Marker combination for detecting STAT5B gene mutation of large-granular lymphocytic leukemia, PCR amplification reagent, kit and application

Abstract

The invention relates to a marker combination, a PCR (Polymerase Chain Reaction) amplification reagent, a kit and application for detecting STAT5B gene mutation of large-grained lymphocytic leukemia. The gene marker combination comprises at least one of the following mutation sites: p.N642H, p.Y665F and p.T628S. According to the present invention, with the STAT5B gene-based combination, the large-particle lymphocytic leukemia gene mutation gene rapid detection can be achieved, the advantages of high sensitivity, rapidness, simpleness, easy operation and strong coverage are provided, and the clinical sample targeting gene detection can be conveniently and rapidly achieved.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular to a marker combination, PCR amplification reagent, kit and application for detecting STAT5B gene mutation in large granular lymphocytic leukemia. Background Art

[0002] Large granular lymphocytic leukemia (LGLL) is a rare clonal lymphoproliferative disease caused by the synergistic effect of antigen stimulation of the immune system and gene mutations leading to monoclonal proliferation of cytotoxic T cells or NK cells. It accounts for about 2% to 5% of T / NK tumors, and as high as 5% to 6% in Asia. In 2022, the World Health Organization (WHO) divided LGLL into: T-Large Granular Lymphocytic Leukemia (T-LGLL), NK-Large Granular Lymphocytic Leukemia (NK-LGLL) and Aggressive Natural Killer Cell Leukemia (ANKL). Among them, the most common T-LGLL accounts for about 85% of LGLL, NK-LGLL accounts for about 10%, and ANKL is extremely rare, accounting for about 5% of LGLL. It is common in Asia and South America and has a very poor prognosis. T-LGLL and NK-LGLL mostly occur in middle-aged and elderly patients, with a median age of about 60 years old, and rarely occur in people under 30 years old.

[0003] LGLL involves the dysregulation of multiple signaling pathways, including Fas-FasL, Ras-MEK1-ERK, PI3K-Akt, IL-15, JAK-STAT, NF-κB, etc., among which the abnormal activation of the JAK-STAT pathway plays an important role in the occurrence and development of T-LGLL. Detecting large granular lymphocytic leukemia-related gene mutations through signaling pathways is of great significance for clinical diagnosis and treatment.

[0004] Previous studies often used PCR-based Sanger sequencing, second-generation sequencing, qPCR, AS-PCR, etc. The PCR-based Sanger sequencing method has low throughput and low sensitivity, and cannot detect low-frequency mutations; although the second-generation sequencing has high throughput, it takes a long time to detect and has high sequencing costs and is difficult to popularize; the fluorescent quantitative PCR can only design primers and probes for site-specific mutations, which may cause interference with fluorescent signals in the case of multiple probes; AS-PCR detection is based on the complementarity of primers with wild-type and mutant bases at the mutation site, which is simple to operate and relatively low in cost, but it only detects up to 1% of mutations, has low throughput, and is not suitable for SNP typing detection with too high or too low GC content near the mutation site, and there is a possibility of false negative results.

[0005] STAT5B mutations in CD4 null + T-LGLL accounts for a high proportion (about 30% of cases); + T-LGLL is associated with a poor prognosis, but has no significant effect on CD4 + There is no impact on the prognosis of T-LGLL and γ / δT-LGLL. In NK-LGLL, the incidence of STAT3 mutations varies from 13% to 70%, whereas STAT5B mutations are rarely detected (<2%).

[0006] In view of the above, it is necessary to explore a detection method that is highly sensitive, rapid, simple, easy to operate, and has strong coverage for STAT5B targeted gene detection in clinical samples. Summary of the invention

[0007] In view of the above, it is necessary to explore a marker combination, PCR amplification reagent, kit and application for detecting STAT5B gene mutation in large granular lymphocytic leukemia with high sensitivity, rapidity, simplicity, ease of operation and strong coverage, which can be used for STAT5B targeted gene detection in clinical samples.

[0008] In a first aspect, the present application also provides a gene marker combination for detecting STAT5B gene mutation in large granular lymphocytic leukemia, comprising at least one of the following mutation sites: p.N642H, p.Y665F, p.T628S.

[0009] In particular, STAT5B mutations are highly prevalent in rare CD4+T-LGLL (approximately 30% of cases); they are associated with a poor prognosis in CD8+T-LGLL, but have no effect on the prognosis of CD4+T-LGLL and γ / δT-LGLL. In NK-LGLL, the incidence of STAT3 mutations ranges from 13% to 70%, whereas STAT5B mutations are rarely detected (<2%). STAT3 mutations are mainly found in CD8+T-LGLL. +In T-LGLL and gamma / delta T-LGLL, the incidence varies from 20% to 70% in different series (approximately 40% on average) and is associated with neutropenia and poor overall survival. + STAT3 mutations were not detected in the T-LGLL subgroup, with only a few exceptions, which are more often associated with secondary tumors, such as monoclonal B-cell lymphocytosis and plasma cell diseases. Therefore, based on the gene marker combination of the present application, the corresponding mutation site detection can be performed on the STAT5B gene alone.

[0010] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.N642H site of the STAT5B gene is shown in SEQ ID NO.9, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.10, and the nucleotide sequence of the probe is shown in SEQ ID NO.23;

[0011] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.Y665F site of the STAT5B gene is shown in SEQ ID NO.11, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.12, and the nucleotide sequence of the probe is shown in SEQ ID NO.24;

[0012] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.T628S site of the STAT5B gene is shown as SEQ ID NO.13, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.14, and the nucleotide sequence of the probe is shown as SEQ ID NO.25.

[0013] In a second aspect, the present application also provides a PCR amplification reagent for detecting large granular lymphocytic leukemia gene mutations, comprising a forward primer, a reverse primer and a probe for detecting the gene marker combination in any of the above embodiments.

[0014] In one embodiment, the PCR amplification reagent also includes a restriction endonuclease.

[0015] In one embodiment, the PCR amplification reagent also includes a gene marker combination for detecting STAT3 gene mutations in large granular lymphocytic leukemia, and the STAT3 gene includes at least one of the following mutation sites: p.Y640F, p.D661Y, p.D661V, p.S614R, p.G618R, p.N647I.

[0016] In one embodiment, the 5' end of each probe is connected to a fluorescent group, and the 3' end is connected to a fluorescent quenching group; the fluorescent group is FAM, HEX or CY5;

[0017] Among them, the fluorescent group of p.N642H is FAM;

[0018] The fluorescent group of p.Y665F and p.T628S is HEX.

[0019] In a third aspect, the present application provides a kit for detecting large granular lymphocytic leukemia gene mutations, comprising the PCR amplification reagent as described in any of the above embodiments.

[0020] In one embodiment, the kit further contains a negative control and a positive control, the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard. Preferably, the sample targeted by the kit is selected from plasma specimens, bone marrow specimens or paraffin specimens. Preferably, the PCR is an asymmetric PCR method; preferably, the kit also includes PerfeCTa Multiplex ToughMix digital PCR premix and fluorescein sodium salt, the premix includes dNTPs, Taq enzyme and PCR buffer. Preferably, the kit also contains restriction endonucleases.

[0021] Use of the gene marker combination in any of the above embodiments, the PCR amplification reagent in any of the above embodiments, or the kit in any of the above embodiments in detecting large granular lymphocytic leukemia gene mutations.

[0022] In a fourth aspect, the present application also provides a method for detecting large granular lymphocytic leukemia gene mutations for non-disease diagnosis purposes, comprising the following steps:

[0023] Collecting an in vitro sample to be tested, and extracting the DNA to be tested as a sample to be tested;

[0024] The sample to be tested is used as a template, and a PCR amplification reagent as in any of the above embodiments or a kit as in any of the above embodiments is used to perform droplet digital PCR detection.

[0025] In one embodiment, multiple mutation sites are detected by a single PCR reaction. In other words, the primers and probes for each mutation site provided in the present application can detect single, double, and multiple mutation sites by a single PCR reaction.

[0026] The above-mentioned gene marker combination for detecting STAT5B gene mutation in large granular lymphocytic leukemia can realize the rapid detection of genes with STAT5B gene mutation in large granular lymphocytic leukemia, and has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, which facilitates the rapid realization of targeted gene detection of clinical samples.

[0027] The primers and probes used in the present invention are all designed by ourselves. Through comprehensive analysis of LGLL-related gene mutation site information, multiple primers and probes are designed. Through primer-probe combination screening, the primer-probe sequence finally selected can improve the accuracy and sensitivity of monitoring.

[0028] The present invention effectively improves the "rain curtain" problem of clinical sample detection by adding restriction endonucleases into the system.

[0029] The present invention develops a highly sensitive detection kit capable of simultaneously detecting 11 mutation types of two genes, STAT3 and STAT5B, through experiments such as primer probe design, adjustment of primer probe concentration, screening of dPCR amplification enzyme, and addition of restriction endonucleases. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a 1D diagram of FAM channel fluorescence signal detection in a specific embodiment;

[0031] Figure 2 It is a 1D diagram of HEX channel fluorescence signal detection in a specific embodiment;

[0032] Figure 3 This is a 1D diagram of fluorescence signal detection of CY5 channel in a specific embodiment;

[0033] Figure 4 It is a 1D diagram of fluorescence signal detection in CY5 channel at different probe concentrations at the same mutation site in a specific embodiment;

[0034] Figure 5 It is a 1D diagram of fluorescence signal detection in FAM channel of different dPCR enzymes compared in a specific embodiment; Figure 6 It is a 2D diagram of fluorescence signal detection of low fluorescence intensity mutation of CY5 channel in a specific embodiment;

[0035] Figure 7 It is a 2D image of high fluorescence intensity fluorescence signal detection of CY5 channel in a specific embodiment;

[0036] Figure 8 It is a 2D diagram of fluorescence signal detection of two mutations in CY5 channel in a specific embodiment;

[0037] Fig. 9 A 2D graph of fluorescence signal detection of restriction endonuclease digestion is added to about 40% of clinical samples in a specific embodiment;

[0038] Fig.10 A 2D graph of fluorescence signal detection of restriction endonuclease digestion is added to about 10% of clinical samples in a specific embodiment;

[0039] Fig.11It is a 2D graph of fluorescence signal detection of about 40% clinical samples without adding restriction endonuclease digestion in a specific embodiment;

[0040] Fig.12 It is a 2D graph of fluorescence signal detection of about 10% clinical samples without adding restriction endonuclease digestion in a specific embodiment;

[0041] Fig.13 This is a 2D diagram of the fluorescence signal detection of the Y640F and N642H sites in the FAM channel of the kit;

[0042] Fig.14 This is the 2D diagram of the fluorescence signal detection of the D661Y / V, Y665F, and T628S sites in the HEX channel of the kit;

[0043] Fig.15 This is a 2D diagram of the fluorescence signal detection of the S614R, G618R, and N647I sites in the CY5 channel of the kit. DETAILED DESCRIPTION

[0044] In order to facilitate the understanding of the present application, in order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth so as to fully understand the present application, and the preferred embodiments of the present application are given in the accompanying drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thoroughly understood. The present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited to the specific embodiments disclosed below. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art belonging to the technical field of the present application. The terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.

[0045] In a first aspect, the present application provides a gene marker combination for detecting gene mutations in large granular lymphocytic leukemia, comprising the following genes: STAT3 gene and STAT5B gene.

[0046] In the present application, rapid detection of genes with large granular lymphocytic leukemia gene mutations can be achieved by adopting a combination of STAT3 gene and STAT5B gene, which has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, and is convenient for rapid realization of targeted gene detection of clinical samples.

[0047] The applicant needs to explain that among large granular lymphocytic leukemia (LGLL), the most common T-LGLL accounts for about 85% of LGLL, NK-LGLL accounts for about 10%, and ANKL is extremely rare, accounting for about 5% of LGLL. It is common in Asia and South America and has a very poor prognosis. T-LGLL and NK-LGLL mostly occur in middle-aged and elderly patients, with a median age of about 60 years old, and rarely occur in people under 30 years old. LGLL involves the dysregulation of multiple signaling pathways, including Fas-FasL, Ras-MEK1-ERK, PI3K-Akt, IL-15, JAK-STAT, NF-κB, etc., among which the abnormal activation of the JAK-STAT pathway plays an important role in the occurrence and development of T-LGLL. Point mutations in the signal transducer and activator of transcription (STAT) 3 gene are the most common genetic abnormalities. 40% of LGLL patients have mutations in the Src homology 2 (SH2) domain of STAT3. In addition, studies have shown that exome sequencing of LGL leukemia patients who are negative for STAT3 mutations found STAT5B mutations. The mutation of the STAT5B gene in LLGL is similar to that of STAT3. The STAT5B mutation is also located in the SH2 domain, which increases the transcriptional activity and phosphorylation of the mutant protein.

[0048] Therefore, the present application incorporates the abnormal characteristics of STAT3 and STAT5B molecules into the diagnostic criteria or prognostic markers of LGLL, so as to achieve rapid detection of gene mutations in large granular lymphocytic leukemia.

[0049] Moreover, STAT3 and STAT5B mutations present different distribution characteristics in LGLL patients and clonal T / NK cell populations: among phenotypically different T-LGLL, STAT3 mutations are mainly found in CD8+T-LGLL and γ / δT-LGLL, with an incidence ranging from 20% to 70% in different case series (about 40% on average), and are associated with neutropenia and poor overall survival. STAT3 mutations have not been detected in the CD4+T-LGLL subset, with only rare exceptions, which are more often associated with secondary tumors such as monoclonal B-cell lymphocytosis and plasma cell disorders. STAT5B mutations account for a high proportion of rare CD4+T-LGLL (about 30% of cases); they are associated with a poor prognosis in CD8+T-LGLL, but have no effect on the prognosis of CD4+T-LGLL and γ / δT-LGLL. In NK-LGLL, the incidence of STAT3 mutations varies from 13% to 70% of cases, in contrast, STAT5B mutations are rarely detected (<2%). In ANKL, both STAT3 and STAT5B mutations are associated with poor prognosis. There are various types of STAT3 gene mutations, among which Y640F, D661Y and D661V are the most common STAT3 gene mutations, accounting for about 2 / 3; while the most common mutations of STAT5B gene are N642H and Y665F, both of which are located in the SH2 domain. Other activation abnormalities, although much less frequent, include point mutations and insertions or deletions, which are usually found in the SH2 region.

[0050] Therefore, in the present application, in order to realize the large granular lymphocytic leukemia gene mutation, the combination of STAT3 gene and STAT5B gene can be used to realize the rapid detection of genes with large granular lymphocytic leukemia gene mutation, which has the advantages of high sensitivity, rapidity, simplicity, easy operation and strong coverage, and is convenient for rapid realization of targeted gene detection of clinical samples.

[0051] In one embodiment, the STAT3 gene includes at least one of the following mutation sites: p.Y640F, p.D661Y, p.D661V, p.S614R, p.G618R, p.N647I. For example, the STAT5B gene includes at least one of the following mutation sites: p.N642H, p.Y665F, p.T628S. Thus, by using the detection based on the above mutation sites, it is possible to quickly detect the gene with large granular lymphocytic leukemia gene mutation. For example, the mutation sites of the STAT3 gene and the STAT5B gene are shown in Table 1:

[0052] Table 1 Mutation sites of STAT3 gene and STAT5B gene

[0053] Gene name Mutation site information Base changes Cosmic ID STAT3 p.Y640F c.1919A>T 1155743 STAT3 p.D661Y c.1981G>T 1155739 STAT3 p.D661V c.1982A>T 1155730 STAT3 p.S614R c.1840A>C 4066548 STAT3 p.S614R c.1842C>A 5706398 STAT3 p.S614R c.1842C>G 220210 STAT3 p.G618R c.1852G>C 1166777 STAT3 p.N647I c.1940A>T 1155744 STAT5B p.N642H c.1924A>C 1716590 STAT5B p.Y665F c.1994A>T 1716592 STAT5B p.T628S c.1882A>T 10184319

[0054] It should be noted that the above Cosmic ID is the ID number in the COSMIC database. For example, among the three mutation sites of p.S614R of the STAT3 gene, the base change c.1840A>C is used as S614R-P1, the base change c.1842C>A is used as S614R-P2, and the base change c.1842C>G is used as S614R-P3. In this way, by using the STAT3 gene and STAT5B gene of the above mutation sites for marker detection, it has the advantages of simple operation, small number of markers, and can realize rapid detection. It has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, which is convenient for rapid realization of targeted gene detection of clinical samples.

[0055] In one embodiment, the fluorescent labeling and reaction of each mutation site of STAT3 gene and STAT5B gene are as follows:

[0056] Table 2 Fluorescence labeling of mutation sites of STAT3 gene and STAT5B gene

[0057]

[0058] That is, when the above mutation sites were fluorescently labeled, the fluorescent groups of p.Y640F and p.N642H were FAM;

[0059] The fluorescent group of p.D661Y, p.D661V, p.Y665F, and p.T628S is HEX;

[0060] The fluorescent group of p.S614R, p.G618R, and p.N647I is CY5.

[0061] In one embodiment, the plasmid sequences synthesized for the STAT3 and STAT5B gene mutation sites are as follows:

[0062] >Y640F mutation sequence:

[0063] TTCTGGGTCTGGCTGGACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATCATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATTCACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGT

[0064] >D661Y mutant sequence:

[0065] AAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGTATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAAT

[0066] >D661V mutant sequence:

[0067] AAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGTTGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAAT

[0068] >S614R-P1 mutant sequence:

[0069] GGGTGTCAGATCACATGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTGGACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATCATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCCGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAG

[0070] >S614R-P2 mutant sequence:

[0071] GGGTGTCAGATCACATGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTGGACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATCATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGAAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAG

[0072] >S614R - P3 mutant sequence:

[0073] GGGTGTCAGATCACATGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTGGACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATCATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGGAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAG

[0074] >N642H mutant sequence:

[0075] GGCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGCCAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCATTGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGCATCTGATGCCTTTTACCACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACCTTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACACACCAGTTCCCTGCGAGTCTGCTACTG

[0076] >Y665F mutant sequence:

[0077] CAACAGGCCCATGACCTACTCATTAACAAGCCAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCATTGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACCACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTTCCTTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACACACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTGAAGCCACAGATCAAGCAAGTGGTCCCTGAGTTTGTGAACGCATCTGCAGATGCCGGGGGCGGCAGCGCCACGTACATGGACCAGGCCCCCTCCCCAGCTGTGTGTCCCCAGGCTCACTAT

[0078] >T628S mutant sequence:

[0079] GAGAATTTACCAGGACGGAATTACACTTTCTGGCAATGGTTTGACGGTGTGATGGAAGTGTTAAAAAAACATCTCAAGCCTCATTGGAATGATGGGGCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGCCAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCTCCATTGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACCACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACCTTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACACACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTG

[0080] >G618R mutant sequence:

[0081] GGGTGTCAGATCACATGGGCTAAATTTTGCAAAGAAAACATGGCTGGCAAGGGCTTCTCCTTCTGGGTCTGGCTGGACAATATCATTGACCTTGTGAAAAAGTACATCCTGGCCCTTTGGAACGAAGGGTACATCATGGGCTTTATCAGTAAGGAGCGGGAGCGGGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGACGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAG

[0082] >N647I mutant sequence:

[0083] AAGCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACATCATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTG GTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAAT

[0084] In order to better achieve the design of primers and probes for the above mutation sites, specific primers and probes were designed for the mutation gene sites of STAT3 and STAT5B. The nucleotide sequences of the specific primers and probes are shown in Table 3:

[0085] Table 3 Design of specific primers and probe sequences for each gene mutation site

[0086] sequence name Nucleotide sequence serial number STAT3-Y640F-F CAGGTAAGACCCAGATC SEQ ID NO.1 STAT3-Y640F-R TCAGCAAATGACATGTTG SEQ ID NO.2 STAT3-D661Y / VF GCTGAAATCATCATGGG SEQ ID NO.3 STAT3-D661Y / VR AGACCAGTGGAGACAC SEQ ID NO.4 STAT3-S614R / G618R-F CCTTCCTGCTAAGATTCA SEQ ID NO.5 STAT3-S614R / G618R-R CTCCACCCAAGTGAAAG SEQ ID NO.6 STAT3-N647I-F GTGGAACCATACACAAAG SEQ ID NO.7 STAT3-N647I-R TAGCCCATGATGATTTCA SEQ ID NO.8 STAT5B-N642H-F TGAATTAGGAAATCTTAAAACC SEQ ID NO.9 STAT5B-N642H-R CACCAGAGACTTCTCC SEQ ID NO.10 STAT5B-Y665F-F GAATGGAGAAGTCTCTGG SEQ ID NO.11 STAT5B-Y665F-R CAAAAGATGAAGTATACTCCA SEQ ID NO.12 STAT5B-T628S-F CTGAGATTCAGTGACTCA SEQ ID NO.13 STAT5B-T628S-R CACTCACGAGAATCAAAC SEQ ID NO.14 STAT3-Y640F-P TGGAACCATTCACAAAG SEQ ID NO.15 STAT3-D661Y-P AGATCATGTATGCTACC SEQ ID NO.16 STAT3-D661V-P AGATCATGGTTGCTACC SEQ ID NO.17 STAT3-S614R-P1 TGAAAGCCGCAAAG SEQ ID NO.18 STAT3-S614R-P2 TGAAAGCAGGAAAGA SEQ ID NO.19 STAT3-S614R-P3 TGAAAGCAGAAAAGA SEQ ID NO.20 STAT3-G618R-P TGACGCGTCCTTC SEQ ID NO.21 STAT3-N647I-P CTGAACATCATGTCA SEQ ID NO.22 STAT5B-N642H-P CATCAGATGCCAAAACA SEQ ID NO.23 STAT5B-Y665F-P CGTAGATAAGGAAATTC SEQ ID NO.24 STAT5B-T628S-P AGCAATGGAGATGC SEQ ID NO.25

[0087] Wherein STAT3-Y640F-F is the forward primer sequence of the Y640F site of the STAT3 gene, STAT3-Y640F-R is the reverse primer sequence of the Y640F site of the STAT3 gene, STAT3-Y640F-P is the probe sequence corresponding to the Y640F site of the STAT3 gene, and the others are analogous. The middle column of the above Table 3 is the corresponding nucleotide sequence. The last SEQ ID NO.1 is the sequence ranked 1 in the sequence list, and this ranking is only for the convenience of distinction and reference.

[0088] In this embodiment, the STAT3 gene Y640F primer-probe combination includes: a STAT3 gene Y640F mutant forward primer, a STAT3 gene Y640F mutant reverse primer, and a STAT3 gene Y640F mutant probe;

[0089] The STAT3 gene D661Y / V primer-probe combination includes: a STAT3 gene D661Y / V mutant forward primer, a STAT3 gene D661Y / V mutant reverse primer, a STAT3 gene D661Y mutant probe, and a STAT3 gene D661V mutant probe;

[0090] The STAT3 gene S614R primer probe combination includes: a STAT3 gene S614R / G618R mutant forward primer, a STAT3 gene S614R / G618R mutant reverse primer, and a STAT3 gene S614R mutant probe;

[0091] The STAT5B gene N642H primer-probe combination includes: a STAT5B gene N642H mutant forward primer, a STAT5B gene N642H mutant reverse primer, and a STAT5B gene N642H mutant probe;

[0092] The STAT5B gene Y665F primer-probe combination includes: a STAT5B gene Y665F mutant forward primer, a STAT5B gene Y665F mutant reverse primer, and a STAT5B gene Y665F mutant probe;

[0093] The STAT5B gene T628S primer-probe combination includes: a STAT5B gene T628S mutant forward primer, a STAT5B gene T628S mutant reverse primer, and a STAT5B gene T628S mutant probe;

[0094] The STAT3 gene G618R primer probe combination includes: a STAT3 gene S614R / G618R mutant forward primer, a STAT3 gene S614R / G618R mutant reverse primer, and a STAT3 gene G618R mutant probe;

[0095] The STAT3 gene N647I primer-probe combination includes: a STAT3 gene N647I mutant forward primer, a STAT3 gene N647I mutant reverse primer, and a STAT3 gene N647I mutant probe.

[0096] Based on the above gene marker combination, the primers and probes provided in this application can be well used for the detection of corresponding gene markers. By adopting a combination based on the STAT3 gene and the STAT5B gene, rapid detection of genes with large granular lymphocytic leukemia gene mutations can be achieved. It has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, and is convenient for rapid realization of targeted gene detection of clinical samples.

[0097] In a second aspect, the present application also provides a PCR amplification reagent for detecting large granular lymphocytic leukemia gene mutations, comprising a forward primer, a reverse primer and a probe for detecting the gene marker combination in any of the above embodiments.

[0098] In one embodiment, the STAT3 gene includes at least one of the following mutation sites: p.Y640F, p.D661Y, p.D661V, p.S614R, p.G618R, p.N647I;

[0099] In one embodiment, the STAT5B gene includes at least one of the following mutation sites: p.N642H, p.Y665F, p.T628S.

[0100] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.Y640F site of the STAT3 gene is shown as SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2, and the nucleotide sequence of the probe is shown as SEQ ID NO.15; see Table 3 for details.

[0101] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.D661Y site of the STAT3 gene is shown in SEQ ID NO.3, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4, and the nucleotide sequence of the probe is shown in SEQ ID NO.16;

[0102] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.D661V site of the STAT3 gene is shown in SEQ ID NO.3, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4, and the nucleotide sequence of the probe is shown in SEQ ID NO.17;

[0103] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.S614R site of the STAT3 gene is shown as SEQ ID NO.5, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.6, wherein the p.S614R site includes S614R-P1, S614R-P2, and S614R-P3, respectively, wherein the nucleotide sequence of the probe corresponding to S614R-P1 is shown as SEQ ID NO.18; the nucleotide sequence of the probe corresponding to S614R-P2 is shown as SEQ ID NO.19, and the nucleotide sequence of the probe corresponding to S614R-P3 is shown as SEQ ID NO.20; but the nucleotide sequences of the forward primers of S614R-P1, S614R-P2, and S614R-P3 are all shown as SEQ ID NO.5, and the nucleotide sequences of the reverse primers are all shown as SEQ ID NO.6.

[0104] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.G618R site of the STAT3 gene is shown as SEQ ID NO.5, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.6, and the nucleotide sequence of the probe is shown as SEQ ID NO.21;

[0105] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.N647I site of the STAT3 gene is shown as SEQ ID NO.7, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.8, and the nucleotide sequence of the probe is shown as SEQ ID NO.22;

[0106] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.N642H site of the STAT5B gene is shown in SEQ ID NO.9, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.10, and the nucleotide sequence of the probe is shown in SEQ ID NO.23;

[0107] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.Y665F site of the STAT5B gene is shown in SEQ ID NO.11, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.12, and the nucleotide sequence of the probe is shown in SEQ ID NO.24;

[0108] In one embodiment, the nucleotide sequence of the forward primer for detecting the p.T628S site of the STAT5B gene is shown as SEQ ID NO.13, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.14, and the nucleotide sequence of the probe is shown as SEQ ID NO.25.

[0109] In one embodiment, the 5' end of each probe is connected to a fluorescent group, and the 3' end is connected to a fluorescent quenching group; the fluorescent group is FAM, HEX or CY5;

[0110] Among them, the fluorescent group of p.Y640F and p.N642H is FAM;

[0111] The fluorescent group of p.D661Y, p.D661V, p.Y665F, and p.T628S is HEX;

[0112] The fluorescent group of p.S614R, p.G618R, and p.N647I is CY5.

[0113] Thus, using the above fluorescent groups for labeling can better perform fluorescent labeling and detection.

[0114] The above-mentioned PCR amplification reagent can realize rapid detection of genes with large granular lymphocytic leukemia gene mutations by adopting a combination based on the STAT3 gene and the STAT5B gene, and has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, which is convenient for rapid realization of targeted gene detection of clinical samples. Moreover, the primers and probes used in this application are all designed by themselves. By comprehensively analyzing the information of LGLL-related gene mutation sites, multiple primers and probes are designed. Through primer-probe combination screening, the primer-probe sequence finally selected can improve the accuracy and sensitivity of monitoring.

[0115] In a third aspect, the present application provides a kit for detecting large granular lymphocytic leukemia gene mutations, comprising the PCR amplification reagent as described in any of the above embodiments.

[0116] In one embodiment, the kit further comprises a negative control and a positive control, the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard. Preferably, the sample targeted by the kit is selected from plasma specimens, bone marrow specimens or paraffin specimens. Preferably, the PCR is an asymmetric PCR method; preferably, the kit further comprises PerfeCTa Multiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix comprises dNTPs, Taq enzyme and PCR buffer. Preferably, the kit further comprises a restriction endonuclease. The present invention effectively improves the "rain curtain" problem of clinical sample detection by adding restriction endonucleases to the system.

[0117] Use of the gene marker combination in any of the above embodiments, the PCR amplification reagent in any of the above embodiments, or the kit in any of the above embodiments in detecting large granular lymphocytic leukemia gene mutations.

[0118] In a fourth aspect, the present application also provides a method for detecting large granular lymphocytic leukemia gene mutations for non-disease diagnosis purposes, comprising the following steps:

[0119] Collecting an in vitro sample to be tested, and extracting the DNA to be tested as a sample to be tested;

[0120] The sample to be tested is used as a template, and a PCR amplification reagent as in any of the above embodiments or a kit as in any of the above embodiments is used to perform droplet digital PCR detection.

[0121] The above-mentioned gene marker combination for detecting large granular lymphocytic leukemia gene mutations can realize rapid detection of genes with large granular lymphocytic leukemia gene mutations by adopting the STAT3 gene and the STAT5B gene. It has the advantages of high sensitivity, rapidity, simplicity, easy operation, and strong coverage, and is convenient for rapid realization of targeted gene detection of clinical samples.

[0122] The present application is further described below in conjunction with specific embodiments. The present application uses different primer probe concentrations and channel combinations to achieve multiple effects and is not limited to detecting STAT3 and STAT5B gene mutation sites, but can also be used to detect other gene variations or gene expressions.

[0123] Example 1

[0124] 1. Design of probes and primers for STAT3 and STAT5B gene mutation sites

[0125] Specifically, the STAT3 and STAT5B gene mutation sites detected by this kit are as follows:

[0126] Table 4 Mutation site information of STAT3 and STAT5B genes

[0127]

[0128]

[0129] Furthermore, the above-mentioned site fluorescent labeling and reaction are as follows:

[0130] Table 5 Fluorescence labeling reaction of each mutation site

[0131] FAM channel HEX Channel CY5 channel Reaction 1 Y640F D661Y / V S614R Reaction 2 N642H Y665F、T628S G618R、N647I

[0132] Specific primers and probes were designed for the STAT3 and STAT5B mutation gene sites. The nucleotide sequences of the specific primers and probes are shown in Table 6:

[0133] Table 6 Nucleotide sequences of primers and probes for each mutation gene site of STAT3 and STAT5B

[0134] sequence name Nucleotide sequence serial number STAT3-Y640F-F CAGGTAAGACCCAGATC SEQ ID NO1 STAT3-Y640F-R TCAGCAAATGACATGTTG SEQ ID NO2 STAT3-D661Y / VF GCTGAAATCATCATGGG SEQ ID NO3 STAT3-D661Y / VR AGACCAGTGGAGACAC SEQ ID NO4 STAT3-S614R / G618R-F CCTTCCTGCTAAGATTCA SEQ ID NO5 STAT3-S614R / G618R-R CTCCACCCAAGTGAAAG SEQ ID NO6 STAT3-N647I-F GTGGAACCATACACAAAG SEQ ID NO7 STAT3-N647I-R TAGCCCATGATGATTTCA SEQ ID NO 8 STAT5B-N642H-F TGAATTAGGAAATCTTAAAACC SEQ ID NO 9 STAT5B-N642H-R CACCAGAGACTTCTCC SEQ ID NO:10 STAT5B-Y665F-F GAATGGAGAAGTCTCTGG SEQ ID NO:11 STAT5B-Y665F-R CAAAAGATGAAGTATACTCCA SEQ ID NO 12 STAT5B-T628S-F CTGAGATTCAGTGACTCA SEQ ID NO 13 STAT5B-T628S-R CACTCACGAGAATCAAAC SEQ ID NO 14 STAT3-Y640F-P TGGAACCATTCACAAAG SEQ ID NO15 STAT3-D661Y-P AGATCATGTATGCTACC SEQ ID NO16 STAT3-D661V-P AGATCATGGTTGCTACC SEQ ID NO 17 STAT3-S614R-P1 TGAAAGCCGCAAAG SEQ ID NO 18 STAT3-S614R-P2 TGAAAGCAGGAAAGA SEQ ID NO 19 STAT3-S614R-P3 TGAAAGCAGAAAAGA SEQ ID NO:20 STAT3-G618R-P TGACGCGTCCTTC SEQ ID NO:21 STAT3-N647I-P CTGAACATCATGTCA SEQ ID NO:22 STAT5B-N642H-P CATCAGATGCCAAAACA SEQ ID NO23 STAT5B-Y665F-P CGTAGATAAGGAAATTC SEQ ID NO24 STAT5B-T628S-P AGCAATGGAGATGC SEQ ID NO25

[0135] The STAT3 gene Y640F primer-probe combination includes: a STAT3 gene Y640F mutant forward primer, a STAT3 gene Y640F mutant reverse primer, and a STAT3 gene Y640F mutant probe; the STAT3 gene D661Y / V primer-probe combination includes: a STAT3 gene D661Y / V mutant forward primer, a STAT3 gene D661Y / V mutant reverse primer, a STAT3 gene D661Y mutant probe, and a STAT3 gene D661Y / V mutant probe. STAT3 gene S614R primer probe combination includes: STAT3 gene S614R / G618R mutant forward primer, STAT3 gene S614R / G618R mutant reverse primer, STAT3 gene S614R mutant probe; STAT5B gene N642H primer probe combination includes: STAT5B gene N642H mutant forward primer, STAT5B gene N642H mutant reverse primer, STAT5B gene N STAT5B gene Y665F primer probe combination includes: STAT5B gene Y665F mutant forward primer, STAT5B gene Y665F mutant reverse primer, STAT5B gene Y665F mutant probe; STAT5B gene T628S primer probe combination includes: STAT5B gene T628S mutant forward primer, STAT5B gene T628S mutant reverse primer, STAT5B gene T628S mutant probe. Probe; STAT3 gene G618R primer probe combination includes: STAT3 gene S614R / G618R mutant forward primer, STAT3 gene S614R / G618R mutant reverse primer, STAT3 gene G618R mutant probe; STAT3 gene N647I primer probe combination includes: STAT3 gene N647I mutant forward primer, STAT3 gene N647I mutant reverse primer, STAT3 gene N647I mutant probe;

[0136] 2. Specificity of single-plex detection primers and probes

[0137] The FAM channel takes STAT3-Y640F as an example, the HEX channel takes STAT3-D661Y as an example, and the CY5 channel takes STAT3-G618R as an example, and mutant plasmids, wild DNA, and mutant plasmid and wild DNA mixed templates are detected simultaneously.

[0138] Select the site and template information as follows:

[0139] Table 7 Selection sites and template information of Y640F, D661, G618R of STAT3

[0140]

[0141] Sample information:

[0142] The mutant plasmid is 10 -6 1 μL of dilution was loaded, 1 μL of wild-type DNA was loaded with genomic DNA of wild-type cell line at a concentration of 30 ng / μL, and 1 μL of mutant plasmid and wild-type DNA mixed template was loaded with mutant plasmid at a concentration of 10 -6 The diluent and 1 μL of wild-type cell line genomic DNA at a concentration of 30 ng / μL were mixed.

[0143] The sample layout is set up according to the following table:

[0144] Table 8 Sample layout table

[0145]

[0146] The reaction system is shown in the following table:

[0147] Table 9 PCR reaction system

[0148]

[0149]

[0150] Among them, dPCR mix is ​​a premixed solution including dNTPs, Taq enzyme and PCR buffer.

[0151] PCR reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.

[0152] Table 10 Digital PCR reaction conditions

[0153]

[0154] Test results: STAT3-Y640F-P probe (FAM) is a mutant probe designed for the Y640F site of the STAT3 gene. The Y640F mutant plasmid is a mutant plasmid for the Y640F site of the STAT3 gene. Please refer to Figure 1 , which is a 1D graph of fluorescence signal detection in the FAM channel. The result should be that the Y640F mutant plasmid is detected in the FAM channel, the wild-type cell line genomic DNA is not detected, and the Y640F mutant plasmid and wild-type DNA mixture is detected in the FAM channel. Therefore, the result is that the Y640F mutant plasmid and the Y640F mutant plasmid and wild-type DNA mixture template only have signals in the FAM channel, while the wild-type cell line genomic DNA has no signals in all channels, which is in line with expectations.

[0155] STAT3-D661Y-P probe (HEX) is a mutant probe designed for the D661Y site of the STAT3 gene. The Y640F mutant plasmid is a mutant plasmid for the D661Y site of the STAT3 gene. Please refer to Figure 2 , which is a 1D graph of fluorescence signal detection in the HEX channel. The result should be that the D661Y mutant plasmid is detected in the HEX channel, the wild-type cell line genomic DNA is not detected, and the D661Y mutant plasmid and wild-type DNA mixture is detected in the HEX channel. Therefore, the result is that the D661Y mutant plasmid and the D661Y mutant plasmid and wild-type DNA mixture template only have signals in the HEX channel, while the wild-type cell line genomic DNA has no signals in all channels, which is in line with expectations.

[0156] STAT3-G618R-P probe (CY5) is a mutant probe designed for the G618R site of the STAT3 gene. The G618R mutant plasmid is a mutant plasmid for the G618R site of the STAT3 gene. Please refer to Figure 3 , which is a 1D graph of fluorescence signal detection in the CY5 channel. The result should be that the G618R mutant plasmid is detected in the CY5 channel, the wild-type cell line genomic DNA is not detected, and the mixture of the G618R mutant plasmid and the wild-type DNA is detected in the CY5 channel.

[0157] Therefore, the results showed that the G618R mutant plasmid and the G618R mutant plasmid and wild-type DNA mixture template only had signals in the CY5 channel, while the wild-type cell line genomic DNA had no signals in all channels, which was in line with expectations. The test results are as follows:

[0158] STAT3-Y640F copy number concentration test results:

[0159] Table 11 STAT3-Y640F copy number concentration detection results

[0160]

[0161] STAT3-D661Y copy number concentration test results:

[0162] Table 12 STAT3-D661Y copy number concentration detection results

[0163]

[0164]

[0165] STAT3-G618R copy number concentration test results:

[0166] Table 13 STAT3-D661Y copy number concentration detection results

[0167]

[0168] 3. Results of multi-site probe concentration detection

[0169] In order to study the multi-site detection of single channel under multiple conditions, taking STAT3-G618R-P probe as an example, the same reaction procedure was adopted, the primer concentration was fixed at 800nM, and the final concentration of the dPCR system was set to 200nM, 400nM, and 600nM. The G618R mutant plasmid was detected and the effect of probe concentration on the fluorescence signal was compared.

[0170] Sample information:

[0171] The mutant plasmid is G618R mutant plasmid, using 10 -6 Load 1 μL of the diluent.

[0172] The sample layout is set up according to the following table:

[0173] Table 14 Sample layout table

[0174] Chip 1 Probe concentration A1 hole STAT3-G618R-P: 600nM B1 hole STAT3-G618R-P: 400nM C1 hole STAT3-G618R-P: 200nM

[0175] Reaction system:

[0176] Table 15 Reaction system

[0177]

[0178] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.

[0179] Table 16 Digital PCR reaction program

[0180]

[0181]

[0182] Test results: STAT3-G618R-P probe (CY5) is a mutant probe designed for the G618R site of the STAT3 gene. The G618R mutant plasmid is a mutant plasmid of the G618R site of the STAT3 gene. The probe final concentration is set to three gradients of 600nM, 400nM, and 200nM. Please refer to Figure 4 , which is a 1D graph of fluorescence signal detection in the CY5 channel at different probe concentrations for the same mutation site. The result should be that the G618R mutant plasmid is detected in the CY5 channel and the fluorescence signal intensity is 600nM>400nM>200nM for the probe concentration.

[0183] Therefore, the fluorescence signal intensity results in the 1D graph are probe concentrations of 600nM>400nM>200nM, which is in line with expectations.

[0184] STAT3-G618R copy number concentration test results:

[0185] Table 17 STAT3-G618R copy number concentration detection results

[0186]

[0187] 4. Explore the comparison of different dPCR enzymes

[0188] In order to study the effect of different dPCR mixes on the fluorescence signal intensity, taking STAT3-Y640F-P probe as an example, different dPCR mixes were set by using the same reaction procedure and reaction system, and the effects of different dPCR mixes on the fluorescence signal were compared.

[0189] Sample information:

[0190] The mutant plasmid is Y640F mutant plasmid, using 10 -6 Load 1 μL of the diluent.

[0191] Different dPCR mix information is as follows:

[0192] Table 18 Different dPCR mix information

[0193] Serial number dPCR mix factory 1 Naica system dPCR MIXES STILLA 2 HR Digtal PCR Master Mix Apexbio 3 PerfeCTa qPCR ToughMix UNG Quantabio 4 PerfeCTa MultiPlex qPCR ToughMix Quantabio 5 SuperfastStar Universal Probe Mixture Kangwei Century

[0194] The sample layout is set up according to the following table:

[0195] Table 19 Sample layout table

[0196]

[0197] Reaction system:

[0198] Table 20 PCR reaction system

[0199] Reagents Volume (μL) dPCR mix / Fluorescein sodium salt 1 Forward Primer 800nM Reverse primer 800nM Probe 200nM template 1 BamHI restriction enzyme 0.5 Total volume Rehydrate to 25

[0200] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.

[0201] Table 21 Digital PCR reaction program

[0202]

[0203] Test results: STAT3-Y640F-P probe (FAM) is a mutant probe designed for the Y640F site of the STAT3 gene. The Y640F mutant plasmid is a mutant plasmid of the Y640F site of the STAT3 gene. For different dPCR mix settings, please refer to Figure 5 , which is a 1D graph comparing different dPCR enzymes in the FAM channel fluorescence signal detection. The result should be that for the Y640F mutant plasmid, different dPCR mixes are used to detect in the FAM channel and the copy number concentration is similar.

[0204] Therefore, in the 1D graph, except for PerfeCTa qPCR ToughMix (UNG), the copy number concentrations of other dPCR mixes are in line with expectations. From the perspective of fluorescence signal differentiation, the fluorescence signals of Naica system dPCR MIXES, HR Digtal PCR Master Mix, PerfeCTa MultiPlex qPCR ToughMix, and SuperfastStar Universal Probe Mixture can be normally differentiated. The best type is the one with higher fluorescence signal intensity and relatively low background signal. The fluorescence signal of SuperfastStarUniversal Probe Mixture shows an absolute advantage. The test results are as follows:

[0205] STAT3-Y640F copy number concentration test results:

[0206] Table 22 STAT3-Y640F copy number concentration detection results

[0207]

[0208] 5. Adjust probe concentration to achieve single-channel multiplex detection

[0209] In order to achieve multiple detection in a single channel, this study adjusted the probe concentration based on the same primer concentration and the fluorescence signal intensity of different sites in the same channel to achieve the purpose of signal differentiation. Taking the G618R and N647I sites of the STAT3 gene as an example, the STAT3-G618R-P probe (CY5) is a mutant probe designed for the G618R site of the STAT3 gene, and the G618R mutant plasmid is a mutant plasmid of the G618R site of the STAT3 gene; the STAT3-N647I-P probe (CY5) is a mutant probe designed for the N647I site of the STAT3 gene, and the N647I mutant plasmid is a mutant plasmid of the N647I site of the STAT3 gene. The G618R and N647I sites were placed in the same system for detection, and the differentiation of the G618R and N647I sites under single and double conditions was observed.

[0210] Reaction system 1 (G618R single weight):

[0211] Table 23 PCR reaction system of G618R single

[0212] Reagents Volume (μL) dPCR mix 5 Fluorescein sodium salt 1 STAT3-S614R / G618R-F 800nM STAT3-S614R / G618R-R 800nM STAT3-G618R-P 500nM template 1 BamHI restriction enzyme 0.5 Total volume Rehydrate to 25

[0213] Reaction system 2 (N647I single weight):

[0214] Table 24N647I single-plex PCR reaction system

[0215] Reagents Volume (μL) dPCR mix 5 Fluorescein sodium salt 1 STAT3-N647I-F 800nM STAT3-N647I-R 800nM STAT3-N647I-P 200nM template 1 BamHI restriction enzyme 0.5 Total volume Rehydrate to 25

[0216] Reaction system 3 (G618R and N647I double):

[0217] Table 25 G618R and N647I dual PCR reaction system

[0218] Reagents Volume (μL) dPCR mix 5 Fluorescein sodium salt 1 STAT3-S614R / G618R-F 800nM STAT3-S614R / G618R-R 800nM STAT3-G618R-P 500nM STAT3-N647I-F 800nM STAT3-N647I-R 800nM STAT3-N647I-P 200nM template 1 BamHI restriction enzyme 0.5 Total volume Rehydrate to 25

[0219] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.

[0220] Table 26 Digital PCR reaction program

[0221]

[0222] The sample layout is set up according to the following table:

[0223] Table 27 Sample layout table

[0224] Chip 1 Sample name A1 hole G618R mutant plasmid single-plex detection B1 hole Single-plex detection of N647I mutant plasmid C1 hole Dual detection of G618R and N647I mutant plasmids

[0225] Test results: STAT3-G618R-P probe (CY5) is a mutant probe designed for the G618R site of the STAT3 gene, and STAT3-N647I-P probe (CY5) is a mutant probe designed for the N647I site of the STAT3 gene. Single and double detection are set. Please refer to Figures 6 to 8 ,in Figure 6 This is the 2D diagram of the fluorescence signal detection of the low fluorescence intensity mutation of the CY5 channel. Figure 7 This is the 2D diagram of the high fluorescence intensity fluorescence signal detection of the CY5 channel. Figure 8This is a 2D graph of fluorescence signal detection of two mutations in the CY5 channel. The results should be as follows: for single detection of the G618R mutant plasmid, it is detected in the CY5 channel and the fluorescence signal intensity is low; for single detection of the N647I mutant plasmid, it is detected in the CY5 channel and the fluorescence signal intensity is high; for double detection of the G618R and N647I mutant plasmids, it is detected in the CY5 channel and the two can be clearly distinguished. From the copy number concentration: the single and double of the G618R and N647I mutant plasmids are consistent.

[0226] Therefore, it can be seen from the 2D graph that the fluorescence signal of the single-plex detection of the N647I mutant plasmid is about 1W; the fluorescence signal of the single-plex detection of the G618R mutant plasmid is about 3W; when the G618R and N647I mutant plasmids are double-detected, the signals can be clearly distinguished. In terms of copy number concentration, the copy number concentration of the single-plex detection of the G618R mutant plasmid is 142.4cp / μL, the copy number concentration of the single-plex detection of the N647I mutant plasmid is 217.6cp / μL, and the copy number concentrations of the double-plex detection of the G618R and N647I mutant plasmids are 102.5cp / μL and 214.4cp / μL, respectively. The single and double detections are consistent and the signals can be clearly distinguished, which is in line with expectations. The test results are as follows:

[0227] Copy number concentration test results:

[0228] Table 28 Copy number concentration detection results

[0229]

[0230] 6. Add restriction endonucleases to compare clinical sample test results

[0231] According to the location of mutation sites in the STAT3 and STAT5B genomic sequences, we searched for restriction endonucleases that could digest the sequences on both sides. We also used clinical samples with mutation ratios of approximately 40% and 10% as templates, and compared the addition and non-addition of restriction endonucleases in the system to see the difference in the resulting signals.

[0232] Table 29 PCR reaction system:

[0233]

[0234] The balance of the system is nuclease-free water.

[0235] PCR reaction program 1 is set as follows:

[0236] 30PCR reaction procedure 1

[0237]

[0238] PCR reaction program 2 is set as follows:

[0239] Table 31 PCR reaction program 1

[0240]

[0241] Test results: We tested samples with mutation ratios of about 40% and 10% respectively. Judging from the mutation ratios, the presence or absence of restriction endonucleases should have no significant effect on the test results; please refer to Figures 9 to 12 ,in Fig. 9 Add restriction endonuclease enzyme digestion fluorescence signal detection 2D map for about 40% of clinical samples, Fig.10 Add restriction endonuclease enzyme digestion fluorescence signal detection 2D map for about 10% of clinical samples, Fig.11 2D graph of fluorescence signal detection without adding restriction endonuclease for about 40% of clinical samples;

[0242] Fig.12 This is a 2D graph of fluorescence signal detection for about 10% of clinical samples without restriction endonuclease digestion. From the 2D graph, when the clinical samples are digested without restriction endonuclease, the positive signal should show a large amount of "rain curtain", and there should be no "rain curtain" when restriction endonuclease is added.

[0243] Therefore, judging from the mutation ratio, the presence or absence of restriction endonucleases has no obvious effect on the test results; from the 2D graph, when the clinical samples are not digested with restriction endonucleases, the positive signals show a large amount of "rain curtains". Adding restriction endonucleases can effectively improve the "rain curtain" situation, which is in line with expectations.

[0244] Table 32 Copy number concentration detection results

[0245]

[0246] VII. Application of digital PCR detection kit and method for large granular lymphocyte leukemia-related gene mutations in clinical samples

[0247] To verify the effectiveness of the kit, the kit control was tested using the kit. In specific applications, the forward primer, reverse primer and probe were first diluted to 100 μM respectively. The forward primer, reverse primer and probe were prepared into a 12.5× mixed solution.

[0248] Sample processing: Extract genomic DNA from the sample to be tested, and test whether the concentration and quality of the DNA meet the requirements of digital PCR for genomic DNA quality and concentration. The extraction reagent used is specifically a blood / cell genomic DNA extraction reagent, and the sample to be tested is peripheral blood.

[0249] Digital PCR reaction solution: The digital PCR reaction solution is a digital PCR premix, fluorescein sodium salt, and a primer-probe mixture. The digital PCR premix specifically includes dPCR buffer, DNA polymerase, dNTPs, MgCl2, etc. for digital PCR amplification; the fluorescein sodium salt specifically includes a dye that makes the droplets detectable; the primer-probe mixture is a primer-probe combination for each site of the STAT3 and STAT5B genes as described in "I. Design of probes and primers for mutation sites of STAT3 and STAT5B genes".

[0250] Control substances, including positive control substances, negative control substances, and blank control substances;

[0251] Positive control: mutant plasmid synthesized by other companies;

[0252] Negative control: wild-type cell line DNA;

[0253] Blank control: Ultrapure water can be used as a blank control.

[0254] Concentration of each component of primer-probe mixture:

[0255] Table 33 Concentration of probes and primers for multiplex hybrid detection

[0256]

[0257] Reaction system:

[0258] Table 34 Concentration of probes and primers for mixed detection

[0259] Reagent name Single reaction volume (μL) dPCR Mix (5×) 5 Fluorescein sodium salt 1 Primer probe mixture (12.5×) 2 Sample 1 Total volume 25

[0260] Reaction procedure:

[0261] Table 35 PCR reaction program for mixed detection

[0262]

[0263] Layout:

[0264] Table 36 Detection layout table

[0265] Chip 1 Sample name A1 hole Blank control B1 hole Negative Control C1 hole Positive Control

[0266] Test results: The positive control can detect the corresponding fluorescence signal at each mutation signal group position; the negative control STAT3 and STAT5B genes should have no mutation; the blank control has no detection in each channel. Figures 13 to 15 ,in Fig.13 This is the 2D diagram of the fluorescence signal detection of the Y640F and N642H sites of the FAM channel of the kit. Fig.14This is the 2D diagram of the fluorescence signal detection of the HEX channel D661Y / V, Y665F, and T628S sites of the kit. Fig.15 This is a 2D diagram of the fluorescence signal detection of the S614R, G618R, and N647I sites in the CY5 channel of the kit.

[0267] Therefore, judging from the test results, the positive control Y640F, D661Y / V, S614R, N642H, Y665F / T628S, and G618R / N647I mutations were all detected at the corresponding signal cluster positions; no mutations were detected in the negative control STAT3 and STAT5B genes, and no mutations were detected in the blank control, which was in line with expectations.

[0268] The results of digital PCR detection of mutation sites are as follows:

[0269] Table 37 Digital PCR detection results of each mutation site

[0270]

[0271]

[0272] It can be seen from the above that the primers and probes for each mutation site of the STAT3 gene and STAT5B gene of the present application can well realize single, double and multiple mixed detection, further improve the detection speed, and the operation process is more convenient.

[0273] The technical features of the above-mentioned embodiments can be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of this application, which all belong to the protection scope of this application. Therefore, the protection scope of the patent in this application shall be based on the attached claims.

Claims

1. A gene marker combination for detecting STAT5B gene mutation in large granular lymphocytic leukemia, characterized in that: Including at least one of the following mutation sites: p.N642H, p.Y665F, p.T628S.

2. The gene marker combination according to claim 1, characterized in that: The nucleotide sequence of the forward primer for detecting the p.N642H site of the STAT5B gene is shown in SEQ ID NO.9, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.10, and the nucleotide sequence of the probe is shown in SEQ ID NO.23; and / or, the nucleotide sequence of the forward primer for detecting the p.Y665F site of the STAT5B gene is shown in SEQ ID NO.11, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.12, and the nucleotide sequence of the probe is shown in SEQ ID NO.24; And / or, the nucleotide sequence of the forward primer for detecting the p.T628S site of the STAT5B gene is shown as SEQ ID NO.13, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.14, and the nucleotide sequence of the probe is shown as SEQ ID NO.

25.

3. A PCR amplification reagent for detecting large granular lymphocytic leukemia gene mutations, characterized in that: It comprises a forward primer, a reverse primer and a probe for detecting the gene marker combination according to claim 1 or 2.

4. The PCR amplification reagent according to claim 3, characterized in that The PCR amplification reagent also includes a restriction endonuclease.

5. The PCR amplification reagent according to claim 4, characterized in that The PCR amplification reagent also includes a gene marker combination for detecting STAT3 gene mutations in large granular lymphocytic leukemia, and the STAT3 gene includes at least one of the following mutation sites: p.Y640F, p.D661Y, p.D661V, p.S614R, p.G618R, and p.N647I.

6. The PCR amplification reagent according to any one of claims 3 to 5, characterized in that The 5' end of each probe is connected to a fluorescent group, and the 3' end is connected to a fluorescent quenching group; the fluorescent group is FAM, HEX or CY5; Among them, the fluorescent group of p.N642H is FAM; The fluorescent group of p.Y665F and p.T628S is HEX.

7. A kit for detecting large granular lymphocytic leukemia gene mutation, characterized in that: Comprising a PCR amplification reagent as described in any one of claims 3 to 6.

8. The kit according to claim 7, characterized in that The kit also contains a negative control and a positive control, the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard. Preferably, the sample targeted by the kit is selected from plasma specimens, bone marrow specimens or paraffin specimens. Preferably, the PCR is an asymmetric PCR method; preferably, the kit also includes PerfeCTa Multiplex ToughMix digital PCR premix and fluorescein sodium salt, the premix includes dNTPs, Taq enzyme and PCR buffer. Preferably, the kit also contains restriction endonucleases.

9. Use of the gene marker combination according to any one of claims 1 to 2, the PCR amplification reagent according to any one of claims 3 to 6, or the kit according to any one of claims 7 to 8 in detecting large granular lymphocytic leukemia gene mutations.

10. A method for detecting gene mutations in large granular lymphocytic leukemia for non-disease diagnosis purposes, characterized in that: The steps include: Collecting an in vitro sample to be tested, and extracting the DNA to be tested as a sample to be tested; Using the sample to be tested as a template, droplet digital PCR detection is performed using the PCR amplification reagent as described in any one of claims 3 to 6 or the kit as described in any one of claims 7 to 8; preferably, detection of multiple mutation sites is achieved through a single PCR mixing reaction.

Images