Heparin hydrolase mutant and recombinant expression method thereof

Abstract

The invention relates to a heparin hydrolase mutant and a recombinant expression method thereof, and belongs to the technical field of enzyme engineering. Heparin hydrolase derived from Chromobacterium amazonense is heterologously expressed in Escherichia coli, the heparin hydrolase is modified, a TrxA dissolution promoting label is added, site-specific mutagenesis is carried out on part of amino acid sites, the catalytic efficiency of the mutant G37T / N145D / V281K is improved by 1.96 times compared with that of an original strain, and the mutant G37T / N145D / V281K plays an important role in application and industrial production of the heparin hydrolase.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, in particular to a heparin hydrolase mutant and a method for recombinant expression thereof. Background Art

[0002] Heparin is a natural glycosaminoglycan that is mainly found in the liver and lung tissue of animals. Heparin has an anticoagulant effect and can bind to thrombin and antithrombin to prevent blood clotting. Heparin also has anti-inflammatory and anti-tumor effects, can regulate the function of the immune system, and plays an important physiological function in the body, including cell signaling, cell adhesion, tissue repair, etc.

[0003] Bacterial heparin hydrolases are endo-β-glucuronidases, belonging to the glycoside hydrolase family 79. This enzyme is usually highly specific and active, and can selectively hydrolyze the β-1,4-glycosidic bond between glucuronic acid and glucosamine in the heparin molecule to produce heparin fragments of specific lengths. These bacterial heparin hydrolases have a wide range of applications. Heparin hydrolases can also be used to modify and transform heparin, by cutting heparin chains, changing the biological activity and pharmacological properties of heparin, and thus developing heparin drugs with better efficacy. Heparin hydrolases are overexpressed in cancer cells and are associated with angiogenesis, inflammation, and increased metastatic potential. They are an important potential anticancer drug target.

[0004] However, there are few types of bacterial heparin hydrolases reported so far, and there is a lack of efficient expression methods. CN108841739A discloses a recombinant bacterium that heterologously expresses bacterial heparin hydrolases using a Pichia pastoris expression system, but the improvement of the heparin hydrolase activity is not obvious, which is not conducive to industrial production. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a heparin hydrolase mutant and a method for recombinant expression thereof, wherein the heparin hydrolase from Chromobacterium amazonense is modified and mutated, heterologously expressed in Escherichia coli, and the product is purified using a nickel column. The heparin hydrolase obtained by the method has significantly improved enzymatic activity.

[0006] The first object of the present invention is to provide a heparin hydrolase mutant, wherein the heparin hydrolase mutant undergoes any of the following modifications to the heparin hydrolase with an amino acid sequence as shown in SEQ ID NO.1:

[0007] Mutate glycine at position 37 to threonine;

[0008] Mutate asparagine at position 145 to glutamine;

[0009] Mutate asparagine at position 145 to aspartic acid;

[0010] mutating glycine at position 37 to threonine and mutating asparagine at position 145 to glutamine;

[0011] Mutation of glycine at position 37 to threonine and asparagine at position 145 to aspartic acid;

[0012] Mutation of glycine at position 37 to threonine and valine at position 281 to lysine;

[0013] The glycine at position 37 was mutated to threonine, the asparagine at position 145 was mutated to aspartic acid and the valine at position 281 was mutated to lysine.

[0014] Furthermore, the heparin hydrolase is derived from Chromobacterium amazonensis.

[0015] Furthermore, the nucleotide sequence of the heparin hydrolase is shown in SEQ ID NO.2.

[0016] The second object of the present invention is to provide a gene encoding the above-mentioned heparin hydrolase mutant.

[0017] The third object of the present invention is to provide a recombinant expression vector comprising the above gene.

[0018] The fourth object of the present invention is to provide a host cell comprising the above-mentioned heparin hydrolase mutant, the above-mentioned gene or the above-mentioned recombinant expression vector.

[0019] The fifth object of the present invention is to provide a recombinant engineered bacterium expressing heparin hydrolase, using Escherichia coli as a starting strain, expressing the above-mentioned heparin hydrolase mutant, and adding a lytic tag to the N-terminus of the heparin hydrolase mutant.

[0020] Furthermore, the solubility-promoting tag is a TrxA tag or a histidine tag.

[0021] The sixth object of the present invention is to provide a microbial preparation comprising the above-mentioned recombinant engineered bacteria.

[0022] The seventh object of the present invention is to provide a heparin hydrolase expressed by the above-mentioned recombinant engineered bacteria or the above-mentioned microbial preparation.

[0023] Furthermore, the heparin hydrolase uses heparin sodium, chondroitin sulfate A, hyaluronic acid or heparin precursor as a substrate.

[0024] Preferably, the heparin hydrolase uses heparin sodium as a substrate.

[0025] Preferably, the optimum temperature of the heparin hydrolase is 45°C and the optimum pH value is 5.0.

[0026] Beneficial effects of the present invention:

[0027] The present invention mutates some sites of the heparin hydrolase derived from the Amazon chromium bacteria and adds a lytic tag, and heterologously expresses the obtained mutant in Escherichia coli. By using the method of induced fermentation production, the recombinant bacteria are added to a system containing a substrate to ferment and produce heparin hydrolase, and then the product is purified by a nickel column. The heparin hydrolase can be produced quickly, the expression level is high, the culture conditions are simple, and the obtained heparin hydrolase product has a high expression amount, stable enzymatic properties, and greatly improved enzyme activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0029] Figure 1 This is a map of the recombinant plasmid expressing heparin hydrolase in Escherichia coli in Example 1 of the present invention;

[0030] Figure 2 The results of measuring the enzymatic activity of heparin hydrolase using different substrates in Example 2 of the present invention;

[0031] Figure 3 The SDS-PAGE electrophoresis result of the purified heparin hydrolase in Example 3 of the present invention;

[0032] Figure 4 The enzymatic property determination results of the heparin hydrolase product of Example 4 of the present invention;

[0033] Figure 5 It is the enzymatic activity of the heparin hydrolase mutant in Example 5 of the present invention. DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0035] The culture medium involved in the embodiment is as follows:

[0036] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0037] TB medium: tryptone 12 g / L, yeast extract 24 g / L, glycerol 10 g / L, potassium dihydrogen phosphate 2.31 g / L, and potassium dihydrogen phosphate 12.54 g / L.

[0038] Example 1: Construction of recombinant Escherichia coli producing heparin hydrolase

[0039] Using pET-28a as a vector, the heparin hydrolase gene from Chromobacterium amazonense (nucleotide sequence as shown in SEQ ID NO.2) was cloned, the upstream primer introduced the BamH I restriction enzyme site; the downstream primer introduced the Hind III restriction enzyme site; the gene Hep Ca , plasmid pET-28a was linearized with primers and then connected to E. coli BL21 (DE3) for amplification, and the correctly sequenced plasmid was selected and transferred to E. coli BL21 (DE3) for expression to obtain recombinant E. coli BL21DE3 / PET28-CaHEP containing the recombinant heparin hydrolase gene.

[0040] The upstream primer was 5'-GCCGCTGCTGTGATGATGATGAT-3', and the downstream primer was 5'-ATGAAAAAAACTGAGCCGCTTCATG-3'.

[0041] The TrxA lytic tag (nucleotide sequence as shown in SEQ ID NO.3) was connected to the N-terminus of the gene. The plasmid map is shown in Figure 1 shown.

[0042] Example 2: Production of heparin hydrolase in shake flasks

[0043] The recombinant Escherichia coli BL21DE3 / PET28-CaHEP containing the recombinant heparin hydrolase gene was used as the production strain. A single colony was inoculated into LB medium and cultured overnight at 37°C and 220rpm to obtain a seed culture solution. The seed culture solution was inoculated into 50 mL of TB medium at a mass percentage of 1%. 600 When the value reaches 0.6, 0.1M IPTG is added to the culture medium, the induction temperature is 25℃, and the expression is induced for 20h. Take 500μL of substrate sodium heparin, chondroitin sulfate A (CSA), hyaluronic acid, and heparin precursor, add 500μL of fermentation broth, and react at 37℃ for 30min. After terminating the reaction, add 500μL DNS and mix well, boil in a water bath for 10min, and measure the absorbance of each numbered tube at 540nm. The heparin hydrolase activity is defined as the amount of enzyme required to hydrolyze heparin to produce 1μg of glucose equivalent reducing sugar per hour at 37℃ and pH 5.0. Figure 2 ).

[0044] Example 3: Purification and preparation of recombinant heparin hydrolase

[0045] Purify the recombinant heparin hydrolase, the specific steps are as follows: Use a 5mL Ni column and balance the column with phosphate buffer (50mmol / L, pH 7.4) for 10 column volumes. Collect the fermentation supernatant by centrifugation at 4℃ and load 20mL. Use imidazole gradient elution. Imidazole is prepared with the above phosphate buffer and eluted according to the gradient of 10mmol / L, 30mmol / L, and 200mmol / L. The target protein is eluted last. The eluted target protein is desalted and deimidazoled and stored at 4℃. The enzyme activity after purification is 110U / L. Figure 3 As shown, as shown in SDS-PAGE, lane 1 represents the band of purified heparin hydrolase.

[0046] Example 4: Enzyme property determination

[0047] A series of buffer solutions with pH values ​​(2.0-10.0) were used to determine the optimal pH for the reaction of heparin hydrolase, namely KCl-HCl buffer (20mM, pH = 2.0-3.0), glycine buffer (20mM, pH = 3.0-4.0), citrate buffer (20mM, pH = 4.0-5.0), citrate-phosphate buffer (20mM, pH = 5.0-6.0), Tris-Hcl buffer (20mM, pH = 6.0-8.0) and Gly-NaOH buffer (20mM, pH = 8.0.0-10.0). The optimal pH value was 5.0, and the effect of different temperatures on the activity of heparin hydrolase was mainly determined using a temperature range of 20-80°C, and the optimal reaction temperature was 45°C ( Figure 4 ).

[0048] Example 5: Obtaining mutants with improved enzyme activity

[0049] In order to improve the enzymatic activity of heparin hydrolase, saturation mutation was performed on G37, N145 and V281 sites. The recombinant plasmid carrying the gene encoding the unmutated heparin hydrolase constructed in the example was used as a template and amplified using the PCR program. The primers used are shown in Table 1. The PCR amplification product was introduced into the competent cells of Escherichia coli BL21 (DE3), ice bathed for 30 minutes, and then heat-shocked at 42°C for 90 seconds. LB medium was added, cultured at 37°C for 40 minutes, coated on a kanamycin LB plate, cultured at 37°C for 8-12 hours, and colonies were selected for sequencing verification to obtain the correct transformants. The culture method of the transformant and the method for obtaining the pure enzyme of the mutant are shown in Examples 1-3. The obtained mutant pure enzyme was placed in a citrate-phosphate buffer (20mM pH 5.0), reacted at 37°C for 1 hour, and its enzyme activity was determined. The mutant G37T / N145D / V281K with significantly improved enzyme activity was screened.

[0050] Table 1 Primer list

[0051] Primer name Sequence (5'-3') G37X-F AGGAGGAGGCNNKAACTCGG G37T-F AGGAGGAGGCACAAACTCGG G37X-R CCTCCTCCTCCGCACGCCGCC N145X-F GTACGGGATCNNKTTGGCAGG N145D-F GTACGGGATCGACTTGGCAGG N145Q-F GTACGGGATCCAGTTGGCAGG N145X-R GATCCCGTACAGGGCCTTCC V281X-F TATCTTACAATCGNNKACGCAGTCAG V281K-F TATCTTACAATCGAAGACGCAGTCAG V281X-R CGATTGTAAGATAGTAGTAAGATTGGGTC

[0052] like Figure 5 As shown, the enzyme activity of the mutant G37T / N145D / V281K was increased by 1.96 times compared with the starting strain.

[0053] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A heparin hydrolase mutant, characterized in that: The heparin hydrolase mutant undergoes any of the following modifications to the heparin hydrolase whose amino acid sequence is shown in SEQ ID NO.1: Mutate glycine at position 37 to threonine; Mutate asparagine at position 145 to glutamine; Mutate asparagine at position 145 to aspartic acid; mutating glycine at position 37 to threonine and mutating asparagine at position 145 to glutamine; Mutation of glycine at position 37 to threonine and asparagine at position 145 to aspartic acid; Mutation of glycine at position 37 to threonine and valine at position 281 to lysine; The glycine at position 37 was mutated to threonine, the asparagine at position 145 was mutated to aspartic acid and the valine at position 281 was mutated to lysine.

2. The heparin hydrolase mutant according to claim 1, characterized in that: The nucleotide sequence of the heparin hydrolase is shown in SEQ ID NO.

2.

3. A gene encoding the heparin hydrolase mutant according to claim 1.

4. A recombinant expression vector comprising the gene according to claim 3.

5. A host cell comprising the heparin hydrolase mutant according to claim 1 or 2, the gene according to claim 3 or the recombinant expression vector according to claim 4.

6. A recombinant engineered bacterium expressing heparin hydrolase, characterized in that: Using Escherichia coli as a starting strain, the heparin hydrolase mutant according to claim 1 is expressed, and a solubility-promoting tag is added to the N-terminus of the heparin hydrolase mutant.

7. The recombinant engineered bacterium according to claim 6, characterized in that: The solubility-promoting tag is a TrxA tag or a histidine tag.

8. A microbial preparation comprising the recombinant engineered bacteria according to claim 6 or 7.

9. A heparin hydrolase, characterized in that: The protein is expressed by the recombinant engineering bacteria described in claim 6 or the microbial preparation described in claim 8.

10. The heparin hydrolase according to claim 9, characterized in that: The heparin hydrolase uses heparin sodium, chondroitin sulfate A, hyaluronic acid or heparin precursor as a substrate.

Images