Paenibacillus kribbensis exopolysaccharide and application thereof in prevention and control of iridovirus disease of micropterus salmoides

Abstract

The invention discloses paenibacillus kribbensis exopolysaccharide and application thereof in prevention and control of iridovirus diseases of micropterus salmoides. The invention provides a paenibacillus kribbensis exopolysaccharide. The paenibacillus kribbensis exopolysaccharide is prepared from a fermentation product of a paenibacillus kribbensis space mutation delta PS04-17 strain. As a fish feed additive, the paenibacillus kribbensis exopolysaccharide has better in-vivo safety, has a promoting effect on the growth of the largemouth bass, and can promote the growth and weight gain of the largemouth bass and reduce the feed coefficient of the largemouth bass. Meanwhile, as a drug for resisting LMBV virus infection, the compound can inhibit expression of viruses in target tissues, alleviate virus-induced fish body target tissue structure damage and reduce the death rate caused by virus infection. Besides, the paenibacillus kribbensis exopolysaccharide serving as a disease-resistant immunopotentiator can maintain intestinal health of the micropterus salmoides, is simple to prepare, low in cost and easy to obtain in quantity, and provides more products and methods for prevention and control of the iridovirus disease of the micropterus salmoides.

Description

Technical Field

[0001] The present invention belongs to the technical field of aquatic disease prevention and control, and more specifically, relates to an exopolysaccharide of Bacillus cribensis and its application in the prevention and control of iridovirus disease of largemouth bass. Background Art

[0002] Largemouth bass (Micropterus salmoides, Largemouth bass), commonly known as California bass, has been introduced to my country since 1983. Due to its fast growth and high nutritional value, it has quickly become an important freshwater fish breeding species in my country. The frequent occurrence of diseases has seriously hindered the development of largemouth bass breeding, among which largemouth bass Ranavirus (LMBV) is one of the most serious viral pathogens. LMBV is a member of the genus Ranavirus of the family Iridoviridae. LMBV spreads rapidly in largemouth bass breeding, with a mortality rate of up to 60%, which seriously endangers the healthy development of largemouth bass breeding. Although various forms of vaccines have been developed, including inactivated vaccines, subunit vaccines, DNA vaccines, etc., most of them are still in the laboratory effect evaluation stage and cannot be widely promoted and applied. At present, there is still no effective drug against LMBV virus infection and means to prevent and control largemouth bass iridovirus disease.

[0003] At present, anti-disease immune enhancers have the characteristics of short development cycle, low cost, convenient application and small side effects. They have the functions of anti-infection, promoting growth performance, improving immunity, etc. As feed additives, they have great application potential in aquatic animal breeding and disease prevention and control. Among them, immune polysaccharides are rich in immune-functional β-glucans and functional oligosaccharides, which have functions such as regulating animal immunity and promoting animal growth. In recent years, they have received attention in aquatic animal diseases. At present, plant polysaccharides and fungal polysaccharides are common in aquaculture applications, mainly astragalus polysaccharides, chitosan, yeast polysaccharides, etc. However, the extraction process of plant polysaccharides and fungal polysaccharides is relatively complicated, often requiring wall breaking treatment, and the polysaccharide content of the raw materials is not high, which leads to a decrease in the application efficiency of immune polysaccharides, which directly hinders the promotion of immune polysaccharides in aquaculture.

[0004] There are many types of bacteria that produce exopolysaccharides, which are widely present in nature and are commonly found in the ocean and soil. Unlike plants and fungi, the exopolysaccharides produced by bacteria can be directly extracted, and the fermentation cycle is short, the polysaccharide yield is high, and they can be mass-produced and applied in practice. In addition, more and more reports have shown that bacterial exopolysaccharides also have antioxidant, anti-inflammatory, anti-tumor, lipid-lowering and cholesterol-lowering and prebiotic effects. However, there are currently few bacterial exopolysaccharides used for the prevention and control of largemouth bass iridovirus disease.

[0005] Paenibacillus kribbensis PS04 was isolated from the soil of the Insecticidal Botanical Garden of South China Agricultural University. After space mutagenesis, the dominant strain △PS04-17 was screened and obtained, which has better effects. Existing studies have shown that the space mutant ΔPS04-17 strain of Paenibacillus kribbensis can be used as a biocontrol agent, which has the functions of plant disease prevention and growth promotion, relief of soil salinization and heavy metal stress, etc.; its fermentation liquid can be used for sewage treatment, and has a good ammonia nitrogen degradation effect on aquaculture wastewater. However, there are few studies on the exopolysaccharides produced by Paenibacillus kribbensis in the prior art, and whether it has the ability to resist aquatic animal viruses has not been reported. In order to expand the new application of the space mutant ΔPS04-17 strain of Paenibacillus kribbensis and provide new strategies for the prevention and control of aquatic animal diseases, it is necessary to develop more products or drugs for the prevention and control of aquatic animal diseases that have the functions of promoting growth, resisting LMBV infection, and improving immunity, which will provide new ideas and means for the prevention and control of largemouth bass iridovirus disease. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the deficiencies of existing products or drugs for preventing and controlling iridovirus disease of largemouth bass, and to provide application of exopolysaccharide of space mutant strain of Paenibacillus cribenbergii in the prevention and control of iridovirus disease of largemouth bass.

[0007] The first object of the present invention is to provide an exopolysaccharide of Paenibacillus cribensis.

[0008] The second object of the present invention is to provide the use of the aerospace mutant ΔPS04-17 strain of Paenibacillus cribenbergii in the preparation of extracellular polysaccharides.

[0009] The third object of the present invention is to provide a method for preparing the exopolysaccharide of Paenibacillus cribenbergii.

[0010] The fourth object of the present invention is to provide the application of Paenibacillus cribenbergii exopolysaccharide.

[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0012] The present invention provides a Paenibacillus kribbensis extracellular polysaccharide, which is prepared by the fermentation product of the Paenibacillus kribbensis aerospace mutant ΔPS04-17 strain; the strain has been deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022, and the deposit number is: GDMCC NO: 62233.

[0013] The Paenibacillus Cribben exopolysaccharide provided by the present invention is prepared by fermenting the Paenibacillus Cribben space mutant △PS04-17 strain, and the preparation is simple, the cost is low, and it is easy to obtain in large quantities. The Paenibacillus Cribben exopolysaccharide is added to aquatic fish feed, which has good in vivo safety. After feeding to largemouth bass, there is no pathological damage to the liver, spleen and intestines of the fish; and after adding the extracellular polysaccharide of the △PS04-17 strain for feeding, it can promote the growth of largemouth bass, increase the weight of largemouth bass, and reduce the feed coefficient. It shows that the Paenibacillus Cribben exopolysaccharide, as a fish feed additive, has a promoting effect on the growth of largemouth bass.

[0014] At the same time, the exopolysaccharide of Paenibacillus Cliburn also has a certain effect on largemouth bass infected with LMBV virus. Studies have shown that exopolysaccharide can improve the survival rate of largemouth bass infected with LMBV, inhibit the expression of virus in target tissues, reduce virus-induced damage to target tissue structure of fish, and reduce the mortality caused by virus infection. The relative protection rate against LMBV is 33.4%, which has a good effect on anti-LMBV virus infection and can be used to prepare drugs against LMBV virus infection. In addition, adding △PS04-17 exopolysaccharide to feed can also maintain the function of intestinal mucosal barrier, maintain the intestinal health of largemouth bass, promote growth, improve immunity, and resist LMBV virus infection. It can be used to prepare anti-disease immune enhancers and feed additives, and can be better applied to the growth of largemouth bass rainbow and the prevention and control of color virus disease.

[0015] Therefore, the present invention provides the use of the space-time mutant ΔPS04-17 strain of Paenibacillus cribenbergii in preparing extracellular polysaccharides.

[0016] The invention provides a method for preparing extracellular polysaccharide of Paenibacillus cribenbergii. The method comprises the following steps: inoculating the space mutant ΔPS04-17 strain of Paenibacillus cribenbergii into a fermentation medium, fermenting to obtain a fermentation liquid, removing bacterial cells from the fermentation liquid, and precipitating with alcohol to obtain the extracellular polysaccharide.

[0017] Preferably, the fermentation medium adopts a modified Czapek medium, with a specific formula of: 1-3 g / L sodium nitrate, 0.5-1.5 g / L dipotassium hydrogen phosphate, 0.4-0.6 g / L potassium chloride, 0.4-0.6 g / L magnesium sulfate, 0.005-0.02 g / L ferrous sulfate, 25-35 g / L sucrose, and a pH value of 7.0-7.2.

[0018] More preferably, the formula of the modified Czapek medium is: 2.0 g / L sodium nitrate, 1.0 g / L potassium dihydrogen phosphate, 0.5 g / L potassium chloride, 0.5 g / L magnesium sulfate, 0.01 g / L ferrous sulfate, 30.0 g / L sucrose, pH 7.0-7.2.

[0019] Furthermore, the present invention provides a more specific preparation step of Paenibacillus kribensis exopolysaccharide:

[0020] (1) inoculating △PS04-17 bacterial solution into a fermentation medium at an inoculum amount of 1 to 10% for fermentation culture;

[0021] (2) collecting the fermentation broth, sterilizing it by centrifugation, and collecting the supernatant;

[0022] (3) The supernatant is collected and purified by alcohol precipitation to obtain the precipitated polysaccharide, which is then dried at 60-70°C to a constant weight to obtain extracellular polysaccharide.

[0023] Preferably, the fermentation conditions are: 25-30°C, 150-200 rpm, and fermentation for 4-5 days.

[0024] Preferably, the alcohol precipitation purification step is: adding 1 to 5 times the volume of anhydrous ethanol, stirring evenly, refrigerating at low temperature for 12 to 24 hours, and collecting the precipitated polysaccharide.

[0025] In particular, the extracellular polysaccharide of the ΔPS04-17 strain provided by the present invention is prepared by simple purification and extraction after fermentation, and is a crude extract of polysaccharide; and the conventional polysaccharide purification methods in the art, such as alcohol precipitation, trichloroacetic acid precipitation to remove protein and dialysis, can further purify the extracellular polysaccharide; and the optimization of the fermentation method conditions can also further increase the yield of the extracellular polysaccharide of the ΔPS04-17 strain. It can be expected that the effect of the purified and refined extracellular polysaccharide can also be improved and used in the present invention.

[0026] The invention provides application of Paenibacillus cribenbergii exopolysaccharide in promoting the growth of largemouth bass.

[0027] The invention provides application of Paenibacillus cribenbergii extracellular polysaccharide in preparing a largemouth bass growth-promoting agent.

[0028] The invention provides application of Paenibacillus kriebensis extracellular polysaccharide in preparing medicine for resisting LMBV virus infection.

[0029] Preferably, the drug can alleviate the damage to the target tissue structure of fish induced by LMBV virus.

[0030] Preferably, the drug can maintain the function of the intestinal mucosal barrier.

[0031] The invention provides application of Paenibacillus cribenbergii extracellular polysaccharide as fish feed additive.

[0032] The invention provides application of Paenibacillus kribensis extracellular polysaccharide in preparing fish feed additive.

[0033] The invention provides application of Paenibacillus cribenbergii extracellular polysaccharide in preparing a fish disease resistance and immunity enhancement product.

[0034] Preferably, the anti-disease immunity enhancement product contains immune polysaccharide, which is purified and refined from the extracellular polysaccharide of the ΔPS04-17 strain.

[0035] Preferably, the fish is largemouth bass.

[0036] The invention also provides a largemouth bass growth promoter or feed additive or disease resistance and immunity enhancement product containing Paenibacillus cribenbergii extracellular polysaccharide.

[0037] The invention also provides a method for promoting the growth of largemouth bass or improving the disease resistance immunity of largemouth bass, and the method comprises feeding largemouth bass with Paenibacillus Cribbens extracellular polysaccharide.

[0038] The present invention has the following beneficial effects:

[0039] The present invention provides a new application of Paenibacillus Cribben exopolysaccharide and its aerospace mutant ΔPS04-17 strain in the preparation of exopolysaccharide. As a fish feed additive, the exopolysaccharide of Paenibacillus Cribben ΔPS04-17 strain has good in vivo safety, can promote the growth and weight gain of largemouth bass after feeding, reduce the feed coefficient, and has a promoting effect on the growth of largemouth bass. At the same time, as a drug for resisting LMBV virus infection, it has a good effect of resisting LMBV virus infection, can improve the survival rate of largemouth bass after LMBV infection, inhibit the expression of the virus in the target tissue, reduce the virus-induced damage to the target tissue structure of the fish body, and reduce the mortality rate caused by viral infection. In addition, as an anti-disease immune enhancer, it has the function of maintaining the intestinal mucosal barrier, can maintain the intestinal health of largemouth bass, and can be better applied to the prevention and control of largemouth bass iris virus disease.

[0040] The invention provides an easily available, low-cost Paenibacillus cribenbergii △PS04-17 extracellular polysaccharide, the preparation method of which is simple and convenient, and the polysaccharide has a high polysaccharide content after simple crude extraction and alcohol precipitation. The polysaccharide has no obvious toxicity as a fish feed additive, can promote the growth of largemouth bass, reduce the feed coefficient, improve the ability of largemouth bass to resist LMBV, and maintain the intestinal health of largemouth bass. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The crude exopolysaccharide of Paenibacillus kribensis △PS04-17 was extracted (A is the exopolysaccharide precipitated after adding three times the volume of anhydrous ethanol to the supernatant of the △PS04-17 fermentation broth after centrifugation; B is the form of the exopolysaccharide of △PS04-17 after drying in a constant temperature oven at 65°C to constant weight).

[0042] Figure 2This graph shows the effect of adding 0.06% and 0.12% △PS04-17 extracellular polysaccharide to feed on the growth of largemouth bass (A is the fish survival rate; B is the HE observation of fish tissue; C is the body length of largemouth bass).

[0043] Figure 3 The graph shows the effect of adding 0.06% and 0.12% △PS04-17 extracellular polysaccharide in feed on the resistance of largemouth bass to LMBV infection (A is the mortality rate of largemouth bass infected with LMBV; BC is the liver and spleen tissue pathology of largemouth bass infected with LMBV; D is the expression of viral genes in infected tissues).

[0044] Figure 4 This is a graph showing the effects of adding 0.06% and 0.12% △PS04-17 extracellular polysaccharide to feed on the intestinal health of largemouth bass (A is the intestinal structure of largemouth bass not infected with LMBV; B is the intestinal structure of largemouth bass infected with LMBV). DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0046] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0047] The Paenibacillus kribbensis space mutant ΔPS04-17 strain used in the following examples has been deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022, with the deposit number: GDMCC NO: 62233, the deposit address is No. 100, Xianlie Middle Road, Guangzhou City, and is recorded in the prior art: CN 114480222A (patent publication number).

[0048] Example 1 Preparation of crude extracellular polysaccharide extract of Paenibacillus cribensis ΔPS04-17

[0049] (1) According to the formula of modified Czapek medium (sodium nitrate 2.0 g / L, potassium dihydrogen phosphate 1.0 g / L, potassium chloride 0.5 g / L, magnesium sulfate 0.5 g / L, ferrous sulfate 0.01 g / L, sucrose 30.0 g / L, pH 7.0-7.2), 500 mL of modified Czapek medium was prepared as a fermentation medium, and then 1% of the bacterial liquid of the space mutant of Paenibacillus kriebenensis △PS04-17 was inoculated, and the mixture was fermented at 28° C. in a constant temperature shaker at 200 rpm / min for 5 days to obtain △PS04-17 fermentation liquid.

[0050] (2) Take 100 mL of the fermented △PS04-17 milky white bacterial liquid and centrifuge it at 5000 g for 10 min. At this time, there is a layer of bacterial sediment at the bottom of the centrifuge tube, and the supernatant is a transparent milky white liquid.

[0051] (3) Collect the supernatant into a pre-cooled beaker and slowly add 3 times the volume of anhydrous ethanol on ice, stirring clockwise with a glass rod. When 3 times the volume of anhydrous ethanol is added, the solution will turn white and turbid; when anhydrous ethanol is continued to be added to 3 times the volume of the supernatant, white flocculent polysaccharides will precipitate. If stirring is continued, the polysaccharides will aggregate into white block polysaccharides with a rubber-like texture. Figure 1 A).

[0052] (4) The polysaccharide precipitate was collected in a 50 mL centrifuge tube and placed in a 65°C constant temperature oven to dry to constant weight to obtain a crude extract of △PS04-17 extracellular polysaccharide (hereinafter referred to as △PS04-17 crude polysaccharide), which was a yellow-white solid with a hard texture ( Figure 1 B).

[0053] Example 2 Determination of crude extracellular polysaccharide content of △PS04-17

[0054] 1. △PS04-17 crude polysaccharide solution:

[0055] The △PS04-17 crude polysaccharide solid prepared in Example 1 was dissolved in 40 mL of water to obtain a crude polysaccharide aqueous solution, which was a milky white low-viscosity liquid.

[0056] 2. Use the phenol-sulfuric acid method to draw a glucose standard curve:

[0057] ① Accurately weigh 10 mg of analytical pure glucose dried to constant weight at 105°C into a 100 mL volumetric flask, dissolve it in distilled water to make up to volume, and obtain a 0.1 mg / mL standard glucose solution.

[0058] ②Take 5g of phenol, place it in a 100mL volumetric flask, add distilled water to the scale, shake well, place in a brown reagent bottle and refrigerate for later use to obtain a 5% phenol solution.

[0059] ③ Pipette 0, 0.2mL, 0.4mL, 0.6mL, 0.8mL, 1.0mL of glucose standard solution into 15mL centrifuge tubes respectively, and fill to 1.0mL with distilled water. Add 1.0mL of 5% phenol solution to the test solution, then quickly add 5.0mL of concentrated sulfuric acid vertically to the liquid surface, and let it react at room temperature for 10min. Then place it in a boiling water bath and continue to react for 20min. It can be seen that the orange color of the mixed solution gradually deepens with the increase of glucose concentration.

[0060] Then, 100 μL of standard glucose reaction solution of different concentrations was taken and added to a 96-well plate, with 4 replicate wells for each concentration. The blank solution was used to adjust the plate to zero, and the absorbance of the solution was measured at a wavelength of 490 nm. The absorbance of the glucose reaction solution of different concentrations was obtained and the average value was taken. Then, a glucose standard curve was drawn with the glucose mass concentration as the horizontal axis and the absorbance value as the vertical axis.

[0061] 3. Determination of polysaccharide content of △PS04-17 crude polysaccharide solution using phenol-sulfuric acid method:

[0062] Dilute the △PS04-17 crude polysaccharide solution 50 times, draw 1mL of the diluted crude polysaccharide solution into 15mL, add 1.0mL of 5% phenol solution, then quickly add 5.0mL of concentrated sulfuric acid vertically to the liquid surface, and let it react at room temperature for 10min. Then place it in a boiling water bath and continue to react for 20min. Take 100μL and add it to a 96-well plate, 4 replicates for each concentration, adjust to zero with a blank solution, measure the absorbance of the solution at a wavelength of 490nm, and calculate the total sugar content of the △PS04-17 crude polysaccharide solution based on the standard curve of glucose.

[0063] The results showed that after the standard glucose solutions with concentrations of 0μg / mL, 200μg / mL, 400μg / mL, 600μg / mL, 800μg / mL and 1000μg / mL reacted with phenol and sulfuric acid, the average absorbance of the solutions at a wavelength of 490nm were 0.05, 0.78, 1.49, 2.06, 2.71 and 3.31, respectively. The glucose standard curve was calculated to be y=0.0032x+0.1216, R 2 =0.9982. The average absorbance of the crude polysaccharide solution of △PS04-17 diluted 50 times after reacting with phenol and sulfuric acid solution at a wavelength of 490nm is 3.00. According to the standard curve, the polysaccharide content in the crude polysaccharide solution of △PS04-17 diluted 50 times is 900.20μg / mL, and the polysaccharide content in the original crude polysaccharide solution of △PS04-17 is 45.01mg / mL.

[0064] Example 3 Effect of adding △PS04-17 polysaccharide to feed on the growth performance of largemouth bass

[0065] 1. Preparation of largemouth bass feed:

[0066] ① Weigh 430.00 g of largemouth bass basic feed into two containers, respectively. Pipette 5.73 mL and 11.47 mL of △PS04-17 crude polysaccharide solution into beaker 1 and beaker 2, respectively, then add 100 mL of pure water to beaker 1 and beaker 2 and stir evenly to obtain △PS04-17 crude polysaccharide dilution 1 and crude polysaccharide dilution 2.

[0067] ② Slowly add △PS04-17 crude polysaccharide dilution 1 and crude polysaccharide dilution 2 into the container containing the feed, stirring evenly while adding until the polysaccharide solution is completely absorbed by the feed.

[0068] ③ The evenly stirred feed was placed in a constant temperature oven at 37°C and dried to constant weight to obtain feed containing △PS04-17 polysaccharide added with a low concentration of 0.06% and a high concentration of 0.12%.

[0069] 2. Effects of adding △PS04-17 polysaccharide to feed on the growth performance of largemouth bass:

[0070] ① Feeding: 300 largemouth bass with uniform body length and average body weight of 3.25g were randomly divided into 3 groups, 100 in each group, namely the basic feed control group (Mock), the 0.06% △PS04-17 crude polysaccharide added group (0.06% EPS) and the 0.12% △PS04-17 crude polysaccharide added group (0.12% EPS). The basic feed, 0.06% EPS and 0.12% EPS were fed at 2% of the fish body weight, twice at regular intervals, for 28 consecutive days. The number of fish deaths in each group was recorded during the feeding period.

[0071] ②After 28 days, 10 fish were randomly selected from each group to measure their body length and weight, and the weight gain rate, specific growth rate and feed coefficient were calculated.

[0072] The calculation formula is as follows: weight gain rate = final body weight / initial body weight; specific growth rate = 100% × (ln final body weight-ln initial body weight) / number of feeding days; feed coefficient = feed amount / weight gain.

[0073] ③ Then, the liver, spleen and intestine of the largemouth bass were dissected with scissors and forceps and placed in a centrifuge tube, and 4% paraformaldehyde fixative was added. The fixed samples were sent to Wuhan Sewell Biotechnology Co., Ltd. for HE staining tissue sections.

[0074] The results are as follows Figure 2 As shown in the figure, there was no mortality in the Mock group, 0.06% EPS group and 0.12% EPS group ( Figure 2 A). Combined with the results of tissue HE staining, it was shown that feeding 0.06% and 0.12% of △PS04-17 crude polysaccharide had no pathological damage to the liver, spleen and intestines of largemouth bass ( Figure 2 B), indicating that feeding feeds containing 0.06% EPS and 0.12% EPS is safe for fish.

[0075] The body length measurements of each group of largemouth bass are as follows: Figure 2C shows that feeding 0.06% and 0.12% △PS04-17 crude polysaccharide promoted the increase of body length of largemouth bass. In addition, the statistical results of weight gain rate, specific growth rate and feed coefficient are shown in Table 1, showing that the weight gain rate of largemouth bass in the Mock group, 0.06% EPS and 0.12% EPS groups were 172.31±42.03, 99.89±43.15 and 201.30±45.13, respectively, the specific growth rate of each group was 3.54±0.11, 3.89±0.09 and 3.90±0.10, respectively, and the feed coefficient was 1.25±0.06, 0.75±0.11 and 0.76±0.12, respectively. The results show that the addition of △PS04-17 crude polysaccharide can promote the growth of largemouth bass, increase the weight gain rate and reduce the feed coefficient.

[0076] Table 1 Effect of the addition of △PS04-17 extracellular polysaccharide on the weight gain rate and specific growth rate of largemouth bass

[0077]

[0078] Example 4 Effect of adding △PS04-17 crude polysaccharide to feed on the resistance of largemouth bass to LMBV infection

[0079] 1. Experimental treatment:

[0080] △PS04-17 crude polysaccharide was added to the feed, and the largemouth bass was fed according to the feeding method of step 2 in Example 3. The groups were divided into a basic feed control group (Mock) and a 0.06% △PS04-17 crude polysaccharide added group (0.06% EPS), and the feeding was continued for 28 days.

[0081] 2. Mortality rate of largemouth bass infected with LMBV:

[0082] Thirty largemouth bass were injected intraperitoneally with 100 μL of LMBV virus (5×10 4.375 TCID 50 ), and 10 healthy untreated largemouth bass were intraperitoneally injected with 100 μL sterile PBS buffer as negative control. The observation was conducted for 14 days, and the number of deaths of largemouth bass in each group was recorded and the survival rate was calculated.

[0083] 3. Histopathology of largemouth bass infected with LMBV:

[0084] Thirty largemouth seabass were injected intraperitoneally with LMBV at the above dose in each group. The clinical symptoms of largemouth seabass were observed after infection. During the peak period of disease, liver and spleen tissues of 3 fish were randomly collected from each group for HE staining analysis.

[0085] 4. Expression of viral genes in tissues of largemouth bass infected with LMBV:

[0086] The liver and spleen of 9 fish were randomly collected from each group infected with LMBV. The single tissues of 3 fish were mixed into one sample, and each group had three samples. The total RNA of tissue was extracted using the Animal Total RNA Isolation Kit (Foregene) according to the instructions. The cDNA template was obtained by reverse transcription using qPCR RT Kit (TOYOBO). The transcriptional expression of viral genes in infected tissues: major capsid protein (MCP) gene and myristoylated membrane protein (MMP) gene were detected by fluorescence quantitative PCR.

[0087] Fluorescence quantitative PCR was performed using a 2×SYBR Green Real-time PCR Mix kit (TOYOBO). The PCR reaction was performed on an Applied Biosystems QuantStudio 5 fluorescence quantitative PCR instrument (Thermo, USA). The reaction conditions were as follows: 95°C, 1 min; 95°C, 5 s; 60°C, 15 s; 72°C, 45 s; 40 cycles. β-actin was used as an internal reference, and the data represent the mean ± standard deviation of three repeated experiments. The primers for the internal reference and viral genes were:

[0088] MsF-β-actin-RT-F (SEQ ID NO. 1): CCACCACAGCCGAGAGGGAA;

[0089] MsF-β-actin-RT-R (SEQ ID NO. 2): TCATGGTGGATGGGGCCAGG;

[0090] LMBV-MCP-RT-F (SEQ ID NO.3): CTCGCCACTTATGACAGCCTTGAC;

[0091] LMBV-MCP-RT-R (SEQ ID NO.4): AACCCACGGGATAATGCTCTTTGAC;

[0092] LMBV-MMP-RT-F (SEQ ID NO.5): GCGTATTTCGCACCCTCTG;

[0093] LMBV-MMP-RT-R (SEQ ID NO. 6): TAACGTCCGCCCTTGTCTG.

[0094] The cumulative mortality statistics of fish in each group infected with LMBV are as follows: Figure 3 As shown in A, it was found that at 14 days after infection, the survival rate of the fish in the PBS injection group was 100%, the survival rate of the largemouth bass in the basic feed control group after LMBV infection was 36.6%, and the survival rate of the largemouth bass in the 0.06% EPS group after LMBV infection increased to 70%, and the relative protection rate was 33.4%.

[0095] Tissue phenotypes of largemouth bass infected with LMBV Figure 3 As shown in B, the LMBV-infected largemouth bass in the basic feed control group showed severe pathological characteristics, manifested as pale liver and enlarged spleen. However, the liver and spleen of largemouth bass infected with 0.06% EPS group showed no obvious pathological changes. In addition, the results of HE staining Figure 3 C showed that the liver and spleen tissues of LMBV-infected largemouth bass in the basic feed control group showed obvious pathological changes, with hepatocyte atrophy, dense cytoplasm in hepatocytes, increased basophilic substances; incomplete cell membranes, partial hepatocyte necrosis; spleen cell necrosis, and local necrotic foci. However, the liver cell morphology of largemouth bass infected with 0.06% EPS group was intact, the cytoplasmic contents were loose, and almost no basophilic substances were observed; the white pulp structure of the spleen was relatively complete, and the boundary with the red pulp was obvious. It shows that adding △PS04-17 crude polysaccharide to the feed can reduce virus-induced damage to the target tissue structure of fish.

[0096] The results of fluorescence quantitative PCR are as follows Figure 3 As shown in D, compared with the LMBV-infected tissues in the basic feed control group, the transcriptional expression levels of viral MCP genes and MMP genes in the infected tissues of the 0.06% EPS group were significantly reduced, indicating that the addition of △PS04-17 crude polysaccharide can inhibit the expression of viral genes in infected tissues and reduce the mortality caused by viral infection.

[0097] Example 5 Effect of △PS04-17 polysaccharide on the intestinal structure of largemouth bass

[0098] The intestines of the uninfected Mock and the largemouth bass group supplemented with 0.06% EPS in Example 4 and the intestines of the infected Mock and the group supplemented with 0.06% EPS were collected, and the structure of the intestinal tissue was observed by HE staining.

[0099] HE staining observation results, such as Figure 4 As shown, there was no significant difference in the intestinal tissue structure between the uninfected Mock and the 0.06% EPS addition group. The intestinal mucosal structure was intact, and the intestinal villi were arranged in an orderly manner and naturally extended into the intestinal cavity ( Figure 4A). In the LMBV-infected Mock group, a large number of intestinal villus epithelial cells in the intestinal tissue were necrotic and sloughed, and the lamina propria and mucosal basal cells were necrotic and sparsely arranged. In the LMBV-infected 0.06% EPS-added group, the intestinal villus epithelial cells were relatively intact, and the lamina propria and mucosal muscularis structure were normal, and the arrangement was dense and orderly. This shows that 0.06% △PS04-17 crude polysaccharide can protect the intestinal mucosal morphology of largemouth bass caused by LMBV infection and maintain the function of the intestinal mucosal barrier ( Figure 4 B).

[0100] In summary, the Paenibacillus Cribbens exopolysaccharide provided by the present invention has good in vivo safety as a fish feed additive, can promote the growth and weight gain of largemouth bass after feeding, reduce the feed coefficient, and has a promoting effect on the growth of largemouth bass. At the same time, as a drug against LMBV virus infection, it has a good effect against LMBV virus infection, can improve the survival rate of largemouth bass after LMBV infection, inhibit the expression of the virus in the target tissue, reduce virus-induced damage to the target tissue structure of the fish body, and reduce the mortality rate caused by viral infection. In addition, as an anti-disease immune enhancer, it has the function of maintaining the intestinal mucosal barrier, can maintain the intestinal health of largemouth bass, and can be better applied to the prevention and control of largemouth bass iridovirus disease.

[0101] The invention provides an easily available, low-cost Paenibacillus cribenbergii △PS04-17 extracellular polysaccharide, the preparation method of which is simple and convenient, and has a high polysaccharide content after simple crude extraction and alcohol precipitation. The polysaccharide has no obvious toxicity as a fish feed additive, can promote the growth of largemouth bass, reduce the feed coefficient, improve the ability of largemouth bass to resist LMBV, and maintain the intestinal health of largemouth bass.

[0102] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An exopolysaccharide of Paenibacillus kribbensis, characterized in that: The exopolysaccharide is prepared from the fermentation product of the aerospace mutant ΔPS04-17 strain of Bacillus cribenbergii; the ΔPS04-17 strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022, with the deposit number: GDMCC NO: 62233.

2. The method for preparing the extracellular polysaccharide according to claim 1, characterized in that: The space mutant ΔPS04-17 strain of Paenibacillus cribenbergii was inoculated into a fermentation medium, and a fermentation liquid was obtained after fermentation. The bacterial cells were removed from the fermentation liquid, and alcohol precipitation was performed to obtain extracellular polysaccharides.

3. The preparation method according to claim 2, characterized in that: The fermentation medium adopts modified Czapek medium, and the specific formula is: sodium nitrate 1-3g / L, dipotassium hydrogen phosphate 0.5-1.5g / L, potassium chloride 0.4-0.6g / L, magnesium sulfate 0.4-0.6g / L, ferrous sulfate 0.005-0.02g / L, sucrose 25-35g / L, pH value 7.0-7.

2.

4. Use of the extracellular polysaccharide according to claim 1 in promoting the growth of largemouth bass or in preparing a largemouth bass growth promoter.

5. Use of the extracellular polysaccharide according to claim 1 in the preparation of a drug for resisting LMBV virus infection.

6. Use of the extracellular polysaccharide according to claim 1 as a fish feed additive or in the preparation of a fish feed additive.

7. Use of the extracellular polysaccharide according to claim 1 in preparing a disease-resistant and immune-enhancing product for aquatic fish.

8. A growth promoter or feed additive or disease-resistant immune enhancement product for largemouth bass, characterized in that: Containing the extracellular polysaccharide according to claim 1.

9. A method for promoting the growth of largemouth bass or improving the disease resistance immunity of largemouth bass, characterized in that: The extracellular polysaccharide according to claim 1 is used for feeding largemouth bass.

10. Use of the space mutant ΔPS04-17 strain of Paenibacillus cribenbergii in the preparation of exopolysaccharides, characterized in that: This strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022, with the deposit number: GDMCC NO: 62233.

Images