Aegilops tauschii detoxification gene resistant to mesosulfuron-methyl and application thereof

Abstract

The invention discloses an aegilops tauschii detoxification gene resistant to mesosulfuron-methyl and application of the aegilops tauschii detoxification gene, and belongs to the technical field of herbicide resistance gene mining, due to LOC109773608, and the CDS sequence of LOC109773608 is shown as SEQ ID NO.1, the invention provides an aegilops tauschii LOC109773608 gene resistant to mesosulfuron-methyl, and belongs to a GSTU gene family, and experimental results show that the gene has the advantages that the gene has the resistance to mesosulfuron-methyl; the expression of the LOC109773608 gene can be used for remarkably reducing the sensitivity of escherichia coli to mesosulfuron-methyl; the aegilops tauschii LOC109773608 gene can be used for researching the mesosulfuron-resistant mechanism of aegilops tauschii, and is a candidate gene for evaluating the chemical prevention and control effect of aegilops tauschii in a region to be prevented and controlled, scientifically designing the medication time and dosage of mesosulfuron, effectively preventing and controlling aegilops tauschii, biologically breeding mesosulfuron-resistant wheat varieties, and ensuring the yield and quality of wheat.

Description

Technical Field

[0001] The invention relates to the technical field of herbicide resistance gene mining, in particular to an Aegilops tauschii detoxification gene resistant to mesosulfuron-methyl and application thereof. Background Art

[0002] Wheat is the second largest grain crop in my country, with its large planting area, high yield and wide distribution. The emergence and greening of wheat field weeds are almost the same as wheat. Their growth process accompanies the entire growth period of wheat, competing with wheat for sunlight, water, fertilizer and living space required for growth, seriously affecting the accumulation of wheat nutrients. In addition, wheat field weeds can also serve as hosts and transmission media for many diseases and insect pests, increasing the incidence and area of ​​wheat diseases and insect pests, and seriously affecting the yield and quality of wheat.

[0003] Aegilops tauschii Coss. is an annual or biennial herb of the genus Aegilops in the tribe Triticeae of the Poaceae family. It is also known as rough goat grass. Its external morphology is extremely similar to wheat, and it is even more difficult to distinguish it from wheat in the seedling stage. In addition, Aegilops tauschii Coss. has a strong tillering ability. When the occurrence density is high, it will cover the wheat, causing a large-scale reduction in wheat yield or even a complete failure. Usually each plant can produce 100-800 seeds per year, and the seed husk is hard and survives for a long time after falling off, allowing its seeds to accumulate in large quantities in the soil. Its seeds will also be mixed with wheat during harvest, reducing the quality of wheat. It has extremely strong adaptability and can germinate and grow in drought, strong acid, and strong alkaline soils. It has great potential for large-scale propagation and diffusion. It is a weed that has an extremely severe impact on global agricultural crop production.

[0004] Chemical weed control is a method of controlling weeds by applying chemical agents, which has the advantages of saving time and labor, etc. However, due to the high affinity between Aegilops tauschii and wheat, it has poor selectivity for general herbicides. Methsulfuron-methyl is the only herbicide on the market that has a relatively ideal control effect on Aegilops tauschii and is relatively safe for wheat. However, the use of metsulfuron-methyl requires high technical requirements, and crop pesticide damage problems occur frequently in production. Due to long-term single use, the control effect of metsulfuron-methyl on Aegilops tauschii has become increasingly poor. It is of great significance to explore and identify non-target resistance-related genes to metsulfuron-methyl in Aegilops tauschii, study the resistance mechanism of Aegilops tauschii to metsulfuron-methyl, evaluate the chemical control effect of Aegilops tauschii in the area to be controlled, reasonably arrange the application period and dosage of metsulfuron-methyl, effectively control Aegilops tauschii, and biological breeding of herbicide-resistant wheat to ensure wheat yield and quality. Summary of the invention

[0005] The purpose of the present invention is to provide a detoxification gene of Agropyron resistant to methyldisulfuron and its application, so as to provide candidate genes for studying the resistance mechanism of Agropyron tauschii to methyldisulfuron, evaluating the chemical control effect of Agropyron tauschii in the area to be controlled, reasonably arranging the application period and dosage of methyldisulfuron, effectively controlling Agropyron tauschii, biological breeding of herbicide-resistant wheat varieties, and ensuring wheat yield and quality.

[0006] To achieve the above object, the present invention provides an Aegilops tauschii detoxification gene resistant to mesosulfuron-methyl. The Aegilops tauschii gene is LOC109773608, and the CDS sequence of LOC109773608 is shown in SEQ ID NO.1.

[0007] Preferably, expression of the gene significantly reduces sensitivity to mesosulfuron-methyl.

[0008] The above-mentioned gene is used for detecting the resistance of Aegilops tauschii to mesosulfuron-methyl.

[0009] The application of the above-mentioned gene in the selection of herbicides and the investigation of dosage for controlling Aegilops tauschii is to detect whether Aegilops tauschii is suitable for control by mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl for control.

[0010] The application of the above gene in wheat herbicide tolerance breeding, wherein the herbicide is mesosulfuron-methyl.

[0011] Therefore, the Aegilops tauschii gene resistant to mesosulfuron-methyl and its application provided by the present invention have the following beneficial effects:

[0012] (1) The present invention provides a gene resistant to mesosulfuron-methyl, namely, the Aegilops tauschii LOC109773608 gene, which belongs to the GSTU gene family. Experimental results show that the expression of the LOC109773608 gene can significantly reduce the sensitivity of Escherichia coli to mesosulfuron-methyl;

[0013] (2) The LOC109773608 gene of the present invention can be used as a candidate gene for studying the mechanism of resistance of A. tauschii to metsulfuron, evaluating the chemical control effect of A. tauschii in the area to be controlled, rationally arranging the application period and dosage of metsulfuron, effectively controlling A. tauschii, and biological breeding of herbicide-resistant wheat varieties, thereby ensuring wheat yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0015] Figure 1 It is the result of comparing the bacterial liquid sequencing results using NCBI in Example 2 of the present invention;

[0016] Figure 2 It is the result of using UGENE 50.0 to align the bacterial liquid sequencing results in the embodiment of the present invention; wherein NCBI is the NCBI registered sequence, BluntSimple and BluntE1 are the sequencing sequences of the empty vector control sequencing result and the positive recombinant vector, respectively, and the sequences after the first 80 bp and 782 bp are the cloning vector and expression vector sequences;

[0017] Figure 3 It is the result of translating the bacterial liquid sequencing result into a protein sequence using UGENE 50.0 alignment in the embodiment of the present invention; wherein NCBI is the NCBI registered sequence, and BluntE1 represents the constructed recombinant vector sequence;

[0018] Figure 4 This is a photo of colonies obtained by applying bacterial liquids of BL21 cells carrying an empty expression vector and BL21 cells carrying a LOC109773608 recombinant expression vector to LB solid medium containing mesosulfuron-methyl and then inverting and culturing for 1.5 days in Example 4 of the present invention;

[0019] Figure 5 It is a sensitivity response curve diagram of BL21 (WT) transformed with an empty expression vector and BL21 transformed with a LOC109773608 recombinant expression vector to mesosulfuron in Example 4 of the present invention;

[0020] Figure 6 The OD values ​​of the single bacterial colonies selected in Example 4 of the present invention and cultured in LB liquid medium containing mesosulfuron for different time periods are 600 Value change curve graph. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0022] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0023] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0024] Embodiment 1

[0025] The specific steps for cloning the Aegilops tauschii LOC109773608 gene are as follows:

[0026] (1) The complete CDS coding region sequence of the Aegilops tauschii LOC109773608 gene was downloaded from the NCBI website. The sequence is shown in SEQ ID NO.1. SnapGene was used to design specific primers (lowercase bases) for the CDS region of the Aegilops tauschii LOC109773608 gene, and the vector homology arm sequence (uppercase bases) for seamless cloning was added. The upstream primer sequence of the LOC109773608 gene is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0027] SEQ ID NO.1:

[0028] ATGGCAGCCAAACCAGACCTGAAGTTGTTGGGCATGTCGGTGAGTCCATTCGTCATCCGTGTTCGCATGGCGCTGCACATGAAGGGCGTGAGCCACGAGTACATCGAGCAGGACCTCTTCAACAAGAGCGAGCTCCTCCTCGAGTCCAGCCCGGTGGAGAAGAAGGTGCCCGTGCTCATCCACGACGGCAAGCCCGTATGCGACTCGCCGGCCATCGTGCAGTACATCGACGAGGTCTGGGCCGCCACGGGGCCGCCGATCCTCCCCGCCGACCCCTATGAGCGTGCCGTCGCTCGTTTCTGGACCGCCTACGTGGACGACAAGCTATTCCCTGCTTACGTTGGCACTGCTAAGGCAGCCACGGAGGAGGAGAGGACGCAACAGATTAACGAGATGTTCGCGGTGATGGGGCAGCTGGAGGAGGCATTTGCCCAGTGCTCAAACGGGAAGGCCTTCTTCGCCGGCGACTCCATCGGCAACCTCGACATCGCCGTTGGATGCAATCTGCTCTTGCTCGAGGTGCTACGCAGTATGTATGGCGTGGAGTTCGTCGACACTGGGAGGACCCCGCTCTTGGCAGCGTGGGCGAAGCGGTTCGGGGAAACCGATGCGGCGAGGGAGGTGGTGCCCGACGTGCACGTCGCCGTGGAGTGCGCCAAGAAGCGTCAGGCTTATTGGGCTGCTGCCGCGGCTACAAAGTGASEQ ID NO.2:GGGACGAGCTCACGGGTACCatggcagccaaaccagacc

[0029] SEQ ID NO.3:TGTAGTCCATTCTAGAtcactttgtagccgcggc

[0030] (2) Total RNA from leaves of the resistant population JJMHN2018-05 of Aegilops tauschii was extracted using the TransZol Up kit. 100 mg of leaf tissue was fully ground under liquid nitrogen conditions, transferred to a 1.5 mL sterile RNase-free centrifuge tube, 1 mL of lysis buffer was added, vortexed and mixed, and allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was added to each 1 mL of lysis buffer, the mixture was vortexed for 15 s, allowed to stand at room temperature for 3 min, and centrifuged at 12000 rpm at 4°C for 15 min. After centrifugation, the sample was separated into three layers. 400 μL of the top aqueous phase was transferred to a new centrifuge tube, an equal volume of isopropanol was added, inverted and mixed, and allowed to stand at room temperature for 30 min. Centrifuged at 12000 rpm at 4°C for 10 min, discarded the supernatant, and 1 mL of 75% ethanol was added to wash the precipitate. Centrifuge at 12000rpm for 5min at 4℃, discard the supernatant, let stand at room temperature for 5min to remove residual ethanol, add 30-50μL Nuclease-free Water to dissolve RNA and store at -80℃. Spectrophotometer detection, RNA concentration using RNA Assay Kit and 2.0 Fluorometer detection, Agilent 2100 Bioanalyzer analysis of RNA integrity. High-quality RNA was selected for subsequent experiments.

[0031] (3) Use One-Step gDNA Removal and cDNA Synthesis SuperMix was used to reverse transcribe the selected high-quality RNA, and the obtained cDNA was used as a template, and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were used as primers. FastPfu DNA Polymerase was used to amplify the full length CDS of the LOC109773608 gene. The reaction system is shown in Table 1, and the amplification program is 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 40 s, 72°C extension for 90 s, 34 cycles; 72°C final extension for 10 min; 4°C storage.

[0032] Table 1

[0033]

[0034]

[0035] (4) The PCR product was subjected to agarose gel electrophoresis, and the results showed that the fragment size was consistent with the expected 702 bp. Quick Gel Extraction Kit was used to recover the target band.

[0036] Embodiment 2

[0037] The recombinant cloning vector containing the LOC109773608 gene was constructed. The specific steps are as follows:

[0038] use Simple Cloning Kit cleaves the target fragment with Simple Cloning Vector cloning vector ligation. 4μL PCR recovery product and 1μL Mix Simple Cloning Vector and incubate in a PCR instrument at 25°C for 15 min. Then add the ligation product to the freshly thawed DH5α cells, place on ice for 30 min, heat shock at 42°C for 30 s, place on ice for 2 min, add 250 μL of room temperature antibiotic-free LB liquid culture medium, and incubate at 37°C with shaking at 200 rpm for 1 h.

[0039] Take 8 μL of 500mmol / L IPTG and 40 μL of 20mg / mL X-gal, mix them and evenly spread them on LB solid medium (containing final concentration of 100mg / L ampicillin) plate, invert and incubate at 37℃ for 30min until the liquid is completely absorbed by the medium. Centrifuge the bacterial solution that has been incubated for 1h at 4000rpm for 1min, retain 100 μL of liquid, pipette and mix the bacteria, evenly spread them on LB plate, and invert and incubate at 37℃ overnight.

[0040] After 24 hours, a single white colony was taken and PCR detection was performed using 2× FlashHot StartMasterMix (Dye) according to the operating instructions. Positive clones were screened and transferred to LB liquid medium containing 100 mg / L ampicillin and cultured at 37°C with shaking at 200 rpm until OD 600 About 0.8. 500 μL of bacterial solution was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing primer is shown in SEQ ID NO.2. The sequencing results were compared and analyzed using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). The results are shown in Figure 1As shown in the figure, compared with the sequence published by NCBI, the similarity is 99.56%. Using UGENE 50.0 for comparison analysis, it was found that there were 3 single-base mutations in the cloned sequence, of which 1 was a nonsense mutation and 2 were sense mutations, which respectively caused the 8th lysine to mutate to glutamine (confirmed by the subsequent sequencing of the LOC109773608 expression vector that the mutation was caused by the primers used for sequencing), the 218th tyrosine to cysteine ​​( Figure 2 , Figure 3 ). This indicated that the recombinant cloning vector containing the LOC109773608 gene was successfully constructed.

[0041] Embodiment 3

[0042] A recombinant expression vector containing the LOC109773608 gene was constructed and transformed into Escherichia coli BL21. The specific steps are as follows:

[0043] The positive bacterial solution containing the recombinant cloning vector in Example 2 was used to extract the plasmid using a plasmid extraction kit to obtain the recombinant cloning vector. The extracted plasmid was used as a template and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were used as primers. FastPfu DNA Polymerase was used to amplify the full length CDS of the LOC109773608 gene, wherein the reaction system and cycling conditions, PCR product electrophoresis, and target fragment recovery were the same as those in Example 1.

[0044] use E1expression Kit will recycle the target fragment and E1expressionVector cloning vector. 4μL PCR recovery product and 1μL E1expression Vector was mixed and incubated in a PCR instrument at 25°C for 15 min. The ligation product was then added to the freshly thawed BL21 competent cells, placed on ice for 30 min, heat-shocked at 42°C for 45 s, placed on ice for 2 min, and 250 μL of room temperature antibiotic-free LB liquid culture medium was added. The cells were shaken and incubated at 37°C for 1 h at 200 rpm.

[0045] Take 8 μL 500mmol / L IPTG and 40 μL 20mg / mL X-gal, mix them and evenly spread them on LB solid medium (containing final concentration of 100mg / L ampicillin) plate, invert and incubate at 37℃ for 30min until the liquid is completely absorbed by the medium. Centrifuge the bacterial solution that has been incubated for 1h at 4000rpm for 1min, retain 100 μL of liquid, pipette and mix the bacteria, evenly spread them on LB plate, and invert and incubate at 37℃ overnight.

[0046] After 24 hours, a single white colony was taken and PCR detection was performed using 2× Flash Hot Start MasterMix (Dye) according to the operating instructions. Positive clones were screened and transferred to LB liquid medium containing 100 mg / L ampicillin and cultured at 37°C with shaking at 200 rpm until OD 600 About 0.8. Take 500 μL of bacterial solution and send it to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were compared and analyzed using UGENE50.0. The results showed that there were two single-base mutations between the recombinant sequence of the expression vector Blunt E1 and the NCBI registered sequence, one of which was a nonsense mutation and the other caused the 218th tyrosine to cysteine ​​mutation ( Figure 2 , Figure 3 ). This indicates that the recombinant expression vector containing the LOC109773608 gene was successfully constructed, and a positive BL21 bacterial solution containing the recombinant expression vector was obtained. The E. coli BL21 transformed with the empty expression vector Blunt E1 was used as a control.

[0047] Embodiment 4

[0048] The sensitivity of E. coli BL21 transgenic with LOC109773608 gene to mesosulfuron was determined as follows:

[0049] (1) The positive BL21 bacterial solution obtained in Example 3 was spread on the surface of LB solid culture medium, and a single colony was picked and inoculated into 1 mL of LB liquid culture medium. The bacterial solution was cultured at 37°C and 200 rpm until the OD 600 =0.6, 30 μL of bacterial solution was evenly spread on solid LB medium (sterilized and supplemented with 100 mg / L ampicillin) containing different concentrations of methyldisulfone (0.005, 0.05, 0.5, 5, 50, 500 μM), and incubated at 37°C for 1.5 days, and the number of colonies and growth status were observed and recorded. E. coli BL21 coated with the expression vector Blunt E1 (empty) was used as a control.

[0050] Colony growth status Figure 4 As shown in Table 2, the BL21 strain with an empty expression vector could not grow normally in a medium containing 0.5 μM methyldisulfone, with only sporadic colonies; while the BL21 strain with the LOC109773608 gene recombinant expression vector could grow normally, with a significantly larger colony number than the BL21 strain with an empty expression vector. The colony number was counted, and the results are shown in Table 2.

[0051] Table 2

[0052]

[0053] Formula 1 was used to calculate the relative growth rate of the strain, and the relative growth rate was plotted as the ordinate and the mesosulfuron treatment dose as the abscissa. The results are shown in Figure 5 As shown, when the concentration of methyldisulfuron in the solid culture medium was ≥0.5 μM, the growth of BL21 Escherichia coli carrying an empty vector was significantly inhibited, while the growth of Escherichia coli carrying the recombinant expression vector of the LOC109773608 gene was not significantly affected.

[0054]

[0055] (2) The positive BL21 bacterial solution obtained in Example 3 was spread on the surface of LB solid culture medium, and a single colony was picked and inoculated into 3 mL of LB liquid culture medium. The bacterial solution was cultured at 37°C and 200 rpm until the OD 600 =0.6, add methyl disulfone solution to 3 mL of bacterial solution to a concentration of 50 μM, and culture at 37°C with shaking at 200 rpm, and record the change in absorbance of the bacterial solution 1, 2, 3, 4, and 5 hours after adding the solution. The culture solution of Escherichia coli BL21 inoculated with the empty expression vector Blunt E1 (empty vector) in Example 3 was used as a control.

[0056] The results are as follows Figure 6 As shown, when the concentration of mesosulfuron was 50 μM, the changes in the OD values ​​of Escherichia coli transfected with the empty expression vector and the LOC109773608 recombinant expression vector were positively correlated with the culture time, and the OD value of Escherichia coli transfected with the LOC109773608 recombinant expression vector was significantly higher than that of other treatments, indicating that the expression of the LOC109773608 gene can significantly reduce the sensitivity of Escherichia coli to mesosulfuron.

[0057] Therefore, the present invention provides a gene that is sensitive to mesosulfuron-methyl resistance, namely, the Agropyron tauschii LOC109773608 gene, which belongs to the GSTU gene family. Experimental results show that the expression of the LOC 109773608 gene can significantly reduce the sensitivity of Escherichia coli to mesosulfuron-methyl; the Agropyron tauschii LOC109773608 gene can be used as a candidate gene for studying the mechanism of Agropyron tauschii resistance to mesosulfuron-methyl, for evaluating the chemical control effect of Agropyron tauschii in areas to be controlled, for scientifically designing the application period and dosage of mesosulfuron-methyl, for effectively controlling Agropyron tauschii, for biological breeding of mesosulfuron-resistant wheat varieties, and for ensuring wheat yield and quality.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A detoxification gene of Aegilops tauschii that is resistant to mesosulfuron-methyl, characterized in that: The Aegilops tauschii gene is LOC109773608, and the CDS sequence of LOC109773608 is shown in SEQ ID NO.

1.

2. The Aegilops tauschii detoxification gene resistant to mesosulfuron-methyl according to claim 1, characterized in that: Expression of the gene significantly reduced sensitivity to mesosulfuron.

3. Use of the gene as claimed in claim 1 in detecting resistance of Aegilops tauschii to mesosulfuron-methyl.

4. The use of the gene as claimed in claim 1 in the selection and dosage of herbicides for controlling Aegilops tauschii, characterized in that: The application is to detect whether Aegilops tauschii is suitable for control by mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl for control.

5. The use of the gene as claimed in claim 1 in wheat herbicide tolerance breeding, characterized in that: The herbicide is mesosulfuron-methyl.

Images