Application of knockout RMP gene in promoting growth of monascus, monascus genetically engineered bacterium as well as construction method and application of monascus genetically engineered bacterium

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a knockout RMP gene in promoting growth of monascus, a monascus gene engineering bacterium and a construction method and application of the monascus gene engineering bacterium. According to the application of knocking out the RMP gene in promoting the growth of monascus, the nucleotide sequence of the RMP gene is as shown in SEQ ID No. 1. RMP gene expression level reduction can promote monascus growth and spore formation and slow down the decline speed of monascus, which indicates that RMP gene expression level reduction can promote monascus growth and reproduction, inhibit monascus decline and prolong the utilization cycle of monascus.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to the application of knocking out RMP gene in promoting the growth of Monascus, Monascus genetic engineering bacteria and a construction method and application thereof. Background Art

[0002] The RMP gene is a hypothetical protein gene in Monascus. Currently, its function is unknown. The applicant previously found that the reduction of the expression level of this gene can regulate the production of the main secondary metabolites of Monascus (monascus pigment, Monacolin K, citrinin), and named it RMP gene ( R egulate m etabolite p This project used RNA interference (RNAi) technology to reduce the expression level of the RMP gene. It was found that this gene not only affects the production of secondary metabolites of Monascus, but also affects the growth, decay and spore formation of Monascus. In the later stage, by regulating the expression of this gene and adding related enzymes, the growth, reproduction and decay of Monascus can be further regulated, the fermentation time of Monascus can be extended, and better support can be provided for the application of Monascus. Summary of the invention

[0003] In order to solve the above problems, the present invention provides the application of knocking out the RMP gene in promoting the growth of Monascus, the Monascus genetically engineered bacteria and the construction method and application thereof. The reduction of the expression level of the RMP gene can promote the growth and spore formation of Monascus, and at the same time slow down the decay rate of Monascus, indicating that the reduction of the expression level of the RMP gene can promote the growth and reproduction of Monascus, inhibit the decay of Monascus, and extend the utilization period of Monascus.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides the use of knocking out an RMP gene in promoting the growth of Monascus purpureus. The nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0006] The present invention also provides the use of knocking out the RMP gene in promoting the spore formation of Monascus purpureus, and the nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0007] The present invention also provides the use of knocking out the RMP gene in slowing down the decay rate of Monascus purpureus. The nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0008] The present invention also provides a Monascus genetic engineering bacterium, which is obtained by knocking out the RMP gene in Monascus.

[0009] The present invention also provides a method for constructing the Monascus genetically engineered bacteria described in the above technical solution, comprising the following steps:

[0010] 1) connecting the RMP gene to the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector to obtain a connection vector; the nucleotide sequence of the RMP gene is shown in SEQ ID No. 1;

[0011] 2) transforming Agrobacterium with the ligated vector obtained in step 1) to obtain transformed bacteria;

[0012] 3) The transformed bacteria obtained in step 2) are used to infect Monascus to obtain genetically engineered Monascus bacteria.

[0013] Preferably, in step 1) the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector is double-digested with BgIII and EcoRI enzymes and then connected to the RMP gene;

[0014] The enzyme digestion system is: BgIII enzyme 1 μL, EcoRI enzyme 1 μL, 10×Buffer 2 μL, pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector 1 μg, ddH2O supplemented to 20 μL;

[0015] The conditions for the enzyme digestion are: 37°C for 1h;

[0016] The ligation system is: 1 μL of RMP gene, 1 μL of pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector after double enzyme digestion, 2 μL of 5×CE II Buffer, 1 μL of Exnase II, and ddH2O supplemented to 10 μL;

[0017] The connection conditions are: 37°C for 30 min.

[0018] Preferably, in step 2), the mass ratio of the ligated vector to the volume of Agrobacterium is 0.1 μg:100 μL;

[0019] The infection conditions of step 3) include: 30° C. for 24 hours.

[0020] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in promoting the growth of Monascus.

[0021] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in promoting the spore formation of Monascus.

[0022] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in slowing down the decay rate of Monascus.

[0023] Beneficial effects of the present invention:

[0024] A hypothetical protein gene (RMP gene for short) in Monascus has an unknown function. The expression level of this gene is now inhibited using RNAi (RNA interference) technology, and an RNAi engineered strain of this gene is constructed. It is found that reduced expression level of the RMP gene can promote the growth and spore formation of Monascus, and slow down the rate of death of Monascus, indicating that reduced expression level of this gene can promote the growth and reproduction of Monascus, inhibit the death of Monascus, and extend the utilization period of Monascus. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1 is the plasmid map of the expression vector;

[0027] Figure 2 This is the plasmid map of RNAi expression vector;

[0028] Figure 3 The gel electrophoresis results of wild-type Monascus and transformants, M: Marker, 1-10: 10 randomly selected transformants, WS: wild-type Monascus;

[0029] Figure 4 The results are real-time fluorescence quantitative PCR;

[0030] Figure 5 Biomass determination for wild-type Monascus and T2 transformants;

[0031] Figure 6 This is the determination of the number of wild-type Monascus and T2 transformed sporozoites. DETAILED DESCRIPTION

[0032] The present invention provides the use of knocking out an RMP gene in promoting the growth of Monascus purpureus. The nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0033] SEQ ID No.1:

[0034] GTGCCGCTTTCTTTGCTTCATCTGCCTGTTTGTTTTCGGCATCTGCAGCTTCAGTGGCTGTATCGGCTTCCATCTTTTTGGCTGTATCGATTGCGTCTTGGACTGCGCGTTCTTGAGCTACAAGCTGTTTGTATTCCTTTTCGCGCTCTTCGGCCGCTTTCTTGTCCAGCTCTAGCTGCTGCCAGACGTCATCTGCAACACCTGAATCTCGGGAGTCATG CAGATTCAGGTCTGGAGACTTTGGAGTCTCCGAAGAGTCGTCTGTCTTGGTGATAGTCGTCGATGCTTTGGTGGCAGCGGGGGTTGCGATGGTGGTATCCAGGTCGGCAGTTACCTGCTGCTGATTAGAATTGGCGACATACTTATTCTGGGTAAAGGCTGCCCGGTGCATGCGGTCGTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0035] The present invention also provides the use of knocking out the RMP gene in promoting the spore formation of Monascus purpureus, and the nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0036] The present invention also provides the use of knocking out the RMP gene in slowing down the decay rate of Monascus purpureus. The nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0037] The invention provides a Monascus genetic engineering bacterium, which is obtained by knocking out the RMP gene in Monascus.

[0038] The present invention also provides a method for constructing the Monascus genetically engineered bacteria described in the above technical solution, comprising the following steps:

[0039] 1) connecting the RMP gene to the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector to obtain a connection vector; the nucleotide sequence of the RMP gene is shown in SEQ ID No. 1;

[0040] 2) transforming Agrobacterium with the ligated vector obtained in step 1) to obtain transformed bacteria;

[0041] 3) The transformed bacteria obtained in step 2) are used to infect Monascus to obtain genetically engineered Monascus bacteria.

[0042] The present invention connects the RMP gene to the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector to obtain a connection vector; the nucleotide sequence of the RMP gene is shown in SEQ ID No.1.

[0043] In the present invention, the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector is preferably double-digested with BgIII and EcoRI enzymes before being connected to the RMP gene. Double-stranded RNA is digested into small interfering RNA, which binds to the enzyme to form a complex, which binds to the RMP gene to degrade it, thereby inhibiting the expression of the RMP gene. In the present invention, the digestion system is preferably: BgIII enzyme 1μL, EcoRI enzyme 1μL, 10×Buffer 2μL, pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector 1μg, ddH2O supplemented to 20μL. In the present invention, the digestion conditions are preferably: 37℃1h. In the present invention, the connection system is preferably: RMP gene 1 μL, double-digested pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector 1 μL, 5×CEII Buffer 2 μL, Exnase II 1 μL, ddH2O to 10 μL. In the present invention, the connection conditions are preferably: 37°C for 30 min.

[0044] The present invention transforms the obtained connection vector into Agrobacterium to obtain a transformed bacterium. In the present invention, the mass ratio of the connection vector to the volume of Agrobacterium is preferably 0.1 μg:100 μL. In the present invention, the Agrobacterium is preferably Agrobacterium tumefaciens GV3101. The present invention does not specifically limit the conditions for transforming Agrobacterium with the connection vector, and those skilled in the art can use conventional methods.

[0045] The present invention infects Monascus with the obtained transformed bacteria to construct a Monascus genetically engineered bacterium. In the present invention, the infection conditions preferably include: 30° C. for 24 hours. The present invention has no special restrictions on other infection conditions, and those skilled in the art can use conventional ones.

[0046] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in promoting the growth of Monascus.

[0047] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in promoting the spore formation of Monascus.

[0048] The present invention also provides the use of the Monascus genetic engineering bacteria described in the above technical solution in slowing down the decay rate of Monascus.

[0049] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0050] Example 1

[0051] 1. Construction of RMP gene RNAi vector

[0052] (1) Monascus DNA extraction and RMP gene fragment amplification

[0053] Take some Monascus hyphae, grind them with liquid nitrogen, and extract genomic DNA according to the operating instructions of the tissue genomic DNA small-scale extraction kit.

[0054] Using Monascus genomic DNA as a template, primers were designed and amplified. The primers used were: hqm-5605F (SEQ ID No. 2): 5'-ggtagatctcagtggctgtatcggcttccatc-3';

[0055] hqm-5605R (SEQ ID No. 3): 5'-accgaattcgacgtctggcagcagctagagc-3'.

[0056] The amplification system is:

[0057] Table 1 Amplification system

[0058] name Volume (μl) Q5 High Fidelity Enzyme 0.5 Q5Buffer(5×) 10 dNTP(10mM) 2 Primer F (100 μmol / mL) 2 Primer R (100 μmol / mL) 2 Template (genomic DNA 40.2 μg / mL) 0.5 <![CDATA[ddH2O]]> 33

[0059] Table 2 Reaction conditions

[0060]

[0061] (2) Linearization of pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 plasmid

[0062] Plasmid map Figure 1 .

[0063] Select BglII and EcoRI to cut the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector backbone.

[0064] Table 3 Enzyme digestion system

[0065] name Volume (μl) Endonuclease BglII 1 EcoRI 1 Buffer(10x) 2 Plasmid backbone (1 μg) x <![CDATA[ddH2O]]> To20

[0066] React at 37℃ for 1h, inactivate at 80℃ for 10min

[0067] The recovered PCR product was recombined and ligated with the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector backbone after restriction digestion.

[0068] Table 4 Recombination system

[0069] name Volume (μl) Insert 1 Linearized vector 1 5×CEIIbuffer 2 ExnaseII 1 <![CDATA[ddH2O]]> To10

[0070] After reacting at 37°C for 30 min, the mixture was immediately cooled on ice.

[0071] (3) Transformation of recombinant products:

[0072] 1) Thaw TranT1 competent cells on ice.

[0073] 2) Take 10ul of the recombinant product and add it to 100ul of competent cells. Gently tap the tube wall to mix (do not oscillate to mix), and let it stand on ice for 30min.

[0074] 3) After heat shock in a 42°C water bath for 45 seconds, immediately cool on ice for 2-3 minutes.

[0075] 4) Add LB medium (without antibiotics) and shake at 37°C for 1 h (speed 200-250 rpm).

[0076] 5) Preheat the LB (kanamycin 50ug / ml) solid culture medium plates of the corresponding resistance in a 37°C incubator.

[0077] 6) Centrifuge at 5,000 rpm for 5 min, discard 900 μl of supernatant, resuspend the cells with the remaining culture medium, and spread evenly on a plate containing 50 ug / ml kanamycin using a sterile spreader.

[0078] 7) Incubate the cells upside down in a 37°C incubator for 12-16 hours.

[0079] The plasmid map of the RNAi expression vector after construction is as follows Figure 2 As shown, it was named pCAMBIA1303-TrpC-Hygro-gpdA-RMP-TEF1.

[0080] 2. Agrobacterium infection and screening and identification of Monascus

[0081] (1) Transformation of Agrobacterium

[0082] 1) Take the GV3101 competent cell stored at -80℃ and place it at room temperature for a while until it partially melts. When it is in an ice-water mixture state, insert it into ice.

[0083] 2) Add 0.1 μg of plasmid DNA (pCAMBIA1303-TrpC-Hygro-gpdA-RMP-TEF1) to 100 μl competent medium, stir the bottom of the tube by hand to mix, and place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0084] 3) Add 700 μl of LB liquid culture medium without antibiotics and culture at 28°C with shaking for 2 to 3 hours.

[0085] 4) Collect the bacteria by centrifugation at 6000 rpm for 1 min, take about 100 μl of the supernatant, gently blow to resuspend the bacteria, and spread it on the LB plate containing the corresponding antibiotics (50 μg / ml kanamycin, 20 μg / ml rifampicin), and invert it in a 28°C incubator for 2-3 days.

[0086] 5) Pick the positive clones and transfer them to 10 ml LB (As 20 mg / L) medium, and culture at 28°C with shaking until OD 600 About 0.6.

[0087] (2) Agrobacterium infection with Monascus

[0088] 1) Inoculate Monascus into PDA medium and incubate in a 30°C incubator for about a week to prepare conidia solution. Dilute the conidia solution to 10% with sterile water. 6 Pieces / ml.

[0089] 2) The Agrobacterium and Monascus spores from the previous step were co-cultured in a 30°C incubator for 24 h.

[0090] 3) The spore solution after co-culture is spread on a PDA plate containing 150ug / ml hygromycin and cultured in a 30°C incubator for about two weeks until a single clone grows out.

[0091] 4) The monoclonal transformants were transferred to new PDA plates containing 150 μg / ml hygromycin and cultured in a 30°C incubator for about two weeks. The genome and RNA were extracted for relevant identification.

[0092] (3) Transformant Verification

[0093] Randomly select 10 transformants and perform ordinary PCR verification. The steps are as follows:

[0094] 1) Extraction of transformant DNA. Take some Monascus mycelium, grind it with liquid nitrogen, and extract genomic DNA according to the instructions of the tissue genomic DNA small-scale extraction kit. The primer sequences used are as follows:

[0095] GpdAF (SEQ ID No. 4): 5'-gCTACATCCATACTCCATCCTTC-3';

[0096] TEFF (SEQ ID No. 5): 5'-gtagtatctgagcacttctcc-3'.

[0097] Table 5 Amplification system

[0098]

[0099] Table 6 Reaction conditions

[0100]

[0102] The results are as follows Figure 3 ,from Figure 3 It can be seen that the wild type Monascus does not contain the target RMP gene, and the selected transformant contains the target gene, indicating that the Monascus RMP gene RNAi transformant was successfully constructed.

[0103] 3. Determination of RMP gene expression level in RNAi transformants

[0104] (1) RNA extraction

[0105] 1) Sample pretreatment: Use a 1 ml pipette tip to take a block of Monascus mycelium, grind it with liquid nitrogen, add 1 ml of Trizol reagent, mix it by blowing with a pipette, transfer it to a 1.5 ml EP tube without RNase, and lyse it for 10 min.

[0106] 2) Add 200 μl of chloroform, mix vigorously by inverting several times, and leave at room temperature for 5 minutes.

[0107] 3) Centrifuge at 4°C, 12,000 rpm for 15 min. The solution can be separated into three phases: upper (RNA), middle (protein), and lower (DNA).

[0108] 4) Transfer the upper aqueous phase (about 400 μl) to another new 1.5 ml EP tube, add 400 μl isopropanol, mix well and let stand at room temperature for 10 min.

[0109] 5) Centrifuge at 4°C, 12,000 rpm for 10 min. A white RNA precipitate will be visible at the bottom of the tube.

[0110] 6) Discard the supernatant, add 1 ml of RNase-free 75% ethanol, vortex to mix, and centrifuge at 4°C, 10,000 rpm for 5 min.

[0111] 7) Repeat step 6 once.

[0112] 8) Discard the supernatant, dry the RNA precipitate in air for 5-10 minutes, and dissolve the precipitate in 20 μl DEPC water.

[0113] 9) Take 2 μl of dissolved RNA and measure OD using a micro-spectrophotometer 260 OD 280 and OD 260 / OD 280 Calculate the purity and concentration of RNA.

[0114] (2) Reverse transcription into cDNA

[0115] ① Genomic DNA removal:

[0116] Table 7 Genomic DNA removal system

[0117] Reagent Volume(μl) RNA 1 μg 4×gDNAwiperMix 4μl <![CDATA[ddH2O(Rnasefree)]]> Up to 16 μl

[0118] Reaction conditions: 42℃2min

[0119] ②Reverse transcription reaction:

[0120] Add 5×HiScript III RT SuperMix directly to the reaction tube in the previous step.

[0121] Table 8 Reverse transcription reaction system

[0122]

[0123] Reaction conditions: 37℃15min, 85℃5sec

[0124] (3) Real-time fluorescence quantitative PCR detection

[0125] cDNA was diluted 10 times

[0126] Reaction system:

[0127] Table 9 Real-time fluorescence quantitative PCR reaction system

[0128] DNA 1μl Forward Primer (10 μM) 0.4μl Reverse Primer (10 μM) 0.4μl SYBR Green Master Mix 10μl <![CDATA[H2O]]> 8.2μl

[0129] Reaction conditions:

[0130] 50℃ 2min; 95℃ 5min, 95℃ 15sec, 56℃ 20sec, 72℃ 40sec, 40cycles.

[0131] Table 10 Primers used in real-time fluorescence quantitative PCR reaction

[0132]

[0133] The results of real-time fluorescence quantitative PCR are shown in Figure 4 ,Depend on Figure 4 It can be seen that, taking the expression level of the RMP gene of the wild-type Monascus as the control, the expression level of the RMP gene of 9 out of 10 transformants was successfully inhibited, and the transformant with the lowest expression level (T2, 0.412 times) was selected for subsequent research.

[0134] 4. Determination of transformant biomass:

[0135] The Monascus seed liquid cultured for 48 hours was filtered through 4 layers of sterile gauze to remove the mycelium and obtain the spore suspension. 2 mL of the bacterial suspension was absorbed and evenly applied to the Monascus solid culture medium, and cultured at 30°C for 21 days. The cellophane was peeled off, the bacteria were placed in an oven, and dried at 50°C to constant weight. Samples were taken every 3 days, and three were parallel in each group. For specific results, see Figure 5 ,Depend on Figure 5 It can be seen that on the 9th day, the biomass of the wild-type Monascus and the engineered strain reached the highest, 0.406g and 0.461g respectively, and the biomass of the engineered strain was higher than that of the wild type. From the 12th day, the biomass of the wild-type Monascus and the engineered strain began to decrease, and it is speculated that the growth of Monascus slowed down from the 12th day. From 12d to 21d, the growth slowdown rate of the engineered bacteria was lower than that of the wild type. This result shows that the reduction in the expression level of the RMP gene promotes the increase of the biomass of the bacteria. At the same time, the reduction in the level of this gene also effectively inhibits the rate of bacterial decay.

[0136] The results of the spore yield determination of wild-type Monascus and RMP engineered bacteria are shown in Figure 6 .Depend on Figure 6 It can be seen that the spore counts of wild-type Monascus and RMP engineered bacteria showed a trend of increasing first and then decreasing. From the 3rd day to the 21st day, the spore count of RMP engineered bacteria was always higher than that of wild-type Monascus. On the 12th day, the spore count of RMP engineered bacteria reached the highest, which was 17.0×10 7 / mL, which is the number of wild-type spores (11.8×10 7 The experimental results show that the reduction of RMP gene expression level increases the number of Monascus spores and promotes the reproduction of Monascus.

[0137] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of knocking out the RMP gene in promoting the growth of Monascus purpureus, the nucleotide sequence of the RMP gene is shown in SEQ ID No.

1.

2. Application of knocking out the RMP gene in promoting spore formation of Monascus purpureus, the nucleotide sequence of the RMP gene is shown in SEQ ID No.

1.

3. Application of knocking out the RMP gene in slowing down the decay rate of Monascus purpureus, the nucleotide sequence of the RMP gene is shown in SEQ ID No.

1.

4. A genetically engineered Monascus bacterium, characterized in that: The genetically engineered Monascus was obtained by knocking out the RMP gene in Monascus.

5. A method for constructing the genetically engineered Monascus bacteria according to claim 4, characterized in that: The following steps are involved: 1) connecting the RMP gene to the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector to obtain a connection vector; the nucleotide sequence of the RMP gene is shown in SEQ ID No. 1; 2) transforming Agrobacterium with the ligated vector obtained in step 1) to obtain transformed bacteria; 3) The transformed bacteria obtained in step 2) are used to infect Monascus to construct a genetically engineered Monascus bacteria.

6. The construction method according to claim 5, characterized in that: The step 1) the pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector is double-digested with BgIII and EcoRI enzymes and then connected to the RMP gene; The enzyme digestion system is: BgIII enzyme 1 μL, EcoRI enzyme 1 μL, 10×Buffer 2 μL, pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector 1 μg, ddH2O supplemented to 20 μL; The conditions for the enzyme digestion are: 37°C for 1h; The ligation system is: 1 μL of RMP gene, 1 μL of pCAMBIA1303-TrpC-Hygro-gpdA-TEF1 vector after double enzyme digestion, 2 μL of 5×CE II Buffer, 1 μL of Exnase II, and ddH2O supplemented to 10 μL; The connection conditions are: 37°C for 30 min.

7. The construction method according to claim 5, characterized in that: In step 2), the mass ratio of the ligated vector to the volume of Agrobacterium is 0.1 μg:100 μL; The infection conditions of step 3) include: 30° C. for 24 hours.

8. Use of the genetically engineered Monascus bacteria according to claim 4 in promoting the growth of Monascus.

9. Use of the genetically engineered Monascus bacteria according to claim 4 in promoting spore formation of Monascus.

10. Use of the genetically engineered Monascus bacteria according to claim 4 in slowing down the decay rate of Monascus.

Images