Application of RSAD1 gene as a target in screening drugs to inhibit infection by microribonucleoviridae viruses.
By targeting and knocking out or overexpressing the RSAD1 gene using CRISPR-Cas9 technology, the problems of Seneca virus replication inhibition and production were solved, enabling the construction of drug screening targets and production cell lines, and significantly inhibiting or promoting Seneca virus replication.
Patent Information
- Application Number
- CN202311314168.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-11
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2043-10-11
AI Technical Summary
Existing technologies are insufficient to effectively inhibit the replication of Seneca virus (SVA), and there is a lack of effective drug targets and cell lines for the production of Seneca virus or vaccines.
Using CRISPR-Cas9 technology, we can target and knock out the RSAD1 gene or overexpress the RSAD1 protein in host cells. By designing specific sgRNA and delivery vectors, we can achieve efficient knockout or overexpression of the RSAD1 gene and construct RSAD1 gene knockout cell lines and overexpression cell lines.
It significantly inhibits the replication of Seneca virus (SVA), provides screening targets for anti-Seneca virus drugs, and constructs a highly efficient cell line for the production of Seneca virus or vaccines.
Smart Images

Figure CN119345361B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the application of RSAD1 gene as a target in screening drugs that inhibit infection by viruses of the Picornaviridae family. Background Technology
[0002] Senecavirus A (SVA) is a single-stranded positive-sense RNA virus and the sole member of the genus Senecavirus in the family Picornaviridae. Other members of the Picornaviridae family include viruses from the genera Enterovirus, Rhinovirus, Cardivirus, and Oral Enterovirus. Senecavirus is highly pathogenic to pigs, infecting pigs of all ages. Infected adult pigs develop vesicular ulcers on the mouth, nose, and coronary band, while newborn piglets experience acute death after infection. Since its introduction to Guangdong Province, my country in 2015, the virus has caused widespread outbreaks, subsequently leading to SVA epidemics in pig farms across multiple provinces, resulting in severe economic losses to my country's pig farming industry.
[0003] The CRISPR-Cas9 system consists of clusters of regularly spaced short palindromic repeats of the CRISPR gene sequence and Cas family proteins. It is a third-generation gene editing technology that can target almost any gene. It is easy to operate, has high knockout efficiency, and is widely used for gene editing, especially for the construction of gene knockout cell lines.
[0004] Proteins containing a radical S-adenosyl-methionine (SAM) domain generate 5'-deoxyadenosine radicals by cleaving the SC (5') bond in the SAM domain, catalyzing a series of complex redox reactions and exhibiting oxidoreductase activity. Literature reports that Radical S-adenosyl-methionine domain-containing protein 2 (RSAD2) possesses oxidoreductase activity and can inhibit the replication of various viruses, including Zika virus, influenza virus, and hepatitis C virus.
[0005] This invention unexpectedly discovered that inhibiting the expression of the RSAD1 gene in host cells can significantly inhibit SVA replication. Secondly, this invention provides a specific sgRNA targeting the RSAD1 gene. This sgRNA specifically targets the RSAD1 gene, and combined with CRISPR-Cas9 technology, RSAD1 gene knockout is achieved. The RSAD1 gene can serve as a target for screening and developing anti-SVA drugs. Simultaneously, this invention found that overexpression of the RSAD1 protein in host cells can significantly promote Seneca virus replication, and this can be used as a cell line for the production of Seneca virus or vaccines. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention unexpectedly discovered that inhibiting the expression of the RSAD1 gene in host cells can significantly inhibit SVA replication. That is, the RSAD1 gene can serve as a target for screening and developing anti-SVA drugs. Furthermore, overexpression of the RSAD1 protein in host cells can significantly promote Seneca virus replication and can be used as a production cell line for Seneca virus or vaccines. Specifically, this includes the following:
[0007] In a first aspect, the present invention provides the application of RSAD1 gene / protein as a target in screening drugs for the prevention or treatment of viral infections, wherein the drug targets RSAD1 and inhibits the expression of RSAD1 gene / protein.
[0008] Preferably, the virus is a virus from the Picornaviridae family.
[0009] Preferably, the microribonucleoviridae virus is Seneca virus.
[0010] Secondly, this invention provides the application of RSAD1 gene / protein expression inhibitors in the preparation of drugs for the prevention or treatment of viral infections.
[0011] Preferably, the virus is a virus from the Picornaviridae family.
[0012] Preferably, the microribonucleoviridae virus is Seneca virus.
[0013] Preferably, the RSAD1 gene / protein expression inhibitor includes a small interfering RNA designed to target the RSAD1 gene / protein or an sgRNA that targets and knocks out the RSAD1 gene / protein.
[0014] Preferably, the sgRNA targeting the knockout of the RSAD1 gene / protein is delivered by a delivery vector.
[0015] Preferably, the target sequence of the sgRNA that targets and knocks out the RSAD1 gene / protein is: TCTAGCCAGCCCCCGTACTG.
[0016] Preferably, the sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R:
[0017] sgRNA-F: 5'-CACCGTCTAGCCAGCCCCCGTACTG-3';
[0018] sgRNA-R: 5'-AAACCAGTACGGGGGCTGGCTAGAC-3'.
[0019] Thirdly, the present invention provides the application of RSAD1 gene / protein as a target in screening virus or vaccine production enhancers, wherein the drug targets RSAD1 and promotes the expression of RSAD1 gene / protein.
[0020] Preferably, the virus is a virus from the Picornaviridae family.
[0021] Preferably, the microribonucleoviridae virus is Seneca virus.
[0022] Fourthly, the present invention provides the application of RSAD1 protein or its expression promoter in the preparation of viral or vaccine production enhancers.
[0023] Preferably, the virus is a virus from the Picornaviridae family.
[0024] Preferably, the microribonucleoviridae virus is Seneca virus.
[0025] Fifthly, the present invention provides the application of RSAD1 protein overexpression cell lines in the preparation of cell lines for virus or vaccine production.
[0026] Preferably, the virus is a virus from the Picornaviridae family.
[0027] Preferably, the microribonucleoviridae virus is Seneca virus.
[0028] The beneficial effects of this invention are: ① This invention first discovered that inhibiting the expression of the RSAD1 gene in host cells can inhibit the replication of SVA, a microRNA virus; ② This invention provides an sgRNA that targets the RSAD1 gene, which, combined with CRISPR-Cas9 technology, can achieve highly efficient knockout of the RSAD1 gene in host cells; ③ This invention provides a method for constructing an RSAD1 gene knockout cell line by delivering the sgRNA to host cells using CRISPR-Cas9 technology; ④ The monoclonal cell line obtained according to the method of this invention can significantly inhibit the replication of SVA, a microRNA virus, and can be used as a drug screening target for treating microRNA viruses, providing research tools and materials for further research on the molecular mechanism by which the RSAD1 gene regulates the replication of microRNA viruses in cells; ⑤ This invention discovered that overexpression of RSAD1 protein in host cells can significantly promote the replication of Seneca virus, and can be used as a production cell line for Seneca virus or vaccines. Attached Figure Description
[0029] Figure 1 Schematic diagram of sgRNA sequences targeting the RSAD1 genomic region;
[0030] Figure 2 Analysis of gene deletion mutations in the RSAD1-KO cell line;
[0031] Figure 3 Western blot analysis was performed to detect the protein level of the RSAD1 gene in knockout cell lines.
[0032] Figure 4 Cell viability assay results for RSAD1 gene loss-of-function cell lines;
[0033] Figure 5 The replication level of SVA in RSAD1-WT and RSAD1-KO cells was detected by real-time quantitative PCR.
[0034] Figure 6 Western blot analysis was performed to detect the viral protein levels of SVA replicating in RSAD1-WT and RSAD1-KO cells;
[0035] Figure 7 TCID 50 Detect the viral titer of SVA in RSAD1-KO cells;
[0036] Figure 8 The expression results of RSAD1 protein were detected in the PK-15 cell line overexpressing RSAD1.
[0037] Figure 9 Results of SVA 3D transcription level detection in PK-15 cell line overexpressing RSAD1;
[0038] Figure 10 Expression results of SVA structural protein VP2 in the RSAD1-overexpressing PK-15 cell line;
[0039] Figure 11 TCID 50 The viral titer of SVA in PK-15 cell lines overexpressing RSAD1 was detected. Detailed Implementation
[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the various embodiments of this invention will be described in detail below with reference to the accompanying drawings. However, those skilled in the art will understand that many technical details have been provided in the embodiments of this invention to facilitate a better understanding of this application. However, the technical solutions claimed in this application can be implemented even without these technical details and various variations and modifications based on the following embodiments.
[0041] definition
[0042] The term "sgRNA (small guide RNA)" refers to guide RNA (gRNA), which guides the insertion or deletion of uridine residues into the kinetoplastid during RNA editing. It is a type of small non-coding RNA. gRNA edits RNA molecules that are approximately 60-80 nucleotides in length and are transcribed from a single gene.
[0043] This invention first synthesizes sgRNA targeting the RSAD1 gene, and then uses CRISPR / Cas9 to specifically knock out the RSAD1 gene. Taking PK-15 cells as an example, the RSAD1 gene (RSAD1 amino acid sequence as shown in SEQ ID NO.1; nucleotide sequence as shown in SEQ ID NO.2) was knocked out, resulting in a gene knockout host cell, providing a strategy for inhibiting SVA infection.
[0044] Using CRISPR / Cas9 gene editing technology, Cas9 protein is guided by sgRNA targeting the RSAD1 gene to bind to a specific sequence position in the RSAD1 gene to cut the DNA double strand, causing a double-strand break. Under the action of the cell's own repair mechanism, random mutations are generated. Mutations such as nucleotide deletion or insertion will cause changes in the gene's reading frame, ultimately achieving the goal of losing the function of the gene-encoded protein and obtaining a cell line with the loss of gene-encoded protein function.
[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies.
[0046] The plasmids used in the following examples were purchased from Origene.
[0047] SVACH-FJ-2017 (GenBank: KY74510) originated from the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
[0048] The RSAD1 gene sequence described in the following examples is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.1.
[0049] Example 1: Construction of RSAD1 gene knockout PK-15 cell line
[0050] Using the NCBI database to query the RSAD1 gene sequence, and following the CRISPR / Cas9 design principles, an sgRNA was designed in the fourth exon region of the RSAD1 gene using CRISPR software (e.g., ...). Figure 1 As shown):
[0051] The target sequence of the RSAD1-sgRNA is: TCTAGCCCAGCCCCCGTACTG (SEQ ID NO.3); the RSAD1-sgRNA is a double-stranded fragment formed by annealing RSAD1-sgRNA-F (5'-CACCGTCTAGCCAGCCCCCGTACTG-3', SEQ ID NO.4) and RSAD1-sgRNA-R (5'-AAACCAGTACGGGGGCTGGCTAGAC-3', SEQ ID NO.5);
[0052] Annealing of sgRNA: Dissolve 1 OD of sgRNA upstream and downstream single-stranded nucleotide dry powder primers in 10 μL of ddH2O. Take 1 μL of each upstream and downstream primers and add annealing buffer. The total system is 50 μL. Anneal at 99℃ for 5 min to form double strands of upstream and downstream primers.
[0053] Enzyme digestion of lenti-CRISPR-v2 vector: 1 μg vector, 1 μL restriction enzyme Esp3I, 2 μL 10× buffer, and ddH2O were added to a reaction system to bring the volume to 20 μL. The reaction system was digested at 37°C for 2 h, and the digested fragments were recovered by gel extraction.
[0054] Ligation of the digested vector with sgRNA: 1 μL T4 ligase, 1 μL 10×T4 ligase buffer, 1 μL lenti-CRISPR-v2 digested fragment, 1 μL annealed sgRNA, 6 μL ddH2O, total 10 μL system, ligated at room temperature for 2 h;
[0055] Transformation of lenti-CRISPR-v2-sgRNA ligation product: The ligation product was transformed into DH5α competent cells, plasmids were extracted, and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence using BLAST software. Recombinant plasmids of sgRNA targeting different exons of the RSAD1 gene were successfully constructed. Location and sequence information are as follows: Figure 1 The recombinant plasmids were named lenti-CRISPR-v2-RSAD1-sgRNA.
[0056] Cell transfection: Following the standard PEI transfection procedure, lenti-CRISPR-v2-RSAD1-sgRNA plasmid (10 μg) and two helper vectors (LH1, 7.5 μg and LH2, 5 μg) were co-transfected into 293T cells. After 36 h of transfection, the supernatant was collected, filtered through a 0.45 μm filter, and polybrene (8 μg / mL) was added to infect PK-15 cells. After three passages of selection using medium containing 1 μg / mL puromycin, cell counts were performed, and cells were aliquoted into 96-well plates at a dilution ratio of one cell per well. Approximately 2-3 weeks later, single clones were picked and sequenced to identify their genotype. Two RSAD1 knockout single clones and two wild-type single clones were randomly selected and expanded for subsequent experiments.
[0057] The results are as follows Figure 2 As shown, there is a deletion of one base at the predetermined cleavage position (between the 3rd and 4th bases of the PAM motif (TGG)).
[0058] The protein expression level of RSAD1 was detected using Western blotting. The results are as follows: Figure 3 As shown, RSAD1 protein expression was not detected in the RSAD1-KO cell line. These results indicate that the RSAD1 gene knockout PK-15 cell line was successfully constructed.
[0059] Example 2: Viability assay of RSAD1 gene knockout PK-15 cell lines
[0060] After digestion and counting, the cell suspension concentration was adjusted, and 100 μL of 2000 cells was added to each well of a 96-well plate. The plates were then incubated normally. 10 μL of CCK-8 reagent was added to each well, and the plates were incubated for another 3 hours. The absorbance was measured at 450 nm using a microplate reader, and the data were analyzed. Results are as follows: Figure 4 As shown, the RSAD1 gene knockout PK-15 cell line RSAD1-KO had the same cell viability as the control group PK-15 cells, indicating that the knockout of the RSAD1 gene does not affect the normal proliferation and growth of host cells.
[0061] Example 3: SVA replication level in RSAD1-KO cell line
[0062] RSAD1-KO and control PK-15 cells (WT) were seeded in 6-well plates and infected with SVA cells 12 h later. Cells were harvested at 0, 6, and 12 h, and total RNA was extracted using the Trizol lysis method. Reverse transcription was performed using the HiScript IIQ RT SuperMix (Novizan R222-01) reverse transcription kit, and qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Novizan Q711-02) reagent. GAPDH was used as an internal control gene to detect the transcription level of SVA3D. The primer sequences used were SVA3D-qPCR-F (5'-AGAATTTGGAAGCCATGCTCT-3', SEQ ID NO. 6) and SVA3D-qPCR-R (5'-GAGCCAACATAGARACAGATTGC-3', SEQ ID NO. 7), swine-GAPDH-qPCR-F (5'-ACATGGCCTCCAAGGAGTAAGA-3', SEQ ID NO. 8), and swine-GAPDH-qPCR-R (5'-GATCGAGTTGGGGCTGTGACT-3', SEQ ID NO. 9). The results are as follows: Figure 5 As shown, knocking out RSAD1 significantly suppressed the transcriptional level of SVA3D, thereby inhibiting SVA replication.
[0063] To investigate the effect of RSAD1 knockout on SVA viral protein levels, RSAD1-KO and control PK-15 cells (WT) were seeded in 6-well plates and infected with SVA 12 h later. Cell samples were collected at 0, 4, 8, and 12 h, and cells were lysed with 2×SDS loading buffer and boiled at 95°C for 10 min. Protein samples were subjected to SDS-PAGE electrophoresis (stacking gel, 80V, 30 min; separating gel, 120V, time as needed). Proteins were then transferred to an NC membrane using a wet transfer method under the conditions of 100V for 1 h in an ice bath. The NC membrane was blocked with 5% skim milk powder for 1 h, incubated with primary antibody at room temperature for 2 h, and then washed three times with TBST (TBS containing 0.1% Tween 20) for 10 min each time. Secondary antibody was incubated at room temperature for 1 h, followed by washing four times with TBST (TBS containing 0.1% Tween 20) for 10 min each time. Finally, the relative content of the target protein was detected using chemiluminescent substrates with different sensitivities (depending on experimental requirements). The results are as follows: Figure 6 As shown, in samples collected after SVA infection, the expression of the SVA structural protein VP2 in the RSAD1-KO cell line was significantly lower than that in wild-type cells, indicating that the RSAD1 gene-deleted monoclonal cell line can significantly inhibit the expression of SVA VP2 and suppress SVA replication.
[0064] In addition, through TCID 50 The experiment detected differences in viral titers in RSAD1-KO and WT cells. SVA was used to infect both cell types, and cell samples were collected at different time points. After three freeze-thaw cycles, the obtained cell samples were subjected to 10 μL of serum-free DMEM. -2 ~10 -8 IBRS-2 cells that had reached a confluent monolayer were seeded with serially diluted viral buffers at different gradients in 96-well cell culture plates. Eight wells were seeded for each dilution, with 100 μL per well. The plates were incubated at 37°C with 5% CO2 for 4 days, with cytopathic effects (CPE) observed and recorded every 12 hours. The TCID of the amplified virus was calculated using the Reed-Muench method. 50 The result is as follows Figure 7 As shown, in samples collected after inoculation of SVA CH-FJ-2017 (GenBank: KY74510), the viral titer of SVA in the RSAD1 gene knockout PK-15 cell line RSAD1-KO was significantly lower than that in wild-type cells, indicating that the RSAD1 gene-deficient monoclonal cell line can significantly inhibit SVA replication. These experimental results demonstrate that the RSAD1 gene knockout cell line can significantly inhibit the replication of Picornaviridae virus SVA and can serve as a drug target for inhibiting the replication of Picornaviridae viruses.
[0065] The above experimental results indicate that RSAD1 gene knockout cell lines can significantly inhibit the replication of Picornaviridae virus SVA, and can serve as a drug target for inhibiting the replication of Picornaviridae viruses.
[0066] Example 4: Construction of RSAD1-overexpressing PK-15 cell lines
[0067] 1. Constructing plasmids
[0068] Based on the RSAD1 gene sequence, upstream primer RSAD1-BamHI-F (5'-CCGGGATTTGGATCCATGGCGCTCCCCGGGGCTCGG-3', SEQ ID NO.10) and downstream primer RSAD1-NheI-R (5'-CTT GTAGTCGCTAGCTCCTCCTGGCACAGGGGAGGA-3', SEQ ID NO.11) were designed.
[0069] RSAD1 gene fragment amplification: Take 1 μL each of upstream and downstream primers and add high-fidelity polymerase. The RSAD1 gene fragment was amplified using a reaction program of 1 μL MaxDNA Polymerase (Takara R045B), 0.5 μL plasmid template, and ddH2O to a final volume of 50 μL. The reaction was performed at 95℃ for 3 min, 95℃ for 15 s, 58℃ for 15 s, 72℃ for 3 min, 30 cycles, and 72℃ for 10 min. The PCR product was then recovered from the gel.
[0070] Enzyme digestion of Plov vector: The reaction system was prepared by adding 1 μg of vector, 1 μL of restriction enzyme BamHI, 1 μL of NheI, 2 μL of 10× buffer, and ddH2O to a final volume of 20 μL. The digestion was carried out at 37°C for 2 h, and the digested fragments were recovered by gel extraction.
[0071] Homologous recombination of the digested vector and gene fragment: Using the ClonExpress II One Step Cloning Kit (Novaza C112-02), 1 μL of homologous recombination enzyme, 2 μL of 5× homologous recombination enzyme buffer, 1 μL of Plov vector digested fragment, 2 μL of RSAD1 fragment, and 4 μL of ddH2O were added to a total volume of 10 μL. Homologous recombination was performed at 37℃ for 30 min.
[0072] Transformation of Plov-RSAD1 homologous recombination product: The product was transformed into DH5α competent cells, plasmid was extracted, and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target gene sequence using MegAlign software, and the Plov-RSAD1 recombinant plasmid was successfully constructed.
[0073] 2. Cell transfection
[0074] According to the standard transfection procedure of PEI, the Plov-RSAD1 plasmid (10 μg) and two helper vectors (LH1 (7.5 μg) and LH2 (5 μg)) were co-transfected into 293T cells. After 36 h of transfection, the supernatant was collected, filtered through a 0.45 μm filter, and polybrene (8 μg / mL) was added to infect PK-15 cells. The cells were cultured for 3 generations in medium containing 1 μg / mL puromycin to select for resistance, and finally the PK-15 cell line pRSAD1, which stably expresses RSAD1, was obtained.
[0075] The protein expression level of RSAD1 was detected using Western blotting. The results are as follows: Figure 8 As shown, RSAD1 protein overexpression was detected in the RSAD1 overexpression cell line. These results indicate that the RSAD1 gene overexpression PK-15 cell line was successfully constructed.
[0076] Example 5: Replication level of SVA in RSAD1 overexpressing cells
[0077] The PK-15 cell line pRSAD1, stably expressing RSAD1, and the control (Vector) PK-15 cells were seeded in 6-well plates. After 12 hours, SVA cells were infected. Cells were harvested at 0, 6, and 12 hours. Total RNA was extracted using the Trizol lysis method, and reverse transcription was performed using the HiScript IIQ RT SuperMix (Novizan R222-01) reverse transcription kit. qPCR was performed using the Ch amQ Universal SYBR qPCR Master Mix (Novizan Q711-02) reagent. GAPDH was used as an internal control gene, and the transcription level of SVA 3D was detected (detection method was the same as in Example 3). The results are as follows: Figure 9 As shown, compared with the control group (Ve ctor) PK-15 cells, the PK-15 cell line pRSAD1, which stably expresses RSAD1, can significantly promote the transcription level of SVA 3D and promote SVA replication.
[0078] Furthermore, the PK-15 cell line pRSAD1, which stably expresses RSAD1, and the control (Vector) PK-15 cells were seeded into 6-well plates, respectively. After 12 hours, the cells were infected with SVA. Cell samples were collected at 0, 6, and 12 hours, and cells were lysed with 2×SDS loading buffer and boiled at 95°C for 10 minutes. Protein samples were subjected to SDS-PAGE electrophoresis to detect the relative content of the target protein (method as in Example 3). The results are as follows: Figure 10 As shown, in samples collected after SVA infection, the expression of SVA structural protein VP2 in the PK-15 cell line pRSAD1, which stably expresses RSAD1, was significantly higher than that in wild-type cells, indicating that overexpression of RSAD1 can promote the expression of SVA VP2 and promote SVA replication.
[0079] In addition, through TCID 50 The experiment detected differences in viral titers in RSAD1-KO and WT cells (method as in Example 3). Results are as follows: Figure 11 As shown, in the samples collected after inoculation of SVA CH-FJ-2017 (GenBank:KY74510), the viral titer of SVA in the PK-15 cell line pRSAD1, which stably expresses RSAD1, was significantly higher than that in the control group, indicating that overexpression of RSAD1 can significantly promote the replication of SVA.
[0080] The above experimental results indicate that overexpression of RSAD1 protein in host cells can significantly promote the replication of Seneca virus (a microRNAviridae virus), and can serve as a cell line for the production of Seneca virus or vaccines. Furthermore, RSAD1 protein can be used as a target for screening Seneca virus or vaccine production enhancers, and RSAD1 protein or its expression promoters can be used as production enhancers to promote the production of Seneca virus or vaccines.
Claims
1. Application of RSAD1 gene / protein expression inhibitor in the preparation of drugs for treating Seneca virus infection; wherein the RSAD1 gene / protein expression inhibitor is an sgRNA that targets and knocks out the RSAD1 gene / protein; wherein the sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R: sgRNA-F: 5'-CACCGTCTAGCCAGCCCCCGTACTG-3'; sgRNA-R: 5'-AAACCAGTACGGGGGCTGGCTAGAC-3'.
2. Application of RSAD1 protein overexpression cell lines in the preparation of cell lines for Seneca virus vaccine production.
Citation Information
Patent Citations
Clone of IRG6 gene having potential anti-classical swine fever virus effect, and construction of stable expression cell line of IRG6 gene
CN102899338A
Recombinant Nucleic Acid of Seneca Valley Virus, Recombinant Vaccine Strain and Preparation Method and Use Thereof
US20220031832A1