Visual detection method of New Delhi tomato leaf curl virus

Abstract

The invention discloses a visual detection method of New Delhi tomato leaf curl virus, and belongs to a plant virus detection technology in the field of biotechnology. The method comprises the following steps: adding genome DNA extracted from a plant sample to be detected into an RAA reaction system containing an RAA primer, and carrying out isothermal amplification; then adding an isothermal amplification product into a CRISPR / Cas12a detection system containing a specific crRNA fluorescent probe and an ssDNA fluorescent probe, and carrying out a reaction; and finally, carrying out fluorescence signal detection on the reaction product, if the fluorescence signal is positive, indicating that the New Delhi tomato leaf curl virus is detected in the plant sample, otherwise, indicating that the New Delhi tomato leaf curl virus is not detected. The method has the advantages of being good in specificity, short in detection time, high in sensitivity, free of dependence on expensive instruments and the like, and the result can be accurately detected through an instrument or directly and preliminarily interpreted in a field with limited conditions.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for detecting plant viruses, and in particular to a method for detecting New Delhi Tomato Leaf Curl Virus in plant leaf samples based on RAA-CRISPR / Cas12a visualization technology. Background Art

[0002] Plant viruses are known as "plant cancers" because of their wide variety, wide distribution, and lack of effective prevention and control methods, which have caused inestimable losses to the yield and quality of global crops. Establishing a convenient and efficient virus detection method is of great significance for curbing the spread of viruses, stabilizing the production quality of crops, and reducing the economic losses caused by viruses. Commonly used virus detection methods can be roughly divided into four types: biological detection methods, electron microscopy detection methods, serological detection methods, and molecular biology detection methods. Although biological detection methods and electron microscopy detection methods are intuitive, they have great limitations, require long detection time, and have great uncertainty, so they are not the mainstream detection methods at present. Serological technology relies on the quality of antibodies, has relatively low detection sensitivity, and is prone to false negatives. Common molecular biology techniques are generally conventional PCR and fluorescence quantitative PCR detection methods, which require expensive instruments such as PCR instruments and gel imaging systems, have high requirements for instruments and technicians, and are difficult to achieve field detection.

[0003] Tomato leaf curl New Delhi virus (ToLCNDV) infects important crops such as Solanaceae and Cucurbitaceae and is widely distributed around the world. The main symptoms include leaf curling, internode shortening and plant dwarfing, which seriously affect the growth of crops. In recent years, ToLCNDV has appeared in different regions, causing significant economic losses to the production of crops such as melons and tomatoes, and seriously threatening the planting safety of Cucurbitaceae and Solanaceae crops. Since the current prevention and control measures for viral diseases are limited, it is particularly important to strengthen early warning monitoring of ToLCNDV and establish a convenient detection method.

[0004] Since 1990, dozens of isothermal amplification technologies with different amplification mechanisms have been developed, including loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), recombinase-mediated isothermal amplification (RPA / RAA), etc. RPA (recombinase polymerase amplification) and RAA (recombinase aided amplification) are both technologies that rapidly amplify nucleic acids at a constant temperature by the combined action of recombinase, single-stranded binding protein and DNA polymerase. The difference between the two lies in the source of the recombinase. The recombinase used in RPA is derived from T4 bacteriophage, while that used in RAA is derived from bacteria or fungi. Compared with traditional PCR technology, isothermal amplification technology can greatly reduce dependence on instruments and simplify the steps and time of detection, but it also has limitations such as nonspecific amplification, aerosol contamination and false positives. In recent years, the gene editing tool CRISPR / Cas system has been increasingly used in the field of nucleic acid detection. CRISPR / Cas12a can recognize specific PAM sequences of several nucleotides and, under the guidance of crRNA, cut double-stranded target DNA. After cutting the target double-stranded DNA, its activity of cutting non-specific single-stranded DNA is activated. Due to its specific cutting activity, some people have begun to combine isothermal amplification technology with gene editing tools, such as researchers who developed a visualization detection technology by coupling LAMP with CRISPR / Cas12a. However, this technology still requires the extraction of sample DNA in the laboratory, and requires endpoint PCR or real-time fluorescent LAMP to determine the final result, and cannot completely break away from the limitations of the laboratory. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a visual detection method for New Delhi Tomato Leaf Curl Virus. The method is rapid, sensitive, and convenient, can complete the detection without complicated operations and expensive instruments, has low requirements on operators, environment, and instrument costs, and has an application prospect for on-site rapid detection.

[0006] In order to solve the technical problem, the technical solution specifically adopted by the present invention is as follows:

[0007] A visual detection method for New Delhi Tomato Leaf Curl Virus, which specifically comprises the following steps: firstly, adding genomic DNA extracted from a plant sample to be detected into an RAA reaction system containing RAA primers and performing isothermal amplification; then, adding the isothermal amplification product into a CRISPR / Cas12a detection system containing specific crRNA and ssDNA fluorescent probes for reaction; finally, performing fluorescent signal detection on the reaction product, if the fluorescent signal is positive, it indicates that the New Delhi Tomato Leaf Curl Virus is detected in the plant sample, otherwise, it indicates that the New Delhi Tomato Leaf Curl Virus is not detected; the RAA primers include a forward primer and a reverse primer, the nucleic acid sequence of the forward primer is shown in SEQ ID NO.1, and the nucleic acid sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the specific crRNA is shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe is 5'-FAM-CCCCCCC-BHQI-3'.

[0008] Based on the above technical solutions, the present invention can further provide one or more of the following preferred solutions. If there is no conflict, the technical features in the following preferred solutions can be combined with each other.

[0009] As a preferred embodiment of the present invention, the extraction buffer used to extract genomic DNA from the plant sample to be detected is an extraction buffer containing PEG and NaOH.

[0010] As a preferred embodiment of the present invention, the plant sample to be detected is leaf tissue of the plant to be detected.

[0011] As a preferred embodiment of the present invention, the RAA reaction system is configured using a RAA nucleic acid amplification kit, and its components include: reaction dry powder, A Buffer, the forward primer, the reverse primer, the genomic DNA, B Buffer and RNase-free water.

[0012] As a preferred embodiment of the present invention, the method of adding the genomic DNA to the RAA reaction system containing RAA primers for isothermal amplification is as follows: firstly preparing a mixed solution containing RNase-free water, A Buffer, the forward primer, and the reverse primer according to the RAA reaction system, and adding the mixed solution to the detection unit tube containing the reaction dry powder; then adding the genomic DNA to the detection unit tube, and then adding the B Buffer and sealing the tube cover to mix well, centrifuging the mixed solution to the bottom of the tube, and then incubating at a constant temperature for isothermal amplification to obtain an isothermal amplification product.

[0013] As a preferred embodiment of the present invention, the components of the CRISPR / Cas12a detection system include: isothermal amplification product, Cas12a protein, the specific crRNA, reaction buffer, the ssDNA fluorescent probe and RNase-free water.

[0014] As a preferred embodiment of the present invention, the method for detecting the fluorescence signal of the reaction product is: using an instrument with a fluorescence collection system to collect the fluorescence signal intensity of the CRISPR / Cas12a detection system at the end of the reaction in real time. When the fluorescence signal is enhanced relative to the initial fluorescence signal, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

[0015] Furthermore, the instrument with the fluorescence collection system is a real-time fluorescence quantitative PCR instrument.

[0016] Furthermore, the real-time acquisition of the fluorescence signal intensity lasts for no less than 1 hour and the interval is no more than 1 minute.

[0017] As a preferred embodiment of the present invention, the method for detecting the fluorescent signal of the reaction product is: using an ultraviolet flashlight to illuminate the CRISPR / Cas12a detection system after the reaction is completed, and visually observing the fluorescent signal; when green fluorescence is observed, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. Good specificity: The present invention combines RAA primer amplification and CRISPR / Cas12a detection system, and both steps have detection specificity, ensuring the accuracy and reliability of ToLCNDV detection results;

[0020] 2. Short detection time: In the present invention, crude extraction of plant leaf sample DNA only takes about 5 min, the RAA reaction time only takes 25 min, and the CRISPR / Cas12a cutting reaction only takes 20 min, which is shorter than the time required for conventional genome extraction and PCR.

[0021] 3. High sensitivity: The detection sensitivity of the present invention to ToLCNDV is very high. -9 ToLCNDV can still be detected after PCR.

[0022] 4. No need to rely on expensive equipment: This detection method only needs to react under constant temperature conditions throughout the process, and the results can be directly judged by a UV flashlight. It is simple to operate and does not rely on expensive real-time fluorescence quantitative PCR instruments or ordinary PCR instruments. It can also be carried out in the field under limited conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a flow chart of the visual detection method of ToLCNDV;

[0024] Figure 2 This is a schematic diagram of the principle of the visual detection method of ToLCNDV;

[0025] Figure 3 This is a schematic diagram of the results of visually interpreting the reaction tubes of different field samples under ultraviolet irradiation;

[0026] Figure 4 The sensitivity results of the RAA-CRISPR / Cas12a method for detecting ToLCNDV in crude extracts of plant leaves; A is the result of naked eye judgment; B is a bar graph of the sensitivity fluorescence values ​​of the RAA-CRISPR / Cas12a method for detecting ToLCNDV in crude extracts of plant leaves. DETAILED DESCRIPTION

[0027] In order to make the above-mentioned purpose, features and advantages of the present invention more obvious and easy to understand, the specific implementation mode of the present invention is described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The technical features in each embodiment of the present invention can be combined accordingly without conflicting with each other.

[0028] like Figure 1 As shown, the present invention provides a visual detection method for New Delhi Tomato Leaf Curl Virus (ToLCNDV), and the specific method is: first, adding genomic DNA extracted from a plant sample to be detected to an RAA reaction system containing RAA primers and performing isothermal amplification; then adding the isothermal amplification product to a CRISPR / Cas12a detection system containing specific crRNA and an ssDNA fluorescent probe with a fluorescent group for reaction; finally, performing fluorescence signal detection on the reaction product, if the fluorescence signal is positive, it indicates that ToLCNDV is detected in the plant sample, otherwise it indicates that ToLCNDV is not detected.

[0029] In the above-mentioned visualization detection method of the present invention, the principle of realizing ToLCNDV visualization detection can be described as follows: CRISPR / Cas12a protein is a kind of nuclease, which can target and cut double-stranded DNA under the guidance of single-stranded RNA, and activate non-specific cutting activity for single-stranded DNA; based on this principle, any single-stranded fluorescent labeled probe is added to the system, and after Cas12a protein cuts the target sequence, the trans-cutting activity is activated and the fluorescent signal can be detected, otherwise there is no fluorescent signal, which allows the detection results of the CRISPR / Cas system to be visually seen by the naked eye. Combining this technology with isothermal amplification technology can greatly increase the sensitivity of the detection method, so that the specificity of the detection results is doubly guaranteed. Therefore, the principle of the above-mentioned detection method can be found in Figure 2 , a fluorescent signal can be finally detected for samples with virus, but no fluorescent signal can be detected for samples without virus.

[0030] In the above-mentioned visualization detection method of the present invention, the plant sample to be detected can be various tissues of the plant to be detected, such as roots, stems, leaves, etc., preferably leaf tissues.

[0031] In the embodiments of the present invention, the sources of the biological materials used are as follows:

[0032] The forward primer CP-F and reverse primer CP-R in the RAA primer were synthesized by Beijing Qingke Biotechnology Co., Ltd.; the ssDNA fluorescent probe with fluorescent groups and specific crRNA were synthesized by Shanghai Sangon Co., Ltd.; the RAA nucleic acid amplification kit (S001ZC) required for the construction of the RAA reaction system was purchased from Shanghai Hangzhou Zhongce Biotechnology Co., Ltd.; the Cas12a required for the construction of the CRISPR / Cas12a detection system was purchased from Gene Biotechnology International Trade (Shanghai) Co., Ltd.

[0033] In the embodiments of the present invention, several nucleotide sequences used are as follows:

[0034] The nucleic acid sequence of the forward primer CP-F is shown in SEQ ID NO.1, and the specific sequence is: ATCATTTCAACGCCCGCATCGAAAGTACGCCGA.

[0035] The nucleic acid sequence of the reverse primer CP-R is shown in SEQ ID NO.2, and the specific sequence is: TCGTGCCTAGATTCAAAGGACTGCACCTTACAA.

[0036] The nucleic acid sequence of the specific crRNA is shown in SEQ ID NO.3, and the specific sequence is: UAAUUUCUAAGUGUAGAUUGUUCAUCGGCCUGUUGGUC.

[0037] In the nucleic acid sequence of the ssDNA fluorescent probe with a fluorescent group, the 5-end has a fluorescent reporter group (FAM) and the 3-end has a quencher BHQI. The specific sequence is: 5'-FAM-CCCCCCC-BHQI-3'.

[0038] In the present invention, the RAA primers and crRNA used are designed to achieve specific detection purposes and are the key to the present invention. Specifically, the above RAA primers and crRNA are designed based on the conserved fragment in the ToLCNDV coat protein gene, and the conserved fragment nucleic acid sequence is shown in SEQ ID NO.4, and the specific sequence is:

[0039] CGATGAACAGAAAACCCAGAATGTACAGAATGTATAGAAGTCCCGACGTGCCAAGGGGCTGTGAAGGACCTTGTAAGGTGCAGTCCTTTGAATCTAGGCACGATGTCTCTCATATTGGCAAAGTCATGTGTGTTAGTGATGTTACCCGAGGAACTGGACTCACACATCGCGTAGGGAAGCGATTCTGTGTGAAATCCGTCTATGTGCTGGGAAAGATATGGATGGATGAA.

[0040] In addition, in the embodiment of the present invention, when the above-mentioned visualization detection method is specifically implemented, the RAA reaction system used can be configured using a RAA nucleic acid amplification kit, and its components include: reaction dry powder, A Buffer, the above-mentioned forward primer, the above-mentioned reverse primer, the above-mentioned genomic DNA, B Buffer and RNase-free water.

[0041] In addition, when the above-mentioned visualization detection method is specifically performed for RAA reaction system configuration and isothermal amplification, the specific operation can be performed according to the instruction manual of the RAA nucleic acid amplification kit. In an embodiment of the present invention, the method of adding the above-mentioned genomic DNA to the RAA reaction system containing RAA primers for isothermal amplification can be performed according to the following process: first configure a mixed solution containing RNase-free water, A Buffer, the above-mentioned forward primer, and the above-mentioned reverse primer according to the above-mentioned RAA reaction system, and add the mixed solution to the detection unit tube containing the above-mentioned reaction dry powder; then add the above-mentioned genomic DNA to the detection unit tube, and then add the above-mentioned B Buffer and seal the tube cover to mix, centrifuge the mixed solution to the bottom of the tube, and then incubate at a constant temperature for isothermal amplification to obtain isothermal amplification products. The specific reaction conditions can be designed and optimized with reference to the prior art.

[0042] In addition, in an embodiment of the present invention, when the above-mentioned visualization detection method is specifically implemented, the components of the CRISPR / Cas12a detection system used include: isothermal amplification product, Cas12a protein, the above-mentioned specific crRNA, reaction buffer, the above-mentioned ssDNA fluorescent probe and RNase-free water. The specific reaction conditions can be designed and optimized with reference to the prior art.

[0043] It should be noted that, when the present invention performs fluorescent signal detection on the reaction product, different detection methods can be designed according to the scenario.

[0044] In a conditional detection scenario such as a laboratory, the method for detecting the fluorescence signal of the reaction product can be carried out as follows: using an instrument with a fluorescence collection system, the fluorescence signal intensity of the CRISPR / Cas12a detection system at the end of the reaction is collected in real time. When the fluorescence signal is enhanced relative to the initial fluorescence signal, it indicates that the plant sample to be tested contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be tested does not contain the New Delhi Tomato Leaf Curl Virus. The above-mentioned instrument with a fluorescence collection system is a real-time fluorescence quantitative PCR instrument, such as Biorad CFX Opus 96. Generally speaking, the duration of real-time collection of fluorescence signal intensity is preferably not less than 1 hour, and the interval is preferably no more than 1 minute, so as to fully determine the fluorescence reaction results.

[0045] In addition, when conducting on-site measurements in the field, the method for detecting the fluorescent signal of the reaction product can be carried out as follows: use an ultraviolet flashlight to illuminate the CRISPR / Cas12a detection system after the reaction is completed, and visualize the fluorescent signal; when green fluorescence is observed, it indicates that the plant sample to be tested contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be tested does not contain the New Delhi Tomato Leaf Curl Virus.

[0046] The technical effects of the present invention are demonstrated below through multiple embodiments. In the following examples, unless otherwise specified, the reagents and materials used can all be commercially available products. In the following examples, where specific conditions are not specified, specific experiments can be carried out according to conventional methods and conditions in the art, or in accordance with the product instructions.

[0047] Example 1 Visual detection of ToLCNDV

[0048] 1. Design and synthesis of specific RAA primers and crRNA for the detection of ToLCNDV in crude extracts of plant leaf genomes based on RAA-CRISPR / Cas12a technology

[0049] (1) Synthesis of RAA primers: The CP gene sequences of different isolates of ToLCNDV were downloaded from the NCBI website, and the CP gene conserved nucleotide sequences of ToLCNDV were compared using Mega-X software. A specific fragment of about 230 bp in length was selected as the target sequence, and its sequence is shown in SEQ ID NO.4. According to the target sequence, the corresponding RAA primers were designed and synthesized. The forward primer and reverse primer in the RAA primers were named CP-F and CP-R, respectively, and the nucleotide sequences were shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. In this example, the CP-F and CP-R primers were synthesized by biological companies such as Beijing Qingke Biotechnology Co., Ltd.

[0050] (2) Design and synthesis of crRNA: The conserved nucleotide sequence of the CP gene of ToLCNDV screened above was used as the target, and the 20 bp sequence after TTTN in the highly conserved region was selected. The sequence specificity was analyzed by BLASTn comparison of the NCBI database, and the efficiency of crRNA was evaluated through an online website (https: / / ezassay.com / primer), and the sequence with the best specificity and highest efficiency was selected. The nucleic acid sequence of the specific crRNA finally obtained is shown in SEQ ID NO.3.

[0051] 2. Method for detecting ToLCNDV in crude extracts of plant leaf genomes based on RAA-CRISPR / Cas12a technology

[0052] See also Figure 1 As shown, this embodiment provides a method for detecting ToLCNDV in a crude extract of a plant leaf genome based on RAA-CRISPR / Cas12a technology, comprising the following steps:

[0053] (1) Crude extraction of genomic DNA from the sample to be tested: prepare an extraction buffer containing 6% PEG and 20 mM NaOH, and filter the extraction buffer with a 0.45 μm bacterial filter; use a 1.5 ml centrifuge tube cap to cut a piece of plant leaf the size of the tube cap as the plant sample to be tested, add 50 μl of extraction buffer, immerse the leaf, grind the leaf tissue with a grinding rod or other tool, and incubate at room temperature for 3-5 min.

[0054] The plant samples to be tested involved in this embodiment were collected from Shanghai, Zhejiang and other places, and detailed information is shown in Table 1.

[0055] (2) Establishment of RAA-CRISPR / Cas12a reaction system: In this system, the pre-designed RAA primers CP-F and CP-R are used to configure the RAA reaction system in the reaction tube, and the extracted genomic DNA is added to the RAA reaction system containing the RAA primers, and isothermal amplification is performed in the reaction tube. The isothermal amplification fragment is added to the CRISPR / Cas12a detection system containing the corresponding crRNA and ssDNA fluorescent probe for reaction. The binary complex formed by crRNA and Cas12a specifically recognizes the target dsDNA in the amplified product, thereby activating the fluorescent probe in the Cas12a non-specific cleavage reaction system.

[0056] As mentioned above, the above RAA primers include CP-F and CP-R, the nucleic acid sequence of CP-F is shown in SEQ ID NO.1, and the nucleic acid sequence of CP-R is shown in SEQ ID NO.2; the sequence of specific crRNA is shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe with a fluorescent group is 5'-FAM-CCCCCCC-BHQI-3'. These RAA primers and crRNA are designed based on the conserved fragment shown in SEQ ID NO.4 in the ToLCNDV coat protein gene.

[0057] In this embodiment, the RAA isothermal amplification reaction conditions are 37°C, 25 min. The RAA reaction system is configured using the RAA nucleic acid amplification kit (S001ZC, Hangzhou Zhongce Biotechnology Co., Ltd.), which includes 1 tube of reaction dry powder, 25μl A Buffer, 2 μl forward primer CP-F (10 μM), 2 μl reverse primer CP-R (10 μM), 5 μl genomic DNA sample and 2.5 μl B Buffer, and finally the system is filled to 50μl with RNase-free water. The specific steps for configuring the RAA reaction system and performing the isothermal amplification reaction are as follows:

[0058] (2.1) According to the reaction quantity and the composition amounts in the above RAA reaction system, prepare a mixed solution containing RNase-free water, ABuffer, forward primer CP-F (as shown in SEQ ID NO.1), and reverse primer CP-R (as shown in SEQ ID NO.2), mix well, and add to the detection unit tube containing the reaction dry powder;

[0059] (2.2) Adding the genomic DNA sample extracted from the plant sample to be tested into the detection unit tube according to the composition amounts in the above RAA reaction system;

[0060] (2.3) Add 2.5 μl of B Buffer to the cap of the detection unit tube according to the composition of the RAA reaction system, cover the tube, invert it several times to mix the components in the RAA reaction system, and then centrifuge the mixture to the bottom of the centrifuge tube by low speed centrifugation;

[0061] (2.4) Place the centrifuge tube in a 37°C constant temperature metal bath (or water bath) and incubate for 25 min to achieve isothermal amplification reaction;

[0062] (2.5) After the isothermal amplification reaction is completed, the obtained isothermal amplification product can be directly used in the next step of the CRISPR / Cas12a system reaction.

[0063] In this embodiment, the reaction conditions of the CRISPR / Cas12a system are 37°C, 30 min, and the reaction system includes: 2 μl isothermal amplification product, 100 nM Cas12a protein, 100 nM crRNA (as shown in SEQ ID NO.3), 2 μl NEBuffer2.1 buffer and 2 μM ssDNA fluorescent probe (sequence 5'-FAM-CCCCCCC-BHQI-3'), and RNase-free water is used to fill up to 20 μl. During the reaction, the binary complex formed by crRNA and Cas12a specifically recognizes the target dsDNA in the amplified product, thereby activating the fluorescent probe in the Cas12a non-specific cleavage reaction system.

[0064] (3) Interpretation of results: Fluorescence signal detection is performed on the reaction product of RAA-CRISPR / Cas12a. If the fluorescence signal is positive, it indicates that ToLCNDV is detected in the plant sample. Otherwise, it indicates that ToLCNDV is not detected. In this embodiment, the CRISPR / Cas12a detection system after the reaction is completed is directly illuminated by an ultraviolet flashlight in the field, and the fluorescence signal is visualized by naked eyes; when green fluorescence is observed, it indicates that the plant sample to be detected contains ToLCNDV, otherwise it indicates that the plant sample to be detected does not contain ToLCNDV.

[0065] The visualization results of this embodiment are as follows Figure 3As shown, the reaction product of RAA-CRISPR / Cas12a was irradiated with an ultraviolet flashlight. The test results are shown in Table 1. Among the 126 melon field samples, samples with sample numbers starting with SH and ZJ were collected from two different places in Shanghai and Zhejiang, respectively. Obvious green fluorescence was observed in the reaction tubes of SHHG-1, SHXG-1, SHXG-2, SHXG-3, SHXG-4, SHXG-5, SHXG-6, SHXG-7, ZJHG-1, ZJHG-2, ZJHG-3, ZJHG-4, ZJHG-5, ZJHG-6, ZJHG-6, ZJHG-7, ZJHG-8, ZJHG-9, and ZJWWG-1, indicating the presence of ToLCNDV in the samples, while no green fluorescence was observed in the reaction tubes of SHCK1, SHCK2, SHCK3, FJCK-1, FJCK-2, FJCK-3, FJCK-4, and FJCK-5, indicating that ToLCNDV was not present in the samples. The above test results are completely consistent with the results of PCR testing of 26 melon field samples after genome extraction using a DNA kit.

[0066] Table 1 Field sample information detected by RAA-CRISPR / Cas12a

[0067] Sample No. Host Plants Test results SHHG-1 cucumber + SHXG-1 watermelon + SHXG-2 watermelon + SHXG-3 watermelon + SHXG-4 watermelon + SHXG-5 watermelon + SHXG-6 watermelon + SHXG-7 watermelon + SHCK-1 cucumber - SHCK-2 pumpkin - SHCK-3 cucumber - ZJHG-1 cucumber + ZJHG-2 cucumber + ZJHG-3 cucumber + ZJHG-4 cucumber + ZJHG-5 cucumber + ZJHG-6 cucumber + ZJHG-7 cucumber + ZJHG-8 cucumber + ZJHG-9 cucumber + ZJWWG-1 Netted melon + ZJCK-1 watermelon - ZJCK-2 watermelon - ZJCK-3 watermelon - ZJCK-4 watermelon - ZJCK-5 watermelon -

[0068] In the table: “+” and “-” represent positive and negative test results, respectively.

[0069] Example 2: Sensitivity evaluation of the visual detection method of ToLCNDV

[0070] This example evaluates the sensitivity of the ToLNDV detection method presented in Example 1 above, and the specific steps are as follows:

[0071] (1) Using Vazyme's Ultra-Universal TOPO Cloning Kit (C603), the RAA amplified fragment of ToLCNDV was constructed into the pCE3 vector as a positive plasmid. The specific operation was as follows: 2 μl 5× Ultra-Universal TOPO Cloning Mix, 1 μl RAA amplification purified product and 7 μl ddH2O were added to the reaction tube, and the vector and amplified fragment were connected in a PCR instrument at 25°C for 30 min. After the reaction, the ligation product was added to 100 μl DH5α chemical competent medium, heat-shocked at 42°C, and plated. After plaque screening and sequencing, the positive plasmid was extracted.

[0072] (2) Dilute the positive plasmid of ToLCNDV CP fragment 10 times in sequence to obtain 10 10 ~101 The test sample of 100 copies / μl was used as a template for RAA isothermal amplification. Then 1 μl was added to the same system, and ddH2O was used as a negative control to perform RAA-CRISPR / Cas12a reaction. In this embodiment, the construction of each reaction system can refer to the content of Example 1 and will not be repeated.

[0073] The naked eye interpretation and sensitivity fluorescence value bar graph results of the sensitivity evaluation of the ToLCNDV visualization detection method in this embodiment are as follows: Figure 4 The results show that the sensitivity of this method is 10 1 copies / μl.

[0074] The above-described embodiment is only a preferred solution of the present invention, which is convenient for technicians in the relevant field to understand and use. Technicians in the relevant field can make various reasonable changes, modifications and improvements without going through creative work without departing from the spirit and principles of the present invention. Therefore, the above examples are not limitations of the present invention, and all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A visual detection method for New Delhi Tomato Leaf Curl Virus, characterized in that: First, the genomic DNA extracted from the plant sample to be tested is added to the RAA reaction system containing RAA primers and isothermally amplified; then the isothermally amplified product is added to the CRISPR / Cas12a detection system containing specific crRNA and ssDNA fluorescent probes for reaction; finally, the reaction product is subjected to fluorescent signal detection. If the fluorescent signal is positive, it indicates that the New Delhi Tomato Leaf Curl Virus has been detected in the plant sample; otherwise, it indicates that the New Delhi Tomato Leaf Curl Virus has not been detected; The RAA primer includes a forward primer and a reverse primer, the nucleic acid sequence of the forward primer is shown in SEQ ID NO.1, and the nucleic acid sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the specific crRNA is shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe is 5'-FAM-CCCCCCC-BHQI-3'.

2. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The extraction buffer used to extract genomic DNA from the plant sample to be tested is an extraction buffer containing PEG and NaOH.

3. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The plant sample to be detected is leaf tissue of the plant to be detected.

4. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The RAA reaction system is configured using a RAA nucleic acid amplification kit, and its components include: reaction dry powder, A Buffer, the forward primer, the reverse primer, the genomic DNA, B Buffer and RNase-free water.

5. The visual detection method of New Delhi Tomato Leaf Curl Virus according to claim 4, characterized in that: The method for adding the genomic DNA to the RAA reaction system containing the RAA primer for isothermal amplification is as follows: first preparing a mixed solution containing RNase-free water, A Buffer, the forward primer, and the reverse primer according to the RAA reaction system, and adding the mixed solution to a detection unit tube containing the reaction dry powder; then adding the genomic DNA to the detection unit tube, and then adding the B Buffer and sealing the tube cover to mix well, centrifuging the mixed solution to the bottom of the tube, and then incubating at a constant temperature for isothermal amplification to obtain an isothermal amplification product.

6. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The components of the CRISPR / Cas12a detection system include: isothermal amplification product, Cas12a protein, the specific crRNA, reaction buffer, the ssDNA fluorescent probe and RNase-free water.

7. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The method for detecting the fluorescence signal of the reaction product is: using an instrument with a fluorescence collection system to collect the fluorescence signal intensity of the CRISPR / Cas12a detection system at the end of the reaction in real time, when the fluorescence signal is enhanced relative to the initial fluorescence signal, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

8. The visual detection method of New Delhi Tomato Leaf Curl Virus according to claim 7, characterized in that: The instrument with the fluorescence collection system is a real-time fluorescence quantitative PCR instrument.

9. The method for visual detection of New Delhi Tomato Leaf Curl Virus according to claim 7, characterized in that: The duration of real-time acquisition of the fluorescence signal intensity is not less than 1 hour, and the interval is not more than 1 minute.

10. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The method for detecting the fluorescent signal of the reaction product is: using an ultraviolet flashlight to illuminate the CRISPR / Cas12a detection system after the reaction is completed, and visually observing the fluorescent signal; when green fluorescence is observed, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

Images