Nucleic acid composition for rapidly detecting type B clostridium botulinum and application of nucleic acid composition

Abstract

The invention discloses a nucleic acid composition for rapidly detecting type B clostridium botulinum and application of the nucleic acid composition, the composition is composed of a primer pair and a probe formed by single-chain molecules with the name of BoNT / B-P. The primer pair is composed of single-chain DNA with the name of BoNT / B-F3 and single-chain DNA with the name of BoNT / B-R3. According to the invention, a real-time fluorescence RPA rapid detection system of the B-type clostridium botulinum is established, and a new technical support is provided for on-site rapid diagnosis and epidemic disease investigation of the B-type clostridium botulinum.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and specifically relates to a nucleic acid composition for rapid detection of type B Clostridium botulinum and an application thereof. Background Art

[0002] Clostridium botulinum ( C . botulinum ) is a Gram-positive, anaerobic, spore-forming oval, short and thick rod. Spore transmission is the main form of infection by Clostridium botulinum. Parasitic Clostridium botulinum is commonly found in places with anaerobic or weak oxygen conditions in nature, such as soil, ocean and lake sediments, which can easily become a breeding ground for the proliferation of Clostridium botulinum. Clostridium botulinum can also survive in the intestines of mammals, birds, and fish, as well as in fermented feed and food. However, parasitic Clostridium botulinum itself does not cause pathogenicity to animals. However, when the parasitic host is under hypoxic conditions, it can activate the parasitic Clostridium botulinum to revive and proliferate, and produce a strong botulinum toxin (botulinum toxin), causing poisoning of the animal itself or the decayed material contaminated by the toxin. According to the different antigenicity of the toxin produced, Clostridium botulinum is divided into 7 types, AG, of which A, B, E, and F are types of human poisoning, C and D are types of animal and poultry poisoning, G type is extremely rare, and H type has recently been found in infant botulism cases. The main prevalent types in my country are Type A and Type B, among which Type A is the main type in Xinjiang, while Type B is the main type in other provinces and regions such as Hebei, Henan, Shandong, etc.

[0003] Botulinum toxin, also known as botulinum neurotoxin (BoNT), is the most potent neurotoxin known to date. Food poisoning caused by it has been found in more than a dozen provinces and regions in my country, with a very high mortality rate, which endangers food safety. As a neurotoxin, botulinum toxin can penetrate the mucous membranes of various parts of the body, be absorbed by the gastrointestinal tract, spread through the lymph and blood, act on cranial nerve nuclei, peripheral neuromuscular junctions, and autonomic nerve endings, hinder the release of acetylcholine, affect the transmission of nerve impulses, and cause muscle flaccid paralysis. If rescue is not timely, the mortality rate is very high. Therefore, a rapid and accurate diagnosis must be made so that symptomatic treatment can be provided. At present, the main detection methods for Clostridium botulinum include isolation and culture, mouse animal experiments, immunological methods such as indirect ELISA for toxins, and molecular biological methods such as real-time fluorescence PCR. Most of these methods have the disadvantages of being time-consuming and labor-intensive or having low sensitivity. In addition, the requirements for professional experimental personnel and high experimental environment also limit field and on-site detection. Therefore, being able to quickly diagnose it in the early stages of infection is an important means to effectively treat patients and reduce mortality. Summary of the invention

[0004] The problem to be solved by the present invention is how to conduct on-site rapid diagnosis and epidemiological investigation of type B Clostridium botulinum.

[0005] To solve the above problems, the present invention provides the use of the composition in any of the following A1) to A12): A1) Application in the detection of Clostridium botulinum type B, A2) Use in the preparation of a product for detecting Clostridium botulinum type B, A3) Application in identification or auxiliary identification of Clostridium botulinum type B, A4) Use in the preparation of a product for identifying or assisting in the identification of Clostridium botulinum type B, A5) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, A6) Use in the preparation of a product for identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, A7) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, A8) Use in the preparation of products for screening or assisting in screening of drugs for preventing and treating Clostridium botulinum type B, A9) Application in the diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, A10) Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by Clostridium botulinum type B infection, A11) Application in monitoring treatment of diseases caused by Clostridium botulinum type B infection, A12) Use in the preparation of a product for monitoring the treatment of diseases caused by Clostridium botulinum type B infection; The composition is a composition for detecting Clostridium botulinum type B, and is composed of a primer pair and a probe, wherein the primer pair is composed of single-stranded DNAs named BoNT / B-F3 and BoNT / B-R3, respectively, wherein the BoNT / B-F3 is a single-stranded DNA molecule whose nucleotide sequence is Sequence 4 in the sequence list; and the BoNT / B-R3 is a single-stranded DNA molecule whose nucleotide sequence is Sequence 8 in the sequence list; The probe is a single-stranded molecule named BoNT / BP, and the BoNT / BP is composed of a first single-stranded DNA fragment, a tetrahydrofuran residue, and a second single-stranded DNA fragment connected from the 5' to the 3' end, the nucleotide sequence of the first single-stranded DNA fragment is sequence 10 (TTTGCATGGATTATATGGCATTAAAGTAGAt), the 31st nucleotide of sequence 10 is modified with a fluorescent group, and the 31st nucleotide of sequence 10 is connected to the tetrahydrofuran residue; the nucleotide sequence of the second single-stranded DNA fragment is sequence 11 (AtTTACCAATTGTACCA), the 1st nucleotide of sequence 11 is connected to the tetrahydrofuran residue, the 2nd nucleotide of sequence 11 is modified with a quenching group, and the 17th nucleotide of sequence 11 is modified with a blocking group.

[0006] The above-mentioned product can be a reagent or a kit.

[0007] The present invention also provides a composition, which may be the above-mentioned composition for detecting Clostridium botulinum type B.

[0008] The present invention also provides a reagent for detecting type B Clostridium botulinum, wherein the reagent contains the above composition.

[0009] The reagent may further contain other reagents required for real-time fluorescent RPA (eg, magnesium acetate solution, exonuclease III, etc.).

[0010] The present invention also provides a kit for detecting type B Clostridium botulinum, wherein the kit contains the above composition or reagent.

[0011] The present invention also protects the use of the above reagent in any of the following: B1) Application in the detection of Clostridium botulinum type B, B2) Application in identification or auxiliary identification of Clostridium botulinum type B, B3) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, B4) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, B5) Application in diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, B6) in the application of therapeutic monitoring in diseases caused by Clostridium botulinum type B infection.

[0012] The present invention also protects the use of the above-mentioned kit in any of the following: C1) Application in the detection of Clostridium botulinum type B, C2) Application in the identification or auxiliary identification of Clostridium botulinum type B, C3) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, C4) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, C5) Application in the diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, C6) in the monitoring of treatment of diseases caused by Clostridium botulinum type B infection.

[0013] The present invention also provides a method for detecting type B Clostridium botulinum, the method comprising the following steps: S1) Obtain genomic DNA of the sample to be tested, S2) using the above composition or reagent or kit to perform real-time fluorescence RPA on the genomic DNA of the sample to be tested, and determining whether the sample to be tested is or contains Clostridium botulinum type B according to the result of the real-time fluorescence RPA.

[0014] The purpose of the above-mentioned applications and methods may be disease diagnosis, disease prognosis and / or disease treatment; or non-disease diagnosis, non-disease prognosis and non-disease treatment. The direct purpose of the above-mentioned applications and methods may be to obtain information on intermediate results of disease diagnosis, disease prognosis and / or disease treatment; or non-disease diagnosis, non-disease prognosis and / or non-disease treatment.

[0015] Furthermore, the sample to be tested may be a microbial culture.

[0016] Furthermore, the sample to be tested may also be soil, ocean sediment, lake sediment, fermented feed or food (such as animal tissue and / or organ used as food).

[0017] Recombinase polymerase amplification (RPA) technology is a technology that uses recombinase and polymerase to amplify specific target DNA fragments at a constant temperature of 37-42°C. It is a preferred amplification technology for on-site diagnosis because of its rapidity, simplicity, and isothermal properties. The present invention designs primers and probes for the botulinum toxin gene type B (BoNT / B) and establishes a real-time fluorescent RPA rapid detection system, providing a new technical support for on-site rapid diagnosis and epidemiological investigation of Clostridium botulinum type B. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Cross-screening of primer pairs for real-time fluorescence RPA of Clostridium botulinum.

[0019] Figure 2 To evaluate the sensitivity of real-time fluorescence RPA detection technology for Clostridium botulinum genomic DNA; Figure 2 A in the middle is a fluorescence amplification curve for sensitivity evaluation, and the figure is a representative set of 4 repeated experiments; Figure 2 Middle B is an independent repeatability test graph, n = 4 independent repeated experiments, t test.

[0020] Figure 3 To evaluate the sensitivity of real-time fluorescence RPA detection technology for Clostridium botulinum positive plasmid pUC57-BoNT / B; Figure 3 A in the middle is a fluorescence amplification curve for sensitivity evaluation, and the figure is a representative set of 3 repeated experiments; Figure 3 Middle B is an independent repeatability test graph, n = 3 independent repeated experiments, t test.

[0021] Figure 4 Evaluation of the specificity of real-time fluorescence RPA detection technology for Clostridium botulinum. n = 4 independent repeated experiments, t-test.

[0022] Figure 5 Simulate clinical sample testing for real-time fluorescence RPA detection technology of Clostridium botulinum. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0024] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0025] The following examples were processed using GraphPad Prism 7.04 statistical software. The experimental results were expressed as mean ± standard deviation and tested using Paired t test. ns indicates no statistical difference, P < 0.05 (*) indicates a statistical difference, P < 0.01 (**) indicates a significant statistical difference, P < 0.001 (***) indicates an extremely significant statistical difference, and P < 0.0001 (****) indicates an extremely significant statistical difference.

[0026] The sources of the reagents and materials involved in the examples are as follows: QIAamp® DNA Mini Kit genomic DNA extraction kit (QIAGEN); Fluorescence RPA amplification kit (TwistAmp TMexo Kit, TwistDx Company); positive reference plasmid, primers and probes (Shanghai Sangon Biotechnology Co., Ltd., Beijing Tianyi Huiyuan Co., Ltd.); nucleic acid rapid amplification detection system (OptiGene, Genie II); Qubit 4.0 nucleic acid concentration meter (Thermo Fisher Scientific, USA).

[0027] Example 1 Selection of Clostridium botulinum target and preparation of positive reference plasmid 1.1 Preparation of genomic template The whole genomic DNA of Clostridium botulinum and other 15 kinds of 1mL heat-inactivated bacterial culture was extracted using the QIAamp® DNA Mini Kit Genomic DNA Extraction Kit (QIAGEN), eluted with 100μL TE buffer, and genomic nucleic acid was quantified using the Qubit4.0 nucleic acid concentration meter for later use. 1.2 Target sequence selection The inventors searched the virulence gene database VFDB to obtain the sequence of the botulinum toxin gene type B (BoNT / B), and performed a BLAST comparison on the core genome in the NCBI nucleic acid database, and selected a conservative specific target sequence (target gene) that can specifically detect Clostridium botulinum type B as sequence 1 (SEQ ID No. 1, 932 bp), which contains a zinc protease conserved domain, as shown below: 5’-TACTTTTGGATATAAACCTGAGGATTTTAATAAAAGTTCCGGTATTTTTAATAGAGATGTTTGTGAATATTATGATCCAGATTACTTAAATACCAATGATAAAAAGAATATATTTTTACAAACAATGATCAAGTTATTTAATAGAATCAAATCAAAACCATTGGGTGAAAAGTTATTAGAGATGATTATAAATGGTATACCTTATCTTGGAGATAGACGTGTTCCACTCGAAGAGTTTAACACAAACATTGCTAGTGTAACTGTTAATAAATTAATTAGTAATCCAGGAGAAGTGGAGCAAAAAAAAGGTATTTTTCGCAAATTTAATAATATTTGGACCTGGGCCAGTTTTAAATGAAAATGAGACTATAGATATAGGTATACAAAATCATTTTGCATCAAGGGAAGGTTTTGGGGGTATAATGCAAATGAAATTTTGTCCAGAATATGTAAGCGTATTTAATAATGTTCAAGAAAACAAAGGCGCAAGTATATTTAATAGACGTGGATATTTTTCAGATCCAGCCTTGATATTAATGCATGAACTTATACATGTTTTGCATGGATTATATGGCATTAAAGTAGATGATTTACCAATTGTACCAAATGAAAAAAAAATTTTTATGCAATCTACAGATACTATACAGGCAGAAGAACTATATACATTTGGAGGACAAGATCCCAGCATCATATCTCCTTCTACAGATAAAAGTATCTATGATAAAGTTTTGCAAAATTTTAGGGGGATAGTTGATAGACTTAACAAGGTTTTAGTTTGCATATCAGATCCTAACATTAACATTAATATATATAAAAATAAATTTAAAGATAAATATAAATTCGTTGAAGATTCTGAAGGAAAATATAGTATAGATGTAGAAAGTTTCAATAAATTATATAAAAGCTTAATGTTTGGTTTTACAGAAACTAAT-3’ (SEQ ID No.1).

[0028] 1.3 Construction of positive reference plasmid A positive reference plasmid pUC57-BoNT / B for the detection target gene of Clostridium botulinum was constructed for the above SEQ ID NO.1 sequence, wherein the cloning vector pUC57 is a commercial vector, and the fragment whose nucleotide sequence is SEQ ID NO. 1 in the sequence list is substituted for the fragment between the restriction endonuclease EcoRI and HindIII recognition sites of the pUC57 vector, and the other nucleotide sequences of the pUC57 vector are kept unchanged, thereby obtaining the positive reference plasmid pUC57-BoNT / B. The plasmid was synthesized by Beijing Tianyi Huiyuan Co., Ltd., and the synthetic plasmid product passed the quality inspection. The concentration of the recombinant positive reference plasmid pUC57-BoNT / B was measured using the Qubit 4.0 nucleic acid quantifier, and the copy number concentration (copies / mL) was calculated. The plasmid with a known copy number concentration was appropriately diluted and used to analyze the sensitivity of the real-time fluorescence RPA detection system.

[0029] Example 2 Design and screening of RPA amplification primers and probes 2.1 Design of RPA amplification primers and probes At present, there is very limited technical tips for RPA primer design. Compared with ordinary PCR, people's research on RPA technology is not thorough enough. RPA technology requires special primer design. The key to RPA analysis lies in the design of amplification primers or probes. Ordinary PCR primers are mostly not suitable for this technology because RPA primers are longer than general PCR primers, usually requiring 30-35 bases. Primers that are too short will reduce the recombination rate, affect the amplification speed and detection sensitivity. When designing RPA primers, it is difficult to meet all the requirements in avoiding the formation of secondary structures, primer-primer interactions, hairpin structure sequences, and reducing primer dimers.

[0030] In this study, we designed four pairs of RPA primers for the Clostridium botulinum-specific target sequence (SEQ ID No. 1) by changing the default parameters of the commonly used primer design software Primer Premier 6 (modifying the parameters such as primer Tm value, length and amplified fragment length accordingly), designed corresponding probes according to the design principle of fluorescence RPA probes, and screened primer pairs by real-time fluorescence RPA. Both primers and probes were synthesized by Shanghai Sangon Biotechnology Co., Ltd., and their sequences and modifications are shown in Table 1.

[0031] Table 1 Amplification primers and probes

[0032] Note: idsp represents the abasic tetrahydrofuran THF residue, i6famdt represents that the nucleotide T at this position is labeled with the fluorescent group 6-FAM (6-carboxyfluorescein), ibhq1dt represents that the nucleotide T at this position is labeled with the quenching group BHQ-1 (BHQ-1 amine), and the 3' end is labeled with C3-spacer (3 CH2) for C3-spacer blocking modification.

[0033] In qPCR-P, [5`JOE] C represents the modified nucleotide obtained by modifying nucleotide C with the fluorescent group JOE, and G [3`BHQ2] represents the modified nucleotide obtained by modifying nucleotide G with the quenching group BHQ2.

[0034] 2.2 Screening of RPA amplification primers The synthesized primers and probes 100 μmol / L stock solution was diluted to 10 μmol / L working solution for later use, and the Clostridium botulinum genomic DNA prepared above was diluted 10-fold to 10aM (1aM=2.5fg / μL) for later use.

[0035] The above-mentioned diluted Clostridium botulinum genomic DNA with a concentration of 10aM was used as template DNA, and deionized water was used as a template as a negative control. BoNT / B-F1 / R1, BoNT / B-F1 / R2, BoNT / B-F1 / R3, BoNT / B-F1 / R4, BoNT / B-F2 / R1, BoNT / B-F2 / R2, BoNT / B-F2 / R3, BoNT / B-F2 / R4, BoNT / B-F3 / R1, BoNT / B-F3 / R2, BoNT / B-F3 / R3, BoNT / B-F3 / R4, BoNT / B-F4 / R1, BoNT / B-F4 / R2, BoNT / B-F4 / R3, and BoNT / B-F4 / R4 were used as RPA primers, and BoNT / B-P was used as a probe to perform 16 combinations of primer cross-screening, and the fluorescent RPA amplification kit TwistAmp was used. TM Real-time fluorescence RPA amplification was performed using exo Kit (TwistDX) (Cat. No.: TAEXO02KIT).

[0036] The RPA amplification reaction system was 50 μL: 2.1 μL of each RPA primer (10 μM) in Table 1, 0.6 μL of the probe BoNT / B-P (10 μM), and TwistAmp TM29.2 μL of the basic buffer in the exo Kit was added to the basic reaction unit and mixed thoroughly. 3 μL of 280 mM magnesium acetate (MgOAc) solution was added to the tube cap, and 13 μL of the template was added and mixed thoroughly. After a brief centrifugation, the tube was quickly placed in the Genie Ⅱ isothermal amplification fluorescence detection system for RPA reaction. Reaction conditions: 39°C, 20 min.

[0037] The fluorescence signal of each group of reactions was collected from the Genie II instrument for 10 minutes, and the data was processed and plotted according to the following method: each group of experimental data was normalized and plotted into an intuitive heat map. By comparing the fluorescence signal under the same template DNA concentration conditions, the color depth in the map corresponds to different normalized values. The darker the color, the closer the normalized value is to 1.00, indicating that the stronger the fluorescence signal of the group, the better the effect. Figure 1 As shown, the primer combination BoNT / B-F3 (SEQ ID No. 4) and BoNT / B-R3 (SEQ ID No. 8) have the highest normalized value, strong fluorescence signal and good effect, and are ideal RPA amplification primers.

[0038] Example 3 Evaluation of sensitivity and specificity of the fluorescent RPA detection method for Clostridium botulinum 3.1 Genomic sensitivity evaluation The screened RPA primers (BoNT / B-F3 and BoNT / B-R3) and probes (BoNT / B-P) were used as primers and probes, and Clostridium botulinum genomic DNA was used as a template. The real-time fluorescence RPA sensitivity evaluation was performed according to the system of Example 2. TM exo Kit Quick Guide Methods for using the Fluorescent RPA Amplification Kit TwistAmp TM Real-time fluorescence RPA was performed using exo Kit (TwistDX) (Cat. No.: TAEXO02KIT). The concentration gradient of Clostridium botulinum genomic DNA solution was set to 4 gradients: 10aM, 5aM, 1aM, and 0.5aM. The sensitivity was evaluated by repeating the experiment 4 times.

[0039] Real-time fluorescence RPA: 2.1 μL each of BoNT / B-F3 solution (10 μM) and BoNT / B-R3 solution (10 μM), 0.6 μL of probe BoNT / B–P solution (10 μM), TwistAmp TM29.2 μL of the basic buffer in the exo Kit was added to the basic reaction unit and mixed thoroughly. 3 μL of 280 mM magnesium acetate (MgOAc) solution was added to the tube cap, and 13 μL of the template (clostridium botulinum genomic DNA solution) was added and mixed thoroughly. After a brief centrifugation, the tube was quickly placed in the Genie Ⅱ isothermal amplification fluorescence detection system for RPA reaction. Reaction conditions: 39°C, 20 min.

[0040] The fluorescence signal of each group was collected from the Genie Ⅱ instrument for 10 minutes of reaction, and the data were processed using GraphPad Prism 7.04 statistical software, and the corresponding fold change graph was made according to the grouping. The experimental results are expressed as mean ± standard deviation, and the paired t test was used for the test. ns indicates no statistical difference, P < 0.05 (*) indicates a statistical difference, P < 0.01 (**) indicates a significant statistical difference, P < 0.001 (***) indicates an extremely significant statistical difference, and P < 0.0001 (****) indicates an extremely significant statistical difference. The results are shown in Figure 2 A in the middle shows a fluorescence signal-time amplification curve of a representative experiment in 4 repeated experiments; Figure 2 The B in the middle shows that the minimum detection limit for genomic DNA is 1aM, and the experimental repeatability is good, indicating that the detection method has high sensitivity and high stability.

[0041] 3.2 Evaluation of positive plasmid sensitivity In order to verify the sensitivity of the real-time fluorescence RPA reaction, we diluted the constructed positive reference plasmid pUC57-BoNT / B by 10 times to a concentration of 15,000 copies / mL (copies / mL), 1,500 copies / mL, 1,000 copies / mL, and 500 copies / mL. The diluted positive reference plasmid pUC57-BoNT / B was used as a template for real-time fluorescence RPA reaction, and deionized water was used as a negative control. BoNT / B-F3 / R3 was used as a primer and BoNT / BP was used as a probe. The reaction system and method were as described in 3.1. The reaction results are shown in Figure 3. Figure 3 Figure A shows the fluorescence signal-time amplification curve of one representative experiment in three repeated experiments. In order to test the stability of sensitivity, we repeated the experiment three times, and the minimum detection limit could reach 1000 copies / mL, and the sensitivity was 13 copies / reaction ( Figure 3 (B).

[0042] 3.3 Genome-specific evaluation To evaluate the specificity of real-time fluorescence RPA detection technology for Clostridium botulinum, Clostridium botulinum type B ( Clostridium botulinum)Type B genomic DNA was used as the positive template DNA (template concentration was 100 fg / μL), and Clostridium botulinum type A ( Clostridium botulinum )Type A genomic DNA (template concentration 100 pg / μL) and 15 non-clostridium botulinum mixed genomic DNAs were used as specific test template DNAs. The 15 non-clostridium botulinum mixed genomic DNAs (referred to as non-clostridium botulinum mixed genomic DNAs) were obtained from Bacillus anthracis ( Bacillus anthraci ), Burkholderia pseudomallei ( Burkholderia pseudomallei ), Burkholderia mallei ( Burkholderia mallei )、Bovine Brucella( Brucella bovis ), Bacillus cereus ( Bacillus cereus ), Bacillus thuringiensis ( Bacillus thuringiensis tularensis ( Francisella tularensis ), Salmonella typhimurium ( Salmonella typhimurium )、Bacillus subtilis( Bacillus subtilis )、Brucella ovis( Brucella melitensis ), Escherichia coli ( Escherichia coli )、Vibrio vulnificus( Vibrio vulnificus ), Staphylococcus aureus ( Staphylococcus aureus ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Staphylococcus epidermidis ( Staphylococcus epidermidis ) was mixed with high concentration (the final concentration of nucleic acid of each bacteria was not less than 100 pg / μL) of purified genomes. Deionized water was used as negative control (NTC), BoNT / B-F3 and BoNT / B-R3 were used as RPA primers, and BoNT / BP was used as probe. Real-time fluorescence RPA was performed according to 3.1.

[0043] The results are as follows Figure 4 As shown in the figure, after three repeated experiments, only the type B Clostridium botulinum DNA was positive, while type A Clostridium botulinum DNA, non-clostridium botulinum mixed genomic DNA and NTC had no amplification signal, indicating that the primer probe and detection method have good specificity ( Figure 4 ).

[0044] Example 4 Preparation of simulated samples and real-time fluorescence RPA detection 4.1 Preparation of simulation samples Blood samples are common samples for clinical and laboratory diagnosis of Clostridium botulinum. In order to verify the practicality of the real-time fluorescence RPA detection method, 100 μL of gradient diluted Clostridium botulinum nucleic acid and the same volume of PBS buffer were added to 100 μL of human whole blood samples to obtain 10% and 20% of Clostridium botulinum content, respectively. 3 —10 0fg / μL whole blood simulated clinical samples and blank control group samples (BC group), a total of 14 groups of blind test samples were randomly numbered.

[0045] 4.2 Real-time fluorescence RPA detection of simulated samples The test personnel extracted genomic DNA from the above 14 groups of simulated human whole blood clinical samples using QIAamp® DNA Mini Kit (QIAGEN). Using the extracted genomic DNA as a template, BoNT / B-F3 and BoNT / B-R3 as RPA primers, and BoNT / B-P as a probe, real-time fluorescence RPA (referred to as fluorescence RPA) was performed according to 3.1 of Example 3. At the same time, the above template DNA was detected using real-time fluorescence PCR detection technology (referred to as real-time fluorescence PCR) using qPCR-F / R as primers and qPCR-P as a probe. The reaction conditions were 95°C pre-denaturation for 2 minutes, followed by 95°C denaturation for 10 seconds and 60°C extension for 30 seconds for a total of 45 cycles, and the two detection results were compared.

[0046] The results are as follows Figure 5 As shown, the detectable concentration of Clostridium botulinum in the simulated human whole blood sample was 10 3 fg / μl (No. 3, 4, 12) and 10 2 fg / μl (No. 2, 9, 10), which is completely consistent with the positive detection results of real-time fluorescence PCR and has comparable sensitivity. There is no cross-reaction with the human whole blood genome (no positive signal in the BC group). The accuracy rate of the results is as high as 100%, indicating that the Clostridium botulinum RPA detection technology established in this study has high sensitivity and strong specificity.

[0047] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of the composition in any of the following A1) to A12): A1) Application in the detection of Clostridium botulinum type B, A2) Use in the preparation of a product for detecting Clostridium botulinum type B, A3) Application in identification or auxiliary identification of Clostridium botulinum type B, A4) Use in the preparation of a product for identifying or assisting in the identification of Clostridium botulinum type B, A5) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, A6) Use in the preparation of a product for identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, A7) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, A8) Use in the preparation of products for screening or assisting in screening of drugs for preventing and treating Clostridium botulinum type B, A9) Application in the diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, A10) Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by Clostridium botulinum type B infection, A11) Application in monitoring treatment of diseases caused by Clostridium botulinum type B infection, A12) Use in the preparation of a product for monitoring the treatment of diseases caused by Clostridium botulinum type B infection; It is characterized in that The composition is a composition for detecting Clostridium botulinum type B, and is composed of a primer pair and a probe, wherein the primer pair is composed of single-stranded DNAs named BoNT / B-F3 and BoNT / B-R3, respectively; the BoNT / B-F3 is a single-stranded DNA molecule whose nucleotide sequence is Sequence 4 in the sequence list; the BoNT / B-R3 is a single-stranded DNA molecule whose nucleotide sequence is Sequence 8 in the sequence list; The probe is a single-stranded molecule named BoNT / BP, and the BoNT / BP is composed of a first single-stranded DNA fragment, a tetrahydrofuran residue, and a second single-stranded DNA fragment connected from the 5' to the 3' end, the nucleotide sequence of the first single-stranded DNA fragment is sequence 10 (TTTGCATGGATTATATGGCATTAAAGTAGAT), the 31st nucleotide of sequence 10 is modified with a fluorescent group, and the 31st nucleotide of sequence 10 is connected to the tetrahydrofuran residue; the nucleotide sequence of the second single-stranded DNA fragment is sequence 11 (ATTTACCAATTGTACCA), the 1st nucleotide of sequence 11 is connected to the tetrahydrofuran residue, the 2nd nucleotide of sequence 11 is modified with a quenching group, and the 17th nucleotide of sequence 11 is modified with a blocking group.

2. A composition, characterized in that The composition is the composition for detecting type B Clostridium botulinum as described in claim 1.

3. A reagent for detecting Clostridium botulinum type B, characterized in that: The reagent contains the composition according to claim 2.

4. A kit for detecting Clostridium botulinum type B, characterized in that: The kit contains the composition according to claim 2 or the reagent according to claim 3.

5. Application of the reagent in any of the following: B1) Application in the detection of Clostridium botulinum type B, B2) Application in identification or auxiliary identification of Clostridium botulinum type B, B3) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, B4) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, B5) Application in diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, B6) Application in monitoring treatment of diseases caused by Clostridium botulinum type B infection; It is characterized in that The reagent is the reagent according to claim 3.

6. Application of the kit in any of the following: C1) Application in the detection of Clostridium botulinum type B, C2) Application in the identification or auxiliary identification of Clostridium botulinum type B, C3) Application in identifying or assisting in identifying whether a sample to be tested is or contains Clostridium botulinum type B, C4) Application in screening or assisting in screening of drugs for prevention and treatment of Clostridium botulinum type B, C5) Application in the diagnosis or auxiliary diagnosis of diseases caused by Clostridium botulinum type B infection, C6) Application in monitoring treatment of diseases caused by Clostridium botulinum type B infection; It is characterized in that The kit is the kit according to claim 4.

7. A method for detecting Clostridium botulinum type B, characterized in that: The method comprises the following steps: S1) Obtain genomic DNA of the sample to be tested, S2) performing real-time fluorescence RPA on the genomic DNA of the sample to be tested using the composition of claim 2, the reagent of claim 3, or the kit of claim 4, and determining whether the sample to be tested is or contains Clostridium botulinum type B based on the result of the real-time fluorescence RPA.

Images