Application of Dixdc1 expression inhibitor in preparation of medicine for treating traumatic brain injury

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a Dixdc1 expression inhibitor in preparation of a medicine for treating traumatic brain injury. The invention discloses that Dixdc1 is a target gene for promoting A1 type astrocytes and inhibiting the transformation of A2 type astrocytes. The shRNA for inhibiting Dixdc1 is transferred into astrocytes, so that polarization of the astrocytes from a proinflammatory A1 type to an anti-inflammatory A2 type in an inflammatory environment is promoted, the anti-inflammatory effect of the astrocytes is enhanced, and damage repair after inflammatory reaction is promoted. The method is helpful for inhibiting or slowing down sustainable development of neuroinflammation after traumatic brain injury, and has important significance for improving prognosis of patients with traumatic brain injury.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a Dixdc1 expression inhibitor in preparing a medicine for treating traumatic brain injury. Background Art

[0002] Traumatic brain injury (TBI) is one of the most common neurological diseases in the world. It is caused by external violent blows to the head, especially the brain, which can lead to impaired consciousness, memory loss and neurological dysfunction. It has a high disability and mortality rate, and a poor prognosis. It can often cause motor, cognitive, and psychological disorders. The pathogenesis of traumatic brain injury is a complex process, including primary injury caused by initial mechanical injury and secondary brain injury caused by long-term molecular, chemical, and inflammatory cascade reactions that lead to neurological deficits. Among them, neuroinflammation is one of the most important pathological manifestations after TBI, and it is also the most critical period for clinical interventional treatment. Inhibiting or slowing down the continued development of neuroinflammation after TBI is of great significance to improving the prognosis of TBI patients.

[0003] Astrocytes have an absolute numerical advantage in the central nervous system and perform almost all the functions of glial cells, including participating in the formation and homeostasis maintenance of the blood-brain barrier, secreting neurotrophic factors to promote neuronal synapse formation, promoting neuronal differentiation and survival, regulating extracellular ion concentrations and neurotransmitters, etc., playing a vital role in responding to neuroinflammation.

[0004] After TBI, damaged neural tissue releases chemokines to recruit immune cells to the injured area. Astrocytes, the most numerous immune cells in the brain, migrate to the site of injury and aggregate and proliferate (ALAM et al., 2020), separating injured tissue from healthy tissue and promoting recovery. Astrocytes change from a resting state to a reactive state after being stimulated by injury, which is manifested by enlarged cell bodies, rich cytoplasm, increased and prolonged synapses, enhanced proliferation, and secretion of inflammatory mediators and neurotrophic factors. However, in addition to supporting, guiding and separating nerve cells, the role of astrocytes in the brain is not entirely beneficial, and they may also damage nerve cells and promote the occurrence of a variety of neurological diseases. Current research has found two different types of reactive astrocytes, type A1 and type A2.

[0005] The activation of astrocytes is heterogeneous and can be divided into type A1 (pro-inflammatory phenotype) and type A2 (anti-inflammatory phenotype). Type A1 is called neurotoxic astrocytes, which directly kill neurons by secreting neurotoxic complement C3, inhibiting the formation of neuronal synapses, inhibiting the phagocytic ability of astrocytes, and secreting neurotoxins to induce neuronal and oligodendrocyte death. In contrast, type A2 is called neuroprotective astrocytes, which promote the expression of neurotrophic factors, promote the survival, growth and differentiation of neurons, promote cell proliferation, and inhibit cell apoptosis. Therefore, it is of great significance to promote the recovery of neurological function through phenotypic changes of astrocytes. At present, the mechanism of astrocyte phenotypic transformation caused by TBI is still unclear, and may involve a variety of substances including miRNA and small molecule proteins, but it has only been reported in scientific research literature. It is unknown whether its actual induction effectiveness in vitro can be used to evaluate the corresponding drug efficacy.

[0006] Dixdc1 (Dishevelled-Axin domain containing 1) is the human homologue of zebrafish Ccd1. It is a protein with two structural domains, Dishevelled-Axin (DIX) and coiled-coil (MTH). It is a positive regulator of the Wnt signaling pathway and plays various functions in cells, including tumor cell proliferation and invasion, participation in the cell cycle, and regulation of neuronal synapses and the cytoskeleton.

[0007] However, whether Dixdc1 is involved in the transformation of astrocyte phenotype remains an unknown area. The phenotypic changes of astrocytes, the loss of neuroprotective function and the acquisition of neurotoxic function are a complex process, which is affected by the stage and severity of neurological diseases. At the same time, the subpopulation division of astrocytes depends largely on the extracellular environment and the type of injury. Therefore, at different stages of the progression of neurological diseases, the phenotype of astrocytes will change accordingly. Therefore, in the research process, there are many technical challenges, such as the difficulty in detecting the polarization of astrocyte phenotypes and the difficulty in confirming the stimulation time of astrocytes.

[0008] References: ALAM A, THELIN EP, TAJSIC T, KHAN DZ, KHELLAF A, PATANI R, HELMYA, 2020. Cellμlar infiltration in traumatic brain injury. Journal of Neuroinflammation, 17(1). DOI: 10.1186 / s12974-020-02005-x. Summary of the invention

[0009] To solve the above problems, the present invention discloses that Dixdc1 is a target gene that promotes the transformation of A1-type astrocytes and inhibits the transformation of A2-type astrocytes. By transferring shRNA that inhibits Dixdc1 into astrocytes, the polarization of astrocytes from pro-inflammatory A1 type to anti-inflammatory A2 type in an inflammatory environment is promoted, the anti-inflammatory effect of astrocytes is enhanced, and the damage repair after the inflammatory reaction is promoted.

[0010] A first aspect of the present invention provides a use of a Dixdc1 expression inhibitor in the preparation of a medicament for treating traumatic brain injury.

[0011] Preferably, the drug for treating traumatic brain injury is a drug that inhibits the transformation of astrocytes to a neurotoxic phenotype after traumatic brain injury.

[0012] Preferably, the drug for treating traumatic brain injury can reduce the pro-inflammatory response triggered by type A1 astrocytes.

[0013] Furthermore, the Dixdc1 expression inhibitor includes at least one of the following:

[0014] Compounds that specifically inhibit Dixdc1 expression;

[0015] Interfering molecules that specifically interfere with the expression of Dixdc1;

[0016] An antibody or ligand that specifically binds to the Dixdc1 protein;

[0017] A Dixdc1 gene knockdown reagent, wherein the Dixdc1 gene knockdown reagent is a gene editing reagent that specifically knocks down Dixdc1.

[0018] Preferably, the Dixdc1 gene knockdown agent comprises an expression vector, wherein the expression vector comprises a DNA coding sequence of a shRNA fragment, and the target gene of the shRNA fragment is the Dixdc1 gene.

[0019] Preferably, the sequence of the shRNA fragment is one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 in the sequence listing.

[0020] More preferably, the sequence of the shRNA fragment is as shown in SEQ ID NO:3.

[0021] Preferably, the expression vector is a plasmid vector or a viral vector.

[0022] The second aspect of the present invention provides a method for constructing a Dixdc1 gene knockdown cell line, comprising the following steps:

[0023] Step 1, designing multiple specific shRNA interference sequences targeting the Dixdc1 gene, wherein the shRNA interference sequence is shown in any one of SEQ ID NOs: 1-4, and synthesizing a plasmid containing the shRNA interference sequence;

[0024] Step 2, mixing the plasmid containing the shRNA interference sequence with PEI;

[0025] Step 3: Mix the liquid obtained in step 2 with the cell line, and obtain a Dixdc1 gene knockdown cell line after screening.

[0026] The third aspect of the present invention provides a Dixdc1 gene knockdown virus-infected cell line method, comprising the following steps:

[0027] Step 1, co-transfecting HEK293T cells with shRNA plasmid, psPAX2 and pMD2.G to prepare recombinant lentiviral particles, and collecting and concentrating the lentiviral particles;

[0028] Step 2: Infect astrocyte cell lines. Use Dixdc1 knockdown lentivirus to infect astrocytes at an MOI of 40.

[0029] Step 3: Obtain Dixdc1 knockdown stable strains through screening.

[0030] Preferably, the cell line is mouse brain astrocyte C8-D1A.

[0031] The fourth aspect of the present invention provides a Dixdc1 gene knockdown stable cell line, wherein the cell line is obtained by any of the methods described above.

[0032] The beneficial effects of the present invention are:

[0033] (1) The present invention discloses that Dixdc1 is a target gene that promotes type A1 astrocytes and inhibits the transformation of type A2 astrocytes. Therefore, the present invention inhibits type A1 astrocytes and promotes the transformation of type A1 astrocytes to type A2 astrocytes by inhibiting the expression of Dixdc1.

[0034] (2) The present invention provides two methods for constructing Dixdc1 knockdown cell lines, namely, plasmid transfection and viral infection.

[0035] (3) The present invention provides four small interfering RNA sequences for inhibiting the expression of Dixdc1, as shown in SEQ ID NO. 1 to 4. Among them, the efficiency of the shRNA sequence shown in SEQ ID NO. 3 infecting astrocytes is more than 90%, which provides a more controllable method for knocking down Dixdc1 and the effect of TBI.

[0036] (4) The present invention promotes the polarization of astrocytes from the pro-inflammatory A1 type to the anti-inflammatory A2 type in an inflammatory environment by transferring shRNA that inhibits Dixdc1 into astrocytes, thereby enhancing the anti-inflammatory effect of astrocytes and promoting the repair of damage after an inflammatory reaction.

[0037] (5) The preparation process of the present invention is simple, the expression is stable, the preparation system is easy to control the quality, and it has good clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The graphs show the expression of the target protein Dixdc1 and the astrocyte activation marker GFAP protein after traumatic brain injury in mice (A) and the statistical results (B, C).

[0039] Figure 2 The protein expression results (A) and statistical results (B, C) of astrocyte polarization markers (C3, S100a10) after traumatic brain injury in mice.

[0040] Figure 3 The co-localization results of the target protein Dixdc1 and astrocytes after traumatic brain injury in mice (A) and the statistical results (B).

[0041] Figure 4 This is an in vitro lipopolysaccharide (LPS)-stimulated astrocyte activation model, with the target protein Dixdc1 and GFAP protein expression results (A) and statistical results (B).

[0042] Figure 5 To screen the Dixdc1 knockdown sequence, the Dixdc1 protein expression result diagram (A) and the Dixdc1 mRNA expression statistical result diagram (B) were shown.

[0043] Figure 6 Figure 2 shows the infection efficiency of Dixdc1 knockdown virus in C8-D1A astrocyte cell line.

[0044] Figure 7 The results of the knockdown intervention of the target protein Dixdc1 and LPS intervention on the protein expression of cell polarization markers (C3, S100a10) in astrocytes (A) and the statistical results (B).

[0045] Figure 8 This is the result of the target protein Dixdc1 knockdown intervention and LPS intervention on the RNA expression levels of cell polarization markers (Serping1, H2.D1, Gbp2, Srgn, S100a10, Clcf1, Emp1) in astrocytes.

[0046] Fig. 9 The graph shows the fluorescence intensity results of target protein Dixdc1 knockdown intervention and LPS intervention on cell polarization markers (C3, S100a10) in astrocytes. DETAILED DESCRIPTION

[0047] The following is a detailed description of an embodiment of the present invention in conjunction with the accompanying drawings: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and process are given, which are intended to be used to explain the present invention, but the implementation does not constitute a limitation to the present invention.

[0048] In this article, the "Dixdc1 gene" mentioned is the full name of Dishevelled-axin domain containing1, which is a gene that encodes the DIXDC1 protein in humans. The DIXDC1 protein refers to a protein with two structural domains, Dishevelled-Axin (DIX) and coiled-coil (MTH), and is a positive regulator of the Wnt signaling pathway. The "small interfering RNA" refers to a small interfering RNA that can inhibit the expression of the Dixdc1 gene. The small interfering RNA shows different degrees of interference with the expression of the Dixdc1 gene, but as long as it inhibits the expression of the Dixdc1 gene, it can be used. PEI is polyethylenimine (Polyethylenimine), a cationic polymer that is widely used in gene transfection, that is, delivering exogenous DNA or RNA into cells.

[0049] As shown in Table 1, the present invention provides four small interfering RNAs that interfere with the expression of the Dixdc1 gene, including small interfering RNA 1 (shRNA 1), small interfering RNA 2 (shRNA 2), small interfering RNA 3 (shRNA 3) and small interfering RNA 4 (shRNA 4). The base sequence of small interfering RNA 1 is shown in SEQ ID NO. 1, the base sequence of small interfering RNA 2 is shown in SEQ ID NO. 2, the base sequence of small interfering RNA 3 is shown in SEQ ID NO. 3, and the base sequence of small interfering RNA 4 is shown in SEQ ID NO. 4.

[0050] Among them, the above four small interfering RNAs can inhibit the expression of Dixdc1 gene.

[0051] Table 1 Base sequence information of small interfering RNA involved in the present invention

[0052]

[0053] Example 1: Expression of Dixdc1 after traumatic brain injury

[0054] A controlled cortical impact (CCI) model of traumatic brain injury was established. Briefly, the mice were randomly divided into 6 groups after a one-week adaptation period. The skull was exposed by separating the muscles and periosteum, and a window (about 4 mm in diameter) was made between the coronal suture and the lambdoid suture, with the medial edge 2 mm from the midline. After the bone flap was removed without damaging the dura mater to expose the brain tissue, the impact device was connected and the parameters were set in advance (piston speed 4.0 m / s, deformation depth 2.0 mm, dwell time 200 ms) so that the tip of the impact rod was perpendicular to the dura mater, and then the mice were given a moderate to severe cortical impact. In the sham operation group, mice underwent the same surgery except for CCI injury, and each animal received a subcutaneous injection of 0.5 ml / 20 g normal saline for postoperative fluid replacement to prevent excessive fluid loss. Afterwards, brain tissues were collected from mice according to the time points set in the experiment (3 hours, 1 day, 3 days, 7 days, and 14 days), and the mice were anesthetized before extraction.

[0055] The expression of Dixdc1 in mouse brain tissue was determined by immunoblotting. The expression results of target protein Dixdc1 and GFAP, a marker of astrocyte activation, are shown in Figure 1 As shown in the figure, compared with the normal cerebral cortex, the protein expression of Dixdc1 increased after injury, and the Dixdc1 protein expression reached a peak 3 hours after injury; the expression of GFAP was high at the beginning of injury, and the activation level of astrocytes gradually returned to normal levels over time. In addition, the protein expression levels of markers of the A1 / A2 phenotype of astrocytes (C3, S100a10) in the mouse cerebral cortex were detected by immunoblotting. The results are shown in Figure 2. Figure 2 It was shown that after TBI, A1 astrocytes showed obvious activation in the early stage of injury, and over time, the expression level decreased, turning into an increase in the expression of A2 astrocytes.

[0056] In order to further observe the localization of Dixdc1 in different cell types after TBI, the present invention uses double immunofluorescence staining with cell-specific markers to identify cell types. Anti-Dixdc1 antibodies were used to perform fluorescent staining on frozen sections of brain tissue of mice in the sham operation group and 3 hours after TBI. Figure 3 The data results showed that compared with the sham operation group, the positive signals of Dixdc1 and GFAP (astrocyte activation marker) increased after TBI; in addition, the positive signal of Dixdc1 overlapped with the positive signal of GFAP, indicating that Dixdc1 may be a potential molecule involved in astrocyte activation after TBI.

[0057] Example 2: Expression of Dixdc1 in astrocytes

[0058] (1) Cell culture medium and culture conditions:

[0059] The complete culture medium formula used for C8-D1A astrocyte cell line: DMEM (4.5 g / L D-Glucose) + 10% fetal bovine serum + 1% penicillin-streptomycin (100 mg / ml). Culture environment: 37° C. constant temperature incubator (containing 5% CO 2 ).

[0060] The complete culture medium formula used for mouse primary astrocytes: DMEM / F12 culture medium (4.5 g / L D-Glucose) + 10% fetal bovine serum + 1% penicillin-streptomycin (100 mg / ml). Culture environment: 37°C constant temperature incubator (containing 5% CO2).

[0061] (2) In vitro neuroinflammation inducers: 1 μg / ml lipopolysaccharide (LPS) was used to stimulate and induce activation of C8-D1A astrocyte line; 100 ng / ml lipopolysaccharide (LPS) was used to stimulate and induce activation of mouse primary astrocytes.

[0062] Since the astrocyte phenotypic polarization phenomenon is difficult to express and detect intuitively in the C8-D1A cell line, the present invention uses primary astrocytes for experiments in RNA extraction to detect the mRNA expression level of astrocyte A1 / A2 phenotype markers and cell immunofluorescence to detect the fluorescence intensity of astrocytes C3 and S100a10.

[0063] The stimulation time was determined based on the expression of the target protein Dixdc1 and the astrocyte activation marker GFAP. Immunoblotting was used to verify the efficiency of lipopolysaccharide stimulation and to conduct cell function experiments. The results of protein expression are shown in Figure 2. Figure 4 As shown, it can be seen that 1 μg / ml LPS stimulation of astrocytes for 24 h can significantly induce increased protein expression of Dixdc1 and GFAP.

[0064] Example 3: Construction and identification of Dixdc1 small interfering fragment

[0065] Small interfering RNA can be roughly divided into siRNA (small interfering RNA) and shRNA (short hairpin RNA). siRNA is a single-stranded RNA interference that prevents protein expression. The decrease in gene expression is shown by external expression, that is, this is an exogenous expression experiment. ShRNA is a virus that integrates into the genome to interfere with genes, so it can achieve long-term gene inhibition effects. In other words, the shRNA interference effect lasts longer, and the product can be used more effectively than siRNA. There are usually two ways for shRNA to inhibit gene expression: through plasmid transfection or viral infection. The present invention also provides methods for constructing these two different expression vectors.

[0066] Establishment of knockdown cell lines:

[0067] According to the Dixdc1 sequence, 4 shRNAs were designed and synthesized (purchased from Shanghai GenePharma, China) to obtain the plasmid vector for knocking down Dixdc1. PEI cell transfection reagent was used to interfere with Dixdc1 in astrocytes. The general experimental steps are as follows: PEI cell transfection reagent, PEI (Dilution Buffer, 20mM CH3COONa, 150mM NaCl, pH = 4.0) and Special Buffer (20mM CH3COONa, 150mM NaCl, ddH2O, pH = 4.0) were prepared in advance. The corresponding shRNA1, shRNA2, shRNA3, shRNA4 and negative control RNA (Control) plasmids and PEI were added to the Special Buffer of two tubes in proportion (plasmid: PEI = 1:3) and allowed to stand for 5 minutes. The liquids in the two tubes were mixed together, and after standing for 20 minutes, a 200μl pipette was used to slowly drip into the culture dish, gently mixed, and placed in the incubator. The culture medium was replaced after 6 hours, and protein and RNA were extracted after 48 hours. Immunoblotting and RT-qPCR were used to verify the knockdown efficiency and perform cell function experiments. The sequences of the above shRNA1, shRNA2, shRNA3, shRNA4 and negative control RNA (Control) are shown in SEQ ID NO.1-5, respectively. The best knockdown sequence was screened by Western Blot detection and lentivirus was prepared.

[0068] Specific steps for preparing Dixdc1 knockdown lentivirus: 1 day before transfection, 2×10 6HEK293T cells were placed in a 10 cm culture dish. The recombinant lentiviral particles were prepared by co-transfection with shRNA plasmid (5 μg), psPAX2 (3.75 μg) and pMD2.G (1.25 μg) for expression in HEK293T packaging cells. The viral particles were collected 48 hours after transfection, and the precipitate was collected by ultracentrifugation at 40,000 g for 1 hour and re-dissolved with 1 ml of complete culture medium to obtain the final Dixdc1 knockdown lentiviral vector successfully constructed and frozen at -80°C for use. Dixdc1 knockdown lentivirus was added to the culture medium to infect astrocytes (mouse brain astrocytes C8-D1A). The experimental steps are as follows: When the cells grow to 5x10 5 80 μl of Dixdc1 knockdown lentivirus was added to each number of astrocytes, and its MOI (multiplicity of infection) was 40. Three days after infection, GFP (green fluorescent protein) positive cells were screened by adding appropriate concentrations of Puromycin to the culture medium to stably transduce Dixdc1 knockdown C8-D1A cell lines. Protein and RNA were extracted for subsequent experiments.

[0069] The results of protein and RNA expression are as follows Figure 5 As shown, it can be seen that compared with the control group, the expression levels of Dixdc1 protein and RNA in the experimental groups transfected with small interfering RNA1 (shRNA1), small interfering RNA2 (shRNA2), small interfering RNA3 (shRNA3) and small interfering RNA4 (shRNA4) were all reduced. From the relative expression levels, it can be clearly seen that the experimental group transfected with small interfering RNA3 has the greatest interference with Dixdc1 protein expression and the best effect. Therefore, in the subsequent examples, shRNA3 is used to interfere with the expression of Dixdc1 gene, wherein the sequence of shRNA3 is as follows: 5'GCAGGACACATCTGTTCTTCA 3'.

[0070] in, Figure 5 The indicated shDixdc1#1 refers to shRNA1, shDixdc1#2 refers to shRNA2, shDixdc1#3 refers to shRNA3, and shDixdc1#4 refers to shRNA4.

[0071] Dixdc1 knockdown lentivirus was used to infect mouse brain astrocytes C8-D1A. The infection efficiency of astrocytes was as shown in Figure 6 As shown, the knockdown sequence contains GFP green fluorescence, and the infected cells show green fluorescence. The results in the figure show that the infection efficiency is >90%. Puromycin is used to kill uninfected cells to obtain a stable Dixdc1 knockdown stable strain.

[0072] Example 4: Cytological experiment to detect the inhibition of neurotoxic astrocyte activation by Dixdc1 small interfering fragment

[0073] According to the experimental scheme of Example 3, the shRNA interference experiment was performed, that is, shRNA3 was used to inhibit the expression of Dixdc1, named Dixdc1-sh. Among them, the experimental groups included NC group (PBS treatment), Dixdc1-sh group (PBS treatment), NC group (LPS treatment) and Dixdc1-sh group (LPS treatment).

[0074] 1. Western blot was used to detect the protein expression levels of cell polarization markers (C3 and S100a10).

[0075] (1) Extraction of total protein: Extraction of cell protein: After the cells are treated to the desired point, discard the culture medium and wash twice with pre-cooled PBS to remove the residual culture medium. Use TBS + 1% TritonX-100 with phosphatase and protease inhibitors to lyse the cell protein, place on a 4°C rotating table to react for 45 minutes, then centrifuge (12000r / min, 20min), and transfer the supernatant to the prepared centrifuge tube for later use.

[0076] (2) Protein concentration determination: There are 9 standard wells, and 2 duplicate wells are made for each sample to reduce experimental errors. The concentration of the target sample is determined according to the operating instructions of the BCA kit. The absorbance value at a wavelength of 562 nm is measured using a full-wavelength microplate reader, and a standard concentration curve is drawn to calculate the final concentration of the protein sample.

[0077] (3) Protein electrophoresis: Mix the reserved sample with 5x SDS-PAGE protein loading buffer at a volume ratio of 4:1, and denature the protein in a 100°C water bath. Place the pre-prepared 7.5% SDS-PAGE gel in the electrophoresis device, add the electrophoresis buffer, add 20 μg of protein into the gel well, and add the protein standard to mark the location of the molecular band. Perform electrophoresis at a constant voltage of 80V to the separation gel. After the standard band appears, perform electrophoresis at a constant voltage of 120V until the protein standard band is completely separated.

[0078] (4) Transfer: Under a constant current of 300 mA, the protein bands on the gel were transferred in parallel to a PVDF membrane soaked in methanol, and then the PVDF membrane was blocked with 5% skim milk prepared in 1× TBST for 2 h.

[0079] (5) Antibody incubation: After blocking, cut out the PVDF membrane strips corresponding to the target protein, and use the primary antibody diluent to prepare antibodies Dixdc1 (Santa Cruz / sc-377160), GFAP (CST / #3670), α-Tubμlin (proteintech / 66031-1-Ig), C3 (proteintech / 21337-1-Ig), and S100a10 (proteintech / 11250-1-AP). The concentration of Dixdc1 primary antibody is 1:500, and the concentration of the other antibodies is 1:1000. The antibodies fully cover the target strips and incubate at 4°C overnight. After overnight incubation with the primary antibody, wash the target strips three times with 1×TBST, each time for 5 minutes. After sufficient washing, incubate with the corresponding secondary antibody prepared in 1×TBST at room temperature for 2 hours, and wash the strips again with 1×TBST three times, each time for 5 minutes.

[0080] (6) Development and analysis: Place the washed PVDF membrane on the development platform of the Bio-Rad gel imager, add an appropriate amount of ECL developer to cover the PVDF membrane for development. Finally, use Image J software to perform grayscale value analysis on the protein blot.

[0081] The results are as follows Figure 7 As shown in the figure, compared with the NC group (PBS treatment), the protein expression of C3 (A1 type astrocyte polarization marker) in the NC group (LPS treatment) was significantly upregulated, and the protein expression of S100a10 (A2 type astrocyte polarization marker) was significantly downregulated, indicating that LPS can significantly induce the expression of A1 type astrocytes. Compared with the NC group (PBS treatment), the protein expression of C3 in the Dixdc1-sh group (PBS treatment) was significantly downregulated, and the protein expression of S100a10 was significantly upregulated. Western blotting experiments proved the ability of the Dixdc1 small interfering fragment to inhibit the activation of A1 astrocytes at the cellular level.

[0082] 2. RT-PCR was used to detect the mRNA expression levels of cell polarization markers (Serping1, H2.D1, Gbp2, Srgn, S100a10, Clcf1, Emp1).

[0083] (1) Cell RNA extraction: After the cells have been treated in each group, the cells are collected at a certain point, the culture medium is discarded, and the cells are washed twice with pre-cooled PBS to wash away the residual culture medium. 1 ml of Trizol is aspirated to blow off the cells thoroughly, and then added to a 1.5 ml enzyme-free EP tube. 200 μl of chloroform is added, and the tube is fully inverted to mix. After standing for 10 minutes, it is placed in a centrifuge at 12000 rpm for 15 minutes. The supernatant is aspirated into a new enzyme-free EP tube, 500 μl of isopropanol is added, and the tube is inverted to mix well. After standing at room temperature for 10 minutes, it is then placed in a centrifuge at 12000 rpm for 15 minutes. At this time, a white precipitate can be seen at the bottom of the tube. The liquid in the tube is aspirated, 75% ethanol (anhydrous ethanol: DEPC water = 3:1) is added, and after being inverted several times, it is placed in a centrifuge at 8000 rpm for 5 minutes. Aspirate all the liquid in the tube, place the EP tube in a 60°C oven to fully dry the liquid in the tube, add 30 μl of DEPC water to each tube, vortex appropriately to fully dissolve the precipitate, and measure the RNA concentration using a spectrophotometer.

[0084] (2) Reverse transcription: prepare RT reaction solution

[0085] After configuring the reaction solution according to the system, reverse transcription reaction was performed under the following conditions:

[0086] Table 2 Configuration of RT reaction solution

[0087]

[0088] PCR amplification program: 37°C for 15 min (reverse transcription reaction); 85°C for 5 sec (reverse transcriptase inactivation reaction); 4°C

[0089] (3) The obtained cDNA was subjected to real-time fluorescence PCR amplification detection in the next step, and the primer sequences are shown in Table 3.

[0090] Table 3 Target gene and primer sequence information

[0091]

[0092]

[0093] Table 4 Configuration of qPCR reaction system (total system is 20 μl)

[0094]

[0095] (4) After the sample addition is completed according to the above system, set the qPCR reaction parameters

[0096] a. Pre-denaturation: 95℃2min

[0097] b. Denaturation: 95℃15sec

[0098] c. Annealing / extension: 60℃15-30sec

[0099] d. Repeat steps b and c for a total of 40 cycles

[0100] e. Melting curve analysis: 95℃15sec, 60℃15sec

[0101] The results are as follows Figure 8 As shown in the figure, compared with the NC group (PBS treatment), the mRNA expression of Serping1, H2.D1, Gbp2, and Srgn (A1 type astrocyte polarization markers) in the NC group (LPS treatment) was significantly upregulated, and the mRNA expression of S100a10, Clcf1, and Emp1 (A2 type astrocyte polarization markers) was significantly downregulated, indicating that LPS can significantly induce the expression of A1 type astrocytes. Compared with the NC group (PBS treatment), the mRNA expression of C3 in the Dixdc1-sh group (PBS treatment) was significantly downregulated, and the mRNA expression of S100a10 was significantly upregulated. That is, the experiment proves the ability of the Dixdc1 small interfering fragment to inhibit the activation of A1 astrocytes at the cellular level.

[0102] 3. Cell immunofluorescence was used to detect the fluorescence intensity levels of cell polarization markers (C3 and S100a10).

[0103] Mouse primary astrocytes transfected with Dixdc1 small interfering RNA were cultured at 1×10 5 Cells / well were plated on a 24-well plate coated with poly-lysine. After stimulating the cells with 1 μg / ml LPS for 24 hours, they were fixed with methanol at 4°C for 15 minutes, and the residual methanol was washed with pre-cooled PBS. Blocking Buffer (PBS + 10% FBS + 0.3% TritonX-100) was used for blocking at room temperature for 2 hours. Then, antibodies were diluted with primary antibody dilution buffer (PBS + 1% FBS + 0.3% TritonX-100), C3 (1:50, Proteintech) and S100a10 (1:50, Proteintech) were incubated at 4°C for 16 hours, and then washed with PBS three times, each time for 5 minutes. The corresponding fluorescent secondary antibody (Thermo Fisher Scientific, 1:1000) was added and incubated at room temperature for 2 hours, and washed with PBS three times, each time for 5 minutes. The fluorescent secondary antibody was discarded, and Hoechest (1:1000) was diluted with PBS and incubated at room temperature for 10 minutes. Finally, the sections were sealed with sealing solution (glycerol: PBS = 1:1) and observed under an inverted fluorescence microscope.

[0104] The results are as follows Fig. 9As shown in the figure, compared with the NC group (PBS treatment), the fluorescence intensity of C3 in the NC group (LPS treatment) increased significantly, and the fluorescence intensity of S100a10 decreased significantly, indicating that LPS can significantly induce A1 astrocytes. Compared with the NC group (PBS treatment), the fluorescence intensity of C3 in the Dixdc1-sh group (PBS treatment) was significantly downregulated, and the fluorescence intensity of S100a10 was significantly upregulated. This experiment proves the ability of the Dixdc1 small interfering fragment to inhibit the activation of A1 astrocytes at the cellular level.

[0105] In summary, the small interfering RNA for inhibiting the expression of the Dixdc1 gene provided in the embodiments of the present invention can inhibit the expression of the Dixdc1 gene by small interfering RNA, thereby inhibiting neurotoxic astrocytes and promoting their transformation into neuroprotective astrocytes, and has good application prospects for the clinical development of targeted drugs for the treatment of neuroinflammation after traumatic brain injury.

[0106] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. Application of Dixdc1 expression inhibitor in the preparation of drugs for treating traumatic brain injury.

2. The use according to claim 1, characterized in that: The drug for treating traumatic brain injury is a drug that inhibits the transformation of astrocytes to a neurotoxic phenotype after traumatic brain injury.

3. The use according to claim 2, characterized in that: The medicine for treating traumatic brain injury is to reduce the pro-inflammatory response caused by astrocyte A1 type.

4. The use according to claim 1, characterized in that: The Dixdc1 expression inhibitor comprises at least one of the following: i) compounds that specifically inhibit the expression of Dixdc1; ii) interfering molecules that specifically interfere with the expression of Dixdc1; iii) an antibody or ligand that specifically binds to the Dixdc1 protein; iv) Dixdc1 gene knockdown reagent, which is a gene editing reagent that specifically knocks down Dixdc1.

5. The use according to claim 4, characterized in that: The Dixdc1 gene knockdown reagent comprises an expression vector, wherein the expression vector comprises a shRNA fragment, and the target gene of the shRNA fragment is the Dixdc1 gene.

6. The use according to claim 5, characterized in that: The sequence of the shRNA fragment is one or more of the sequences shown in the sequence listing SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

7. The use according to claim 5, characterized in that: The expression vector is a plasmid vector or a viral vector.

8. A method for constructing a Dixdc1 gene knockdown cell line, characterized in that: The following steps are involved: Step 1, designing a specific shRNA interference sequence targeting the Dixdc1 gene, wherein the shRNA interference sequence is shown in any one of SEQ ID NOs: 1-4, and synthesizing a plasmid containing the shRNA interference sequence; Step 2, mixing the plasmid containing the shRNA interference sequence with PEI; Step 3: Mix the liquid obtained in step 2 with the cell line, and obtain a Dixdc1 gene knockdown cell line after screening.

9. A method for infecting a cell line with a Dixdc1 gene knockdown virus, characterized in that: The steps include: Step 1, co-transfecting HEK293T cells with shRNA plasmid, psPAX2 and pMD2.G to prepare recombinant lentiviral particles, and collecting and concentrating the lentiviral particles; Step 2: Infect astrocyte cell lines using Dixdc1 knockdown lentivirus to infect astrocytes at an MOI of 35-45; Step 3: Obtain Dixdc1 knockdown stable strains through screening.

10. A Dixdc1 gene knockdown stable cell line, characterized in that: Obtained by the method according to any one of claims 8-9.

Images