison of the control group (Sham), STZ model group, and STZ model;

[0065] Figure 5 F shows the percentage of positive area of ​​Fibronectin immunohistochemical sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0066] Figure 5 G shows the percentage of positive area of ​​α-SMA immunohistochemical sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0067] Figure 6 A shows the changes in glomerular structure after HE staining, from left to right: the untreated control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0068] Figure 6B shows the changes in glomerular structure after PAS staining, from left to right: the untreated control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0069] Figure 6 C shows the changing trends of blood glucose levels over time in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0070] Figure 6D shows the changing trends of serum creatinine levels over time in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0071] FIG6E shows the change in percentage of glomerular sclerosis area in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0072] FIG6F shows the changes in the thickness of the glomerular capillary wall in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0073] Figure 6G shows the comparison of podocyte process fusion index in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0074] Figure 6H shows the comparison of the proportion of podocytes to the total number of cells in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model;

[0075] Figure 6I shows the comparison of the immunohistochemical section expressions of Nephrin and Podocin in the glomerular tissues of the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0076] Figure 6J shows the width of the foot processes of glomerular podocytes in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model;

[0077] Figure 7 A shows the changes in urea nitrogen (BUN) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0078] Figure 7 B shows the changes in creatinine (CRE) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0079] Figure 7 C shows the changes in hemoglobin (HGB) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0080] Figure 7 D shows the changes in hematocrit (HCT) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0081] Figure 7 E shows the changes in the red blood cell count (RBC) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0082] Figure 7 F shows the changes in the white blood cell count (WBC) in the blood of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0083] Figure 7 G shows the weight changes of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days;

[0084] Figure 7 H shows the histological structure comparison of the heart, spleen, liver, lung and kidney of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days. DETAILED DESCRIPTION

[0085] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0086] Example 1

[0087] Preparation and physicochemical properties of RBM@CeO2 nanomedicine

[0088] like Figure 1 A method for preparing RBM@CeO2 nanomedicine is shown, comprising the following steps:

[0089] S1. Prepare CeCl3·7H2O and Na3C6H5O7 solutions. Mix 200 ml of 0.008 mol / L CeCl3 solution and 200 ml of 0.008 mol / L Na3C6H5O7 solution and stir with a magnetic stirrer at room temperature for 15 minutes.

[0090] S2. Add (CH2)6N4 solution. Add 400 ml of (CH2)6N4 solution with a concentration of 0.16 mol / L (for 2 nm nanoparticles) or 0.08 mol / L (for 10 nm nanoparticles) to the mixed solution and stir with a magnetic stirrer at room temperature for 3 hours, and then stir at 60°C for 1.5 hours.

[0091] S3. Add NH4OH and H2O2. When the solution turns saturated yellow, add 0.8 ml NH4OH and 1.4 ml H2O2.

[0092] S4. Boil. Place the solution in a round-bottom flask with a reflux condenser and boil for 5 hours. Finally, a clear, colorless solution is obtained.

[0093] S5. Concentrate. The solution was concentrated to 30 ml in a rotary evaporator under vacuum in a water bath at 70°C.

[0094] S6. Precipitation. Add 2 mol / L CaCl2 solution to the solution until the solution becomes turbid. Then separate the solid phase precipitate by centrifugation.

[0095] S7, washing. Repeat the steps of adding calcium chloride solution and centrifuging three times in total.

[0096] S8. Re-suspend. After the last centrifugation, add a 1:1 molar ratio of Na3C6H5O7 solution to the precipitate to obtain a transparent solution without impurities.

[0097] S9, dialysis. Dialysis was performed using a "Cellu Sep H1" dialysis membrane with a molecular weight of 3.5 KDa, and deionized water was replaced every 12 hours (the initial water / colloid volume ratio was 40).

[0098] S10, filtering. The dialyzed solution is filtered through a membrane filter with a pore size of 0.1 µm to obtain RBM@CeO2 nanomedicines of CeO2-wrapped RBM spheres.

[0099] The results are as follows Figure 1 As shown in A~G, RBM@CeO2 nanomedicine is spherical and uniform in size. The particle size of RBM@CeO2 nanomedicine is about 50nm and the surface charge is about -21 mv.

[0100] Figure 1 Figure A shows a transmission electron microscopy image of RBM@CeO2 nanoparticles. The particles exhibit a uniform spherical morphology and are well dispersed. Figure 1B shows an image of podocytes taken using a confocal laser scanning microscope, where RBM@CeO2 nanoparticles are labeled with red fluorescence. It can be seen that the nanoparticles are able to effectively enter the cell interior and distribute in the cytoplasm. Figure 1C compares the average particle size of three different batches of nanoparticles at 1 day, 3 days, and 7 days. The results show that the average particle size of all batches of nanoparticles remained stable at different time points. Figure 1 D and 1E show the time-dependent trends of Zeta potential and DPI of RBM@CeO2, respectively. For all batches. Based on the above results, we can conclude that RBM nanoparticles have good stability and can be effectively accumulated in cells. In addition, the physicochemical properties of nanoparticles, such as particle size and surface charge, change with the extension of culture time, which may affect their biological effects. Further studies are needed to evaluate the impact of these changes on the biocompatibility and functionality of nanoparticles.

[0101] Example 2

[0102] The application of the above RBM@CeO2 nanomedicine in the preparation and treatment of diabetic nephropathy.

[0103] Kidney diabetes, usually referring to diabetic nephropathy, is one of the common complications of diabetes. Its main features include proteinuria, gradually progressive renal impairment, hypertension, edema, and severe renal failure that may occur in the late stage. This complication poses a major health threat to diabetic patients, especially in patients with a longer course of the disease. According to statistics, diabetic nephropathy has become the leading cause of end-stage renal failure. In the United States, approximately 35%-38% of end-stage renal disease cases are caused by diabetic nephropathy. The abnormal ECM deposition caused by diabetes is not limited to the kidneys, but also involves multiple systems such as the cardiovascular and retinal systems. It is one of the key pathological bases for the formation of chronic complications of diabetes. Therefore, regulating ECM metabolism and inhibiting excessive ECM deposition have become one of the important strategies for treating diabetic complications.

[0104] The STZ model, whose full name is the Streptozotocin (STZ)-induced diabetes model, is a commonly used and important animal model for studying diabetes and its complications. Its advantages mainly include: similar to the course of human type 1 diabetes: STZ can specifically destroy pancreatic β cells, simulate the pathogenesis of human type 1 diabetes, lead to absolute insulin deficiency, and make animals quickly show symptoms of hyperglycemia, which is very similar to the course of human type 1 diabetes, low cost and easy to repeat, rapid modeling, wide range of applications, ideal model for studying complications, and flexible dosing regimen. The STZ model has become an indispensable tool in diabetes research because of its convenient experimental operation, high cost-effectiveness, controllable course of disease, and ability to fully reflect the pathological characteristics of diabetes and its complications. It is an ideal pathological model to mimic human diabetic nephropathy and is often used in the mechanism study of renal diabetic nephropathy models.

[0105] Experimental method steps:

[0106] STZ model preparation usually refers to the process of using streptozotocin (STZ) to induce diabetes in experimental animals (mice) to simulate the pathological state of human type 1 diabetes. The following are the general steps and precautions for STZ model preparation:

[0107] 1. Experimental Animal Preparation

[0108] Choose an appropriate animal strain, such as C57BL / 6 mice or SD mice.

[0109] The experimental animals need to fast but not drink water for 10-16 hours to reduce the degradation of STZ by the gastrointestinal tract.

[0110] Make sure the animal is in good health and has no infections or other health problems.

[0111] 2. Preparation of STZ solution

[0112] STZ is generally dissolved in ice-cold citrate buffer, and the pH value is usually around 4.5, because the acidic environment can improve the stability of STZ.

[0113] The preparation process needs to be quick because STZ has poor stability in solution. It is recommended to complete dissolution within 5 minutes before use and use it immediately.

[0114] 3. STZ injection

[0115] The STZ dose is calculated based on the animal's body weight, usually in the range of 50-200 mg / kg. For the induction of type 1 diabetes models, the commonly used dose is 150-200 mg / kg. However, the specific dose needs to be adjusted according to the experimental purpose and animal strain.

[0116] The animals were given STZ solution by intraperitoneal injection.

[0117] Closely monitor the animal's condition after injection to prevent adverse reactions such as hypoglycemia shock.

[0118] 4. Animal Care and Monitoring

[0119] After STZ injection, provide plenty of drinking water and consider giving sugar water for 1-2 days to prevent hypoglycemia.

[0120] Observe the animal's behavior, weight changes, and any abnormalities.

[0121] Blood glucose is usually monitored starting 48-72 hours after STZ injection, and then regularly tested, such as again after one week, to confirm that the diabetes model is successfully established.

[0122] 5. Model determination and remedy

[0123] A blood glucose level significantly above the normal range (usually >16.7mmol / L or 300mg / dL) indicates that the model has been successfully established.

[0124] For animals that fail to meet the criteria for diabetes, consider giving a lower dose of STZ (such as 10-20 mg / kg) again after the animal's condition stabilizes or wait until blood sugar returns to normal before trying again.

[0125] Model: STZ, STZ + RBM@CeO2. Figure 2 The histopathological changes and biochemical index detection results of the STZ diabetic nephropathy model before and after RBM@CeO2 treatment are shown.

[0126] Sham usually refers to the sham operation group in the experiment, that is, the group that undergoes surgery but does not receive actual intervention. This design is used to control the impact of the surgery itself on the experimental results and ensure the reliability of the experimental results.

[0127] Figure 2 A shows the changes in kidney tissue structure after HE staining. From left to right, they are the untreated control group (Sham), STZ model group, RBM@CeO2 treatment group, and RBM@CeO2 treatment group under STZ model. In the HE staining section ( Figure 2 A) The renal tissue structure of the control group was normal, with clearly visible glomeruli and renal tubules; the STZ-induced diabetic nephropathy model showed obvious glomerular hypertrophy, tubular dilatation, and interstitial inflammatory cell infiltration; and the degree of the above-mentioned lesions was significantly reduced in the RBM@CeO2-treated model.

[0128] Figure 2 B shows the changes in kidney tissue structure after PAS staining. From left to right, they are the untreated control group (Sham), STZ model group, RBM@CeO2 treatment group, and RBM@CeO2 treatment group under STZ model; PAS staining section ( Figure 2 B) shows that the glomerular basement membrane of the control group is intact and has no glycogen deposition; the glomerular basement membrane of the diabetic model prepared by STZ is thickened and colored red, indicating increased glycogen deposition; while the treatment group receiving RBM@CeO2 has reduced glycogen deposition and the basement membrane thickness is close to normal levels.

[0129] Figure 2C shows the changing trends of blood glucose levels over time in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under the STZ model. The results showed that the blood glucose level of the STZ-prepared diabetic model was significantly increased, while the blood glucose level decreased after RBM@CeO2 treatment, but was still higher than that of the normal control group.

[0130] Figure 2D shows the changing trends of serum creatinine levels over time in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model. The results showed that the control group maintained a low level, the serum creatinine of diabetic model mice increased significantly, and the treatment group was significantly lower than the model group at 6 and 12 weeks after treatment.

[0131] Figure 2E shows the changes in the percentage of glomerular sclerosis area in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; Figure 2F shows the changes in the thickness of the glomerular capillary wall in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the STZ diabetic model had severe glomerular sclerosis and thickened capillary walls, while the above indicators were improved in the treatment group treated with RBM@CeO2 and the treatment group treated with RBM@CeO2 under STZ model.

[0132] Figure 2G shows the comparison of podocyte protrusion fusion index in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the index of the control group was low, the index of the STZ diabetes model was significantly increased, while the index of the treatment group treated with RBM@CeO2 and the treatment group treated with RBM@CeO2 under STZ model was reduced.

[0133] Figure 2H shows the comparison of the proportion of podocytes to the total number of cells in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the proportion in the control group was high, the proportion in the STZ diabetes model was significantly reduced, and the proportion in the treatment group treated with RBM@CeO2 and the treatment group treated with RBM@CeO2 under STZ model increased slightly.

[0134] Figure 2J shows the comparison of Nephrin and Podocin protein expression in podocytes of the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the proportion in the control group was high, the proportion in the STZ diabetes model was significantly reduced, and the proportion in the treatment group treated with RBM@CeO2 and the treatment group treated with RBM@CeO2 under STZ model was significantly reduced.

[0135] Figure 2I shows the comparison of the width of the podocyte foot process in the control group (Sham), STZ model group, treatment group treated with RBM@CeO2, and treatment group treated with RBM@CeO2 under STZ model; the results show that the proportion of the control group is high, the proportion of the STZ diabetes model is significantly reduced, and the width of the glomerular podocyte foot process in the treatment group treated with RBM@CeO2 and the treatment group treated with RBM@CeO2 under STZ model is significantly reduced. In summary, RBM@CeO2 can alleviate renal damage in the diabetic nephropathy model, reduce blood glucose and serum creatinine levels, and improve glomerular sclerosis and podocyte damage.

[0136] After RBM@CeO2 treatment, kidney tissues of STZ and STZ + RBM@CeO2 groups were sent to the company for sequencing. The transcriptome sequencing results showed that 2056 genes were upregulated and 1048 genes were downregulated. Cluster analysis showed that the gene expression profile of diabetic nephropathy model mice prepared by STZ was significantly different from that of the control group and the RBM@CeO2 treatment group, while the difference between the treatment groups was small. The results of translational genomics enrichment analysis showed the richness of disease and functional classification. STZ model mice were mainly enriched in disease-related pathways such as proteinuria, connective tissue cancer, and urinary system diseases, while after RBM@CeO2 treatment, the enrichment of these diseases was reduced. The treatment effect was best at 20 mg / kg. The results are as follows Figure 3 shown.

[0137] Figure 3 A shows the comparison of gene expression patterns between the STZ model group and the treatment group treated with RBM@CeO2 under the STZ model; cluster analysis found that the gene expression profile of STZ-prepared diabetic nephropathy model mice was significantly different from that of the control group and the RBM@CeO2 treatment group, while the differences between the treatment groups were smaller.

[0138] Figure 3 B shows the comparison of proteomic sequencing results between the STZ model group and the treatment group receiving RBM@CeO2 treatment under the STZ model. The results showed that the RBM@CeO2 treatment group had the least differentially expressed genes compared with the control group.

[0139] Figure 3 C is the result of the joint analysis of genomics and proteomics, showing the richness of disease and functional classification; the results showed that the diabetic nephropathy model was mainly enriched in disease-related pathways such as proteinuria and urinary system diseases, while after RBM@CeO2 treatment, the enrichment of these diseases was reduced.

[0140] Figure 3 D is the result of GWAS analysis, showing the richness of signaling pathways. The results showed that diabetic nephropathy model mice were enriched in interleukin 10 signaling pathway, fatty acid metabolism and other pathways, while after RBM@CeO2 treatment, the enrichment of these pathways decreased.

[0141] In summary, RBM@CeO2 can regulate the gene expression profile of diabetic nephropathy model mice and reduce the enrichment of disease-related genes, especially in proteinuria, cardiovascular disease, and lipid metabolism disorders, thereby playing a protective role.

[0142] Example 3

[0143] ELISA kits were used to detect serum IL-1β, TNF-α, and HMGB1 levels, qRT-PCR was used to detect the expression of IL-1β, TNF-α, HMGB1, and NF-κB at the mRNA level, and Western blotting was used to detect the expression of IL-1β, TNF-α, HMGB1, and NF-κB at the protein level. Compared with the Sham group, the serum IL-1β (A), TNF-α (B), and HMGB1 (C) levels and the mRNA levels of IL-1β (E), TNF-α (F), HMGB1 (G), and NF-κB (H) in the STZ group were significantly increased (P < 0.05 or P < 0.01), and the protein levels of IL-1β (I), TNF-α (J), HMGB1 (K), and NF-κB (L) were also significantly upregulated (P < 0.05 or P < 0.01). Compared with the STZ group, the serum IL-1β (A), TNF-α (B), and HMGB1 (C) levels and the mRNA levels of IL-1β (E), TNF-α (F), HMGB1 (G), and NF-κB (H) in the RBM@CeO2 group were significantly decreased (P < 0.05 or P < 0.01), and the protein levels of IL-1β (I), TNF-α (J), HMGB1 (K), and NF-κB (L) were also significantly downregulated (P < 0.05 or P < 0.01). Figure 4 The results showed that RBM@CeO2 could effectively alleviate the release of renal inflammatory factors in STZ-induced diabetic mice.

[0144] The diabetic model was induced by STZ and treated with RBM@CeO2. The levels of c-collagen I, α-SMA and β-actin mRNA were detected by RT-PCR, and the mRNA expressions of FN, a-SMA, DUSP1 and HDAC1 were detected by QPCR after HK2 cells were incubated with 20 nM TGF-b for 24 hours.

[0145] Total RNA from kidneys was extracted using a total RNA extraction kit and transcribed into cDNA using SSRTII reverse transcriptase (Beijing Qingke). The reaction system included 7.5 mL cDNA, 10 uL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), 1.25 mL specific primers, and a total volume of 20 mL.

[0146] The conditions were set as follows: 98°C for 30 s, 95°C for 30 s, 95°C for 15 s, 40 denaturation cycles, and 60°C for 1 min, with β-actin used as an internal standard.

[0147] Mouse specific primer pairs are as follows:

[0148] IL-1β positive: GAAATGCCACCTTTTGACAGTG; (SEQ ID NO.1)

[0149] IL-1β reverse: TGGATGCTCTCATCAGGACAG; (SEQ ID NO.2)

[0150] TNF-α positive: GCGGCCACAGAAAACACTC; (SEQ ID NO.3)

[0151] TNF-α reverse: CTCCCAATGGTCAAGGCATC; (SEQ ID NO.4)

[0152] IL-6 forward: CTGCAAGAGACTTCCATCCAG; (SEQ ID NO.5)

[0153] IL-6 reverse: AGTGGTATAGACAGGTCTGTTGG; (SEQ ID NO.6)

[0154] HMGB1 forward: GCTGACAAGGCTCGTTATGAA; (SEQ ID NO.7)

[0155] HMGB1 reverse: CCTTTGATTTTGGGGCGGTA; (SEQ ID NO.8)

[0156] β-ACTIN forward: GTCTGCCTTGGTAGTGGATAATG; (SEQ ID NO.9)

[0157] β-ACTIN reverse: TCGAGGACGCCCTATCATGG; (SEQ ID NO. 10).

[0158] Figure 4 It was further shown that RBM@CeO2 improved the renal inflammatory response and inhibited the HMGB1 / NF-κB signaling pathway in STZ model-induced diabetic mice.

[0159] Figure 4 A shows the bar graph of the mRNA expression of IL-1β in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4 B shows the bar graph of mRNA expression of TNF-α in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4C shows the bar graph of IL-6mRNA expression in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4 D shows the bar graph of HMGB1 mRNA expression levels in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the expression of the above inflammatory factors in STZ-prepared diabetic nephropathy model mice was significantly increased, while after RBM@CeO2 treatment, the expression of the above inflammatory factors was reduced, but still higher than that in the normal control group.

[0160] Figure 4 E shows the comparison of Western Blotting results of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model. No obvious bands were found in the control group, while the expression of IL-1β, TNF-α, and p-NF-ΚB in diabetic model mice was enhanced, while the expression was weakened after RBM@CeO2 treatment.

[0161] Figure 4 F shows the relative expression of IL-1β protein in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4 G shows the relative expression of TNF-α proteins in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4 H shows the relative expression of HMGB1 proteins in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 4 I shows the relative expression of p-NF-ΚB / NF-ΚB proteins in mice of the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; the results showed that the above indicators were significantly increased in STZ-prepared diabetic nephropathy model mice, while the expression was reduced after RBM@CeO2 treatment, but still higher than that in the normal control group.

[0162] In summary, RBM@CeO2 can inhibit the inflammatory response of diabetic nephropathy model mice and reduce the expression of inflammatory factors, but it failed to completely restore normal levels.

[0163] Example 4

[0164] 1) STZ-induced diabetes model was used and RBM@CeO2 was given. The levels of c-collagen I, α-SMA and β-actin mRNA were detected by RT-PCR. After HK2 cells were incubated with 20 nM TGF-b for 24 hours, the mRNA expressions of FN, a-SMA, DUSP1 and HDAC1 were detected by QPCR.

[0165] Total RNA from kidneys was extracted using a total RNA extraction kit and transcribed into cDNA using SSRTII reverse transcriptase (Beijing Qingke). The reaction system included 7.5 mL cDNA, 10 uL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), 1.25 mL specific primers, and a total volume of 20 mL.

[0166] The conditions were set as follows: 98°C for 30 s, 95°C for 30 s, 95°C for 15 s, 40 denaturation cycles, and 60°C for 1 min, with β-actin used as an internal standard.

[0167] Mouse specific primer pairs are as follows:

[0168] Fibronectin forward: TCTGTGCCTCCTATCTATGTGC; (SEQ ID NO.11)

[0169] Fibronectin reverse: GAGGGACCACGACAACTCTTC; (SEQ ID NO.12)

[0170] a-SMA forward: GTTGAGAACCGTGTACCATGT; (SEQ ID NO.13)

[0171] a-SMA reverse: TTCCCACAATTTGGCAAGAGC; (SEQ ID NO.14)

[0172] β-ACTIN forward: CCAGAAGGACTGTTATGTGGGA; (SEQ ID NO.15)

[0173] β-ACTIN reverse: GACTCCGTGTTCAATGGGATAC; (SEQ ID NO.16)

[0174] Figure 5 This is the improvement effect of RBM@CeO2 of the present invention on renal fibrosis in STZ diabetic nephropathy model mice.

[0175] Figure 5A shows the bar graph of mRNA expression of fibronectin in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 5 B shows the bar graph of mRNA expression levels of α-SMA in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model; Figure 5 C shows a bar graph of the mRNA expression levels of collagen I in mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under the STZ model; the results showed that the above indicators were significantly increased in STZ-prepared diabetic nephropathy model mice, while the expression was reduced after RBM@CeO2 treatment, but still higher than the normal control group.

[0176] Figure 5 D shows the percentage of positive areas of Masson-stained sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0177] Figure 5 E shows the control group (Sham), STZ model group, Masson staining sections under STZ model, Fibronectin, α-SMA immunohistochemistry section staining and fibrosis comparison; the results showed that there was no obvious staining in the control group, and a large amount of blue staining appeared around the glomeruli and tubules of STZ diabetic model mice, that is, fibrosis areas, while after RBM@CeO2 treatment, the degree of fibrosis was alleviated and ECM accumulation was reduced.

[0178] Figure 5 F shows the percentage of positive area of ​​Fibronectin immunohistochemical sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0179] Figure 5 G shows the percentage of positive area of ​​α-SMA immunohistochemical sections of mice in the control group (Sham), STZ model group, and treatment group treated with RBM@CeO2 under STZ model;

[0180] The results are as follows Figure 5 The results showed that the expression levels of HDAC1, Fibronectin and a-SMA were significantly increased in the kidneys of chronic renal injury, while the treatment group could significantly inhibit the reduction of HDAC1, Fibronectin and a-SMA expression ( Figure 5), while DUSP1 mRNA and protein showed significant increase. WB results were consistent with QPCR results.

[0181] 1) Expression of fibrosis markers after RBM@CeO2 treatment of UUO, the degree of collagen deposition was analyzed by Masson trichrome staining, and the expression changes of fibronectin and α-SMA were observed by immunohistochemical staining. Compared with the control group, diabetic mice showed significantly elevated c-collagen I, α-SMA, and β-actin mRNA levels, as well as enhanced collagen deposition and expression of fibronectin and α-SMA. However, in diabetic mice treated with RBM@CeO2, the above indicators were significantly improved and close to the levels of the healthy control group. RBM@CeO2 may alleviate renal damage in diabetic mice by inhibiting the expression of fibrosis-related genes and collagen deposition. The results are shown in Figure 4 This finding provides a potential target for developing new treatments for diabetic nephropathy.

[0182] Example 5

[0183] DB / DB mice are a widely used animal model of type 2 diabetes. Its full name is diabetic (DB) mice, which originated from a recessive mutant gene, the DB gene, discovered in the Jackson Laboratory in 1966. This gene mutation is located on chromosome 4 and affects the function of the leptin receptor (LEPR), leading to leptin signaling disorders. Since leptin is a key hormone that regulates energy balance and appetite, the loss of its receptor function causes DB / DB mice to show symptoms of excessive eating, weight gain, and severe obesity, and then develop a series of typical characteristics of diabetes and its complications, such as insulin resistance, hyperglycemia, and hyperlipidemia. Specifically, the diabetic characteristics of DB / DB mice include: Early onset: Starting from a few weeks after birth, DB / DB mice will experience rapid weight gain, and obvious obesity can be observed at about 3-4 weeks of age. Insulin resistance and hyperglycemia: As they age, mice gradually develop insulin resistance, which is manifested as high blood sugar levels. Usually, blood sugar increases significantly at 8-10 weeks of age, and hyperglycemia can be detected without exogenous sugar load. Metabolic disorders: In addition to hyperglycemia, DB / DB mice also have metabolic abnormalities such as high triglycerides and elevated cholesterol levels, which are similar to the metabolic characteristics of human type 2 diabetes patients. Multi-organ damage: Long-term diabetic status can cause damage to the functions of multiple organs such as the heart, kidneys, and retina of DB / DB mice, which can be used to simulate and study diabetic complications. Genetic background: The genetic background of DB / DB mice is mainly C57BL / Ks mice, about 71% of its genome comes from the C57BL / 6J (B6) strain and 29% comes from the DBA / 2J (DBA) strain. This mixed background makes the diabetes manifestations of DB / DB mice more obvious. Reproductive characteristics: Homozygous DB / DB female mice usually lose their reproductive ability due to obesity, but their ovaries can be transplanted into non-DB / DB mice to restore their fertility. Therefore, DB / DB mice are widely used in basic scientific research and drug development as an important tool for studying the pathogenesis of type 2 diabetes, drug screening, and treatment strategies for complications.

[0184] Model: DB / DB, DB / DB + RBM@CeO2.

[0185] Figure 6 The present invention shows the pathological changes of renal injury in DBDB mice and the intervention effect of RBM@CeO2.

[0186] Figure 6 A shows the changes in glomerular structure after HE staining, from left to right: the untreated control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; Figure 6B shows the changes in glomerular structure after PAS staining. From left to right, they are the unintervention control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model. No obvious lesions were found in the control group, while the glomerular basement membrane of the DBDB group mice was thickened, the mesangial area was expanded, and the podocytes were detached, and the above symptoms were improved after RBM@CeO2 treatment.

[0187] Figure 6 C shows the changing trends of blood glucose levels over time in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; Figure 6D shows the changing trends of serum creatinine levels over time in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; the results showed that the serum creatinine level of mice in the DBDB group was significantly increased, while the above indicators decreased after RBM@CeO2 treatment.

[0188] Figure 6E shows the changes in the percentage of glomerular sclerosis area in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; Figure 6F shows the changes in the glomerular capillary wall thickness in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; Figure 6G shows the comparison of the podocyte process fusion index in the control group (Sham), the STZ model group, the treatment group treated with RBM@CeO2, and the treatment group treated with RBM@CeO2 under the STZ model; Figure 6H shows the comparison of the proportion of podocytes to the total number of cells in the control group (Sham), the STZ model group, the treatment group treated with RBM@CeO2, and the treatment group treated with RBM@CeO2 under the STZ model; the results showed that DBDB The thickness of glomerular basement membrane increased, the number of WT-1+ cells decreased, and the density of podocytes decreased in the mice of the RBM@CeO2 group, while the above indicators improved after RBM@CeO2 treatment.

[0189] Figure 6I shows the comparison of immunohistochemical expression of nephrin and podocin in the glomerular sections of the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model; the results showed that there was no obvious staining in the control group, the number of podocytes in the DBDB group mice decreased, and the expression of nephrin and podocin decreased, while the number of podocytes increased after RBM@CeO2 treatment, and the expression of nephrin and podocin was enhanced.

[0190] Figure 6J shows the width of the foot processes of glomerular podocytes in the control group (Sham), the treatment group treated with RBM@CeO2, the DBDB model group, and the treatment group treated with RBM@CeO2 under the DBDB model.

[0191] The results are as follows Figure 6 The results showed that DBDB mice showed obvious signs of renal injury, such as thickening of glomerular basement membrane and podocyte shedding, while RBM@CeO2 could improve the above symptoms, reduce serum creatinine, increase podocyte density and the expression of nephrin and podocin.

[0192] Example 6

[0193] Toxicity evaluation of RBM@CeO2 nanodrugs

[0194] HK-2 cells were co-cultured with 200 μg / mL RBM@CeO2 and the cell viability was measured after 24 h. Figure 7 As shown in the figure, 800 μg / mL had no effect on cell viability, indicating that the prepared RBM@CeO2 was biosafe in in vitro experiments. After treating mice with RBM@CeO2 (20 mg / kg) for 7 days, blood was collected to analyze CRE, BUN, WBC, HGB, RBC, HTC and ALT in the blood, and HE staining was performed on the heart, liver, spleen, lung and kidney. The results are shown in the figure. Figure 7 As shown in Figure G, compared with the control group, the mice treated with RBM@CeO2 had no significant changes in body weight. Blood analysis showed that there were no significant differences in CRE, BUN, WBC, HGB, RBC, and HTC in the blood compared with the control group ( Figure 7 HE staining of the heart, liver, spleen, lung, and kidney showed no obvious pathological changes in each organ ( Figure 7 Middle H).

[0195] Figure 7 This is the effect of RBM@CeO2 of the present invention on the physiological and biochemical indicators and organs of healthy mice.

[0196] Figure 7 A shows the changes in urea nitrogen (BUN) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; Figure 7 B shows the changes in creatinine (CRE) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; Figure 7 C shows the changes in hemoglobin (HGB) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; Figure 7 D shows the changes in the hematocrit (HCT) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; the results showed that there was no significant difference between the control group and the RBM@CeO2 group.

[0197] Figure 7 E shows the changes in the red blood cell count (RBC) of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; Figure 7 F shows the changes in the white blood cell count (WBC) in the blood of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; Figure 7 G shows the changes in body weight of mice in the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; the results showed that there was no significant difference between the control group and the RBM@CeO2 group.

[0198] Figure 7 H shows the histological structure comparison of the heart, spleen, liver, lung and kidney of the control group (Sham) and the treatment group treated with RBM@CeO2 after 30 days; the results showed that there was no significant difference between the control group and the RBM@CeO2 group. In summary, RBM@CeO2 has no adverse effects on the physiological and biochemical indicators and organs of healthy mice.

[0199] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. A method for preparing RBM@CeO2 nanomedicine, characterized in that: The following steps are involved: S1. Mix a CeCl3 solution with a concentration of 0.008 mol / L and a Na3C6H5O7 solution in a volume ratio of 1:1, and stir with a magnetic stirrer at room temperature for 1-30 min to obtain a mixed solution of CeCl3·7H2O and Na3C6H5O7; S2, adding a (CH2)6N4 solution having a volume ratio of 1:1 and a concentration of 0.08-0.16 mol / L to the mixed solution prepared in step S1, and stirring with a magnetic stirrer at room temperature for 1-6 hours, and then stirring at 60-80°C for 0.5-2 hours; when the solution turns saturated yellow, adding 0.8 ml NH4OH and 1.4 ml H2O2; S3, placing the solution prepared in step S2 into a round-bottom flask with a reflux condenser, and boiling for 4 to 6 hours to finally obtain a clear and colorless solution; S4, concentrating the solution prepared in step S3 by vacuum rotary evaporation in a water bath at 60-70°C; S5, adding 1-5 mol / L CaCl2 solution to the solution concentrated in step S4 several times and centrifuging and washing to separate the solid phase by precipitation; S6. After the last centrifugation in step S5, a Na3C6H5O7 solution with a molar ratio of 1:1 is added to the precipitate to obtain a transparent solution without impurities and dialyze; S7. Filter the dialyzed solution in step S6 through a membrane filter with a pore size of 0.1-0.15 µm to obtain RBM@CeO2 nanomedicine containing CeO2-wrapped RBM spheres.

2. The method for preparing the RBM@CeO2 nanomedicine according to claim 1, characterized in that: In step S1, 200 ml of a 0.008 mol / L CeCl3 solution and 200 ml of a 0.008 mol / L Na3C6H5O7 solution are uniformly mixed.

3. The method for preparing the RBM@CeO2 nanomedicine according to claim 2, characterized in that: In step S2, when the size of the (CH2)6N4 solution nanoparticles is 2 nm, the solution concentration is selected to be 0.16 mol / L, and when the size of the (CH2)6N4 solution nanoparticles is 10 nm, the solution concentration is selected to be 0.08 mol / L.

4. The method for preparing the RBM@CeO2 nanomedicine according to claim 3, characterized in that: In step S5, the steps of adding calcium chloride solution and centrifuging are repeated three times in total.

5. The method for preparing the RBM@CeO2 nanomedicine according to claim 3, characterized in that: In step S6, a dialysis membrane with a molecular weight cutoff of 3.5 kDa is used for dialysis, and deionized water is replaced every 12 hours.

6. RBM@CeO2 nanomedicine prepared by the preparation method of RBM@CeO2 nanomedicine according to any one of claims 1 to 5.

7. Use of the RBM@CeO2 nanomedicine as claimed in claim 6 in the preparation and treatment of diabetic nephropathy.

8. A RBM@CeO2 nanopharmaceutical preparation, characterized in that: It comprises the RBM@CeO2 nanomedicine according to claim 5 and one or more pharmaceutically acceptable drug carriers or compounds.

9. Use of the RBM@CeO2 nanopharmaceutical preparation as claimed in claim 8 in the preparation and treatment of diabetic nephropathy.

Images