Construction method and application of prefrontal cortex specific Gabre overexpression mouse model

Abstract

The invention belongs to the field of biology, and relates to a construction method and application of a prefrontal cortex specific Gabre overexpression mouse model.The construction method comprises the steps that a CAG-LSL-mGabre-3-3xFlag-WPRE-PolyA gene segment is inserted into the H11 site of a mouse in a fixed point mode through the CRISPR / Cas9 technology; the sequence behind the H11 site of the recombined mouse is as shown in SEQ ID NO. 1. The CRISPR / Cas9 system and the homologous recombinant vector are microinjected into fertilized eggs of C57BL / 6JGpt mice, and F0-generation mice are obtained; the F0-generation positive mouse and the C57BL / 6JGpt mouse which are verified to be correct through PCR (Polymerase Chain Reaction) and sequencing comate to obtain an F1-generation positive mouse model capable of stably inheriting; and mating the F1-generation mouse with a Cntnap2-CreERT2 mouse to obtain an F2-generation mouse, and carrying out gene identification on the F2-generation mouse to finally obtain a stably inherited gene editing animal.

Description

Technical Field

[0001] The invention belongs to the biological field and relates to a method for constructing a prefrontal cortex-specific Gabre overexpression mouse model and an application thereof. Background Art

[0002] ZFNs (zinc finger nuclease) technology is the first generation of genome editing technology, but it has the defects of low efficiency and time-consuming and labor-intensive. The emergence of the second-generation gene editing technology ZFN and TALEN has greatly improved the efficiency of gene editing. Both ZFN and TALEN are synthetic proteins that can produce sticky overhang DSBs after cutting the target sequence. ZFN and TALEN have greatly accelerated the development of gene editing technology, but in the application process, their complex protein design, expensive cost and high difficulty still limit the widespread application of gene editing technology. The third-generation gene editing technology CRISPR / Cas9 system does not require the design of complex DNA binding proteins and the fusion process of DNA binding proteins and Fok I nuclease. sgRNA can be quickly designed and preliminarily screened through software. At the same time, by changing a small sequence in sgRNA, the CRISPR / Cas9 system can quickly edit other gene sites.

[0003] The gamma-aminobutyric acid type A receptor subunit epsilon (Gabre) is the fifth subunit of the heteropentameric GABA-gated chloride channel GABAa receptor, which mediates most of the fast synaptic inhibition in the mammalian brain. GABAa receptor-mediated GABAergic transmission defects are related to the etiology of anxiety, mood disorders and schizophrenia. For example, increased expression of Gabre protein was found in the cerebellum of patients with schizophrenia. The prefrontal cortex (PFC) is located in the front of the frontal lobe of the brain and is an important area responsible for higher cognitive functions. It plays a key role in working memory, decision-making, emotional regulation, behavioral planning and strategy. A large number of studies have shown that the occurrence of schizophrenia may be related to abnormalities in the relevant structures and functions of the prefrontal cortex. However, there are few studies on the role of Gabre protein in the prefrontal cortex of schizophrenia. Therefore, it is urgent to provide a mouse with Gabre overexpression in the prefrontal cortex. Through modern genetic engineering technology, the activity of Gabre in the mouse cortex can be intervened to study the various functions of the Gabre gene, such as GABA transmitter transmission, GABA A Receptor presentation, neuronal synaptic plasticity, etc. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides a method for constructing a prefrontal cortex-specific Gabre overexpression mouse model and its application. The present invention rationally designs and modifies sgRNA to ensure the high specificity and low off-target rate of the constructed homologous recombination vector. The target gene to be edited and its vector are introduced into the mouse body by microinjection to achieve stable inheritance of the editing of the target gene, and finally obtain gene-edited animals with stable inheritance.

[0005] The technical solution provided by the present invention is as follows:

[0006] The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model comprises the following steps: using CRISPR / Cas9 technology to site-specifically insert a CAG-LSL-mGabre-3-3xFlag-WPRE-PolyA gene fragment into the H11 site of the mouse; the sequence after the H11 site of the recombinant mouse is shown in SEQ ID NO.1.

[0007] Furthermore, the CRISPR / Cas9 system and homologous recombination vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice to obtain F0 mice; the F0 positive mice verified correct by PCR and sequencing were mated with C57BL / 6JGpt mice to obtain a stably inherited F1 positive mouse model; the F1 mice were mated with Cntnap2-CreERT2 mice to obtain F2 mice and their genes were identified.

[0008] Furthermore, a homologous recombination vector carrying the target site homologous region and the target fragment was constructed; the transcribed gRNA and Cas9 system and the purified homologous recombination vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice to obtain F0 generation mice.

[0009] Furthermore, the identification primers of the homologous recombination vector are as follows:

[0010] 1213515-SeqF1:tccccatcaagctgataaca;

[0011] 1213515-SeqR2:GCTCTGATTTCATTCCTGGC;

[0012] 1213515-SeqF5:tgtcaccacaatgctctcct;

[0013] H11-3arm-TR: CTCAGGACCTCTGAAAGACC.

[0014] Furthermore, the sequence of gRNA is 5′-CTGAGCCAACAGTGGTAGTA-3′.

[0015] Further, the identification primers for F0 generation mice are as follows:

[0016] H11-tF2:ATGCCCACCAAAGTCATCAGTGTAG;

[0017] H11-CAG-5tR2: AGGCGGGCCATTTACCGTAAGTTA;

[0018] H11-tF1: TCACGTTCAGACTCCTCAGAATGT;

[0019] H11-CAG-5tR1:TCAATGGAAAGTCCCTATTGGCGT;

[0020] WPRE-tF1: TCAATCCAGCGGACCTTCCTT;

[0021] H11-tR2:TCACAGAAACCATATGGCGCTCC;

[0022] WPRE-tF1: TCAATCCAGCGGACCTTCCTT;

[0023] H11-tR1: GACCCACTATTCTGCACCACTCATTAG;

[0024] H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT;

[0025] H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

[0026] Further, the identification primers for F1 generation mice are as follows:

[0027] H11-tF2:ATGCCCACCAAAGTCATCAGTGTAG;

[0028] H11-CAG-5tR2: AGGCGGGCCATTTACCGTAAGTTA;

[0029] H11-tF1: TCACGTTCAGACTCCTCAGAATGT;

[0030] H11-CAG-5tR1:TCAATGGAAAGTCCCTATTGGCGT;

[0031] WPRE-tF1: TCAATCCAGCGGACCTTCCTT;

[0032] H11-tR2:TCACAGAAACCATATGGCGCTCC;

[0033] WPRE-tF1: TCAATCCAGCGGACCTTCCTT;

[0034] H11-tR1: GACCCACTATTCTGCACCACTCATTAG;

[0035] H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT;

[0036] H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

[0037] Further, the identification primers for F2 generation mice are as follows:

[0038] H11-tF3:GGGCAGTCTGGTACTTCCAAGCT;

[0039] CAG-tR1: TGGCGTTACTATGGGAACATACGTC;

[0040] WPRE-tF1: TCAATCCAGCGGACCTTCCTT;

[0041] H11-tR3:ATATCCCCTTGTTCCCTTTCTGC;

[0042] H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT;

[0043] H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

[0044] The present invention also provides the use of the prefrontal cortex-specific Gabre overexpression mouse model constructed by the above method in the preparation of drugs.

[0045] Furthermore, the drug is a schizophrenia drug.

[0046] Beneficial Effects

[0047] The present invention uses the CRISPR / Cas9 system to establish an animal model of Gabre overexpression in the prefrontal cortex. The process is simple, low-cost, large-scale, high-throughput, and high-editing efficiency, which can help study the related functions of the Gabre gene in prefrontal cortical neurons. The present invention rationally designs and modifies sgRNA to ensure the high specificity and low off-target rate of the constructed homologous recombination vector. The target gene to be edited and its vector are introduced into the mouse body by microinjection, so that the editing of the target gene can be stably inherited, and finally a gene-edited animal with stable inheritance is obtained.

[0048] The present invention studies whether the mouse has schizophrenia behavior and related molecular physiological mechanisms based on the constructed prefrontal cortex-specific Gabre overexpression mouse model. The overexpression mouse constructed by the present invention has increased Gabre protein expression targeting the prefrontal cortex compared with WT mice, has defects in short-term memory and social interaction ability, and also shows schizophrenia-like behavioral characteristics such as strong hyperactivity. Overexpression mice can be bred with various Cre tool mice to start Gabre gene overexpression, and then generate Gabre overexpression mice in different regions, which can be used to study various functions of Gabre genes, such as abnormal neurotransmitter and synaptic transmission, synaptic plasticity and development of the nervous system. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is a map of homologous recombination vectors.

[0050] Figure 2 This is a diagram of the homologous recombination vector identification results.

[0051] Figure 3 This is a diagram of the homologous recombination vector identification results.

[0052] Figure 4 This is a design strategy diagram. Wild type: ①②PCR reaction did not obtain the Target band; ③PCR reaction can obtain a single WT band; Heterozygous: ①②PCR reaction can obtain the Target band; ③PCR reaction can obtain a single WT band; Homozygous: ①②PCR reaction can obtain the Target band; ③PCR reaction did not obtain a single WT band.

[0053] Figure 5 This is a diagram of the F1 generation mouse identification strategy.

[0054] Figure 6 This is the result of F1 generation mouse identification. Note: The numbers are the mouse tail numbers, WT is C57BL / 6JGpt, N is the blank control, and M is the DNA Marker.

[0055] Figure 7 For Gabre fl / fl; Gabre protein immunoblot results of Cre(CKI) mice targeting the prefrontal cortex and WT mice.

[0056] Figure 8 For Gabre fl / fl ; Immunofluorescence experiment results of Gabre protein expression in Cre(CKI) mice targeting the prefrontal cortex and WT mice.

[0057] Fig. 9 For Gabre fl / fl ; Results of novel object recognition test in Cre(CKI) mice targeting the prefrontal cortex and WT mice.

[0058] Fig.10 For Gabre fl / fl ; Results of social interaction test and mine field test in Cre(CKI) mice targeting the prefrontal cortex compared with WT mice. DETAILED DESCRIPTION

[0059] Gabre gene overexpression mice: The name is H11-CAG-LSL-mGabre-3×Flag-WPRE-PolyA, the background is C57BL / 6JGpt, and it is the mouse generated for this project.

[0060] Cre tool mouse: named Cntnap2-P2A-CreERT2-P2A-mCherry, background is C57BL / 6JGpt.

[0061] 1. Experimental methods

[0062] 1.1 Vector construction

[0063] According to the design plan, gRNA was designed, constructed and transcribed in vitro, and a homologous recombination vector (Donor vector) was constructed at the same time, such as Figure 1 As shown, the correctness of the vector sequence was verified by sequencing.

[0064] gDNA sequences:

[0065] gRNA name gRNA sequence (5'-3') PAM H11-S2 CTGAGCCAACAGTGGTAGTA(SEQ ID NO.3) AGG

[0066] The PCR primer names, sequences, product sizes, electrophoresis patterns and restriction site identification of the homologous recombination vector (name: GJS0220221213515-01) are as follows: Figure 2 and 3 shown.

[0067] The homologous recombination vector map is shown in the table below.

[0068]

[0069] PCR identification:

[0070]

[0071]

[0072] Enzyme digestion identification

[0073]

[0074] Using CRISPR / Cas9 technology, the CAG-LSL-mGabre-3×Flag-WPRE-PolyA gene fragment was inserted into the H11 site of the mouse. The sequence of gRNA is 5′-CTGAGCCAACAGTGGTAGTA-3′.

[0075] 1.2 Microinjection

[0076] The CRISPR / Cas9 system and Donor vector samples were microinjected into the fertilized eggs of mice with a C57BL / 6JGpt background; the fertilized eggs that survived the injection were transplanted into pseudo-pregnant female mice, which became pregnant and gave birth to obtain F0 generation mice.

[0077] 1.3 Identification of F0 generation mice

[0078] The F0 generation pups born to the recipient mice were numbered after their tails and toes were clipped at 5-7 days old, and their genomic DNA was extracted for PCR and sequencing to confirm their genotypes.

[0079] 1.4 Breeding of positive F0 generation mice

[0080] After the positive F0 generation mice reach sexual maturity, they are mated with wild-type background mice; the F1 generation mice born are numbered after their tails and toes are cut off at 5-7 days old, and their genomic DNA is extracted for PCR and sequencing identification to confirm their genotype.

[0081] 1.5 Positive F1 mice breed cre tool mice

[0082] After the positive F1 generation mice reached sexual maturity, they were mated with Cntnap2-CreERT2 mice. The mice were numbered after their tails and toes were clipped on days 5-7 after birth, and their genomic DNA was extracted for PCR and sequencing to confirm their genotypes.

[0083] 2. Specific operations

[0084] 2.1 Construction of Gabre gene knock-in mouse model

[0085] Using CRISPR / Cas9 technology, the CAG-LSL-mGabre-3×Flag-WPRE-PolyA gene fragment was site-specifically inserted into the H11 site of mice. The sequence of gRNA is 5′-CTGAGCCAACAGTGGTAGTA-3′. The CRISPR / Cas9 system and Donor vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice to obtain F0 generation mice. The F0 generation positive mice verified by PCR and sequencing were mated with C57BL / 6JGpt mice to obtain a stable and heritable F1 generation positive mouse model. The F1 generation mice were mated with Cntnap2-P2A-CreERT2-P2A-mCherry mice to obtain F2 generation mice and their genes were identified.

[0086] 2 Identification of mouse genotype

[0087] The toes of the F2 mice were taken and genomic DNA was extracted using a kit, and the expression of the target gene was detected by PCR technology. The PCR reaction system included: 2×Mix 12.5μL, cDNA 1μL, upstream and downstream primers 1μL, ddH2O 9.5μL.

[0088] The reaction conditions are:

[0089]

[0090] The PCR primer sequences used for detection of F1 mice are as follows:

[0091]

[0092]

[0093] The PCR primer sequences used for testing F1 generation mouse offspring are as follows:

[0094]

[0095]

[0096] The reaction products were analyzed by agarose gel electrophoresis.

[0097] Identification results: 76, 79, 83, 84, and 85 mice were identified as positive by PCR and sequencing, and the F1 generation model development was completed.

[0098] The PCR primer sequences used for detection of F2 generation mice are as follows:

[0099]

[0100] Validation of prefrontal cortex-specific Gabre overexpression mice:

[0101] 1. Experimental Procedure

[0102] 1.1 Protein gel electrophoresis experimental steps

[0103] The mice were killed, and the whole brain tissue was quickly removed and sliced. The left mPFC brain region was extracted according to the "Allen Mouse Brain Atlas Second Edition" and weighed and recorded. The tissue or collected cells were then mixed with PIPA lysis buffer containing an appropriate amount of PMSF (Phenylmethanesulfonylfluoride), protease inhibitors, phosphatase inhibitors, and EDTA (Ethylene Diamine Tetraacetic Acid), and grinding beads were added to the tissue grinder for grinding (60Hz, run for 60s, stop for 3s, 10 times). After shaking quickly on ice for 30min, centrifuged at 14000×g for 30min at 4℃, carefully removed the supernatant, quantified by BCA, added an appropriate amount of loading buffer, placed in a 95℃ metal bath for heating for 5min, and quickly placed on ice for cooling and packaging, and stored in a -80℃ refrigerator for later use. The protein samples were electrophoresed on gels at 120 V for 70-90 min and transferred to 0.22 μm polyvinylidene fluoride (PVDF) membranes (Millipore Corp., USA) at 300 mA. The membranes were blocked with TBST containing 3% bovine serum albumin (BSA) or 5% skim milk for 1 h at room temperature and incubated with Gabre primary antibody (1:100; Santa Curz Biotechnology, sc-271668) at 4 °C overnight. The next day, the membranes were washed with TBST for 10 min three times and then incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibodies. After the incubation was completed, the membranes were washed again with TBST for 10 min three times. Finally, the protein bands were detected using the ECL (Enhanced chemiluminescence) system, and protein quantification was obtained using ImageJ software. GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) was used as an internal reference protein for semi-quantitative analysis.

[0104] 1.2 Immunofluorescence experimental steps

[0105] After deep anesthesia with 1% pentobarbital, mice were perfused transcardially with cold PBS (phosphate buffered saline) for 5 minutes, and then replaced with 4% PFA (paraformaldehyde) for 5 minutes. The whole brain was quickly removed and immediately fixed in 5 volumes of 4% PFA overnight, and then dehydrated in gradient sucrose (15-30%) for 72 hours, all at 4°C. After the brain was dehydrated, it was frozen with OCT glue and cut from the brain sample using a Leica cryostat (CM1900, Germany) 30μm thick coronal slices, and then sandwiched into a 12-well plate with antifreeze buffer and placed in a -20°C refrigerator for use. The brain slices were rewarmed and permeated, and then incubated with blocking solution (5% fetal goat serum and 0.3% Triton X-100 in 1× PBS) for 1.5h, followed by the addition of mouse GABAARε antibody (1:50; santa curz Biotechnology, sc-271668) and incubated at 4°C overnight. The whole operation was protected from light. After washing with 1XPBS, the corresponding secondary antibodies labeled with different fluorescent colors (ThermoFisher Scientific) were selected according to the source of the primary antibody and incubated for 1.5 hours. After washing with PBS, the brain slices were mounted on poly-lysine-coated slides, and anti-fluorescence quenchers containing DAPI (4',6-diamidino-2-phenylindole, Abcam, AB104139) were added to seal the slides. All slides were imaged using a FV1000 laser confocal microscope (Olympus, Japan).

[0106] 1.3 Behavioral Experimental Procedures

[0107] Behavioral testing

[0108] Unless otherwise stated, behavioral tests were performed in a room with constant background sound and ambient lighting of approximately 25-30 lux (lumens / m2). The temperature and pressure of the behavior room were monitored and kept constant. All behavioral experiments recorded mouse behavior with a charge-coupled device (CCD) camera (Sony, Tokyo, Japan) and tracked and analyzed using the ANY-MAZE behavioral monitoring system (Stoelting Co., Wood Dale, IL, USA). After each test, all instruments were wiped with 70% ethanol to prevent the odor of previously tested mice from affecting the accuracy of subsequent tests. All behavioral tests were performed by an experimenter who was unaware of the treatment conditions.

[0109] Novel Object Recognition Test (NORT)

[0110] The test site was a white resin glass box (30cm×40cm×30cm) with two novel objects of the same size and texture but different shapes. The test was divided into three stages. (a) Acclimation: 24h before the test, each test mouse was placed in the center of the test box and allowed to freely explore and adapt in an open area without any objects for 3min. (b) Training: 2h before the test, two identical objects (F1 and F2) were symmetrically placed in the glass box, about 10cm away from the box wall. Each test mouse was placed from the center of the test box to freely explore the two identical objects for 3min. (c) Test: A new object (N) replaced an old object (F) that appeared in the training phase. Each test mouse was placed from the center of the test box and allowed to freely explore for 3min. A manual stopwatch and video software simultaneously recorded the time the test mouse smelled or touched the object with its nose and / or forepaws. The cognitive function of rats was measured by DI (Discrimination index) DI = [(TF-TN) / (TF+TN)X100%].

[0111] Social Interaction Test (SIT)

[0112] 24h before the test, the test mice were placed in the test box to adapt and confirm the initial unbiased preference. The test box is made of white resin glass, separated by baffles into three chambers (45cmX15 cmX35 cm), and two side chambers contain the same cylinder made of wire mesh (15cm in diameter, 25cm in height). Each test mouse was placed in the center of the test box during adaptation, and was allowed to explore the three chambers for 10min without the presence of an empty cylinder. In the test phase, a female stimulus mouse (different cages) was placed in a cylinder in a side chamber as a social target, and then the test mouse was placed in the middle chamber to allow it to freely explore all chambers for 5min. The time when the test mouse sniffed or contacted the stimulus cylinder was defined as Tm "sniffing time" (the time when the four limbs climbed up the cage at the same time was not recorded), T0 was "the time to explore the empty cylinder", and the social tendency of the test mouse was calculated by the formula Time in side % = (Tm) / (Tm + T0) * 100%.

[0113] Open Field Test (OFT)

[0114] The open field test was used to assess the psychotic activity of mice. The test mice were placed in the center of the test box (45 cm × 45 cm × 35 cm) and allowed to move freely for 5 min. The digitized images of the path and distance traveled were recorded by video tracking to measure the locomotor activity of each mouse.

[0115] 2. Experimental results

[0116] 2.1 Western blotting results

[0117] like Figure 7 As shown, Gabre fl / fl ; The expression of Gabre protein in the prefrontal cortex of Cre(CKI) mice was increased compared with that in WT mice.

[0118] 2.2 Immunofluorescence results

[0119] like Figure 8 As shown, the expression of Gabre protein targeted to the prefrontal cortex was increased in CKI mice compared with WT mice.

[0120] 2.3 Behavioral Experimental Results

[0121] To further understand the pathogenic effect of Gabre overexpression in the prefrontal cortex, we performed an experiment on Gabre fl / fl Cre mice and control group Gabre fl / fl WT mice were given tamoxifen for 7 days, and then allowed to rest for 10 days to allow Cre recombinase to fully cleave.

[0122] Subsequently, we conducted several behavioral tests on CKI mice, including the novel object recognition test (NORT), social interaction test (OFT), and open field test (OFT). In the novel object recognition test, the results showed that CKI mice spent more time exploring the novel object than wild-type (WT) mice, indicating a significant difference in their short-term memory ability ( Fig. 9 In the social interaction test, CKI mice spent significantly less time sniffing the stimulus mouse ( Fig.10 ), indicating impaired social interaction. In the open field test, CKI mice showed significant hyperactivity and their total distance traveled was significantly increased ( Fig.10 ). These results show that CKI mice not only have defects in short-term memory and social interaction ability, but also show strong schizophrenia-like behavioral characteristics such as hyperactivity. The above-mentioned immunoblotting and immunofluorescence experimental results verify the effectiveness of the gene mouse in overexpressing Gabre protein in the mouse prefrontal cortex; behavioral results show that the gene mouse exhibits a schizophrenia-like behavioral phenotype. The gene mouse can be mass-produced as a basic study of mental diseases related to Gabre gene and GABAA receptor.

[0123] SEQ ID NO.1: Recombinant sequence information: (the bold underline is the H11 site)

[0124]

[0125]

[0126] SEQ ID NO.2: CAG-LSL-mGabre-3×Flag-WPRE-PolyACas9-KI targeting genomic sequence

[0127] The KI fragment is bold and underlined, 1100bp to 2819bp is CAG promoter, 2820bp to 2853bp is loxp, 2854bp to 4447bp is terminator, 4448bp to 4481bp is loxp, 4502bp to 4510bp is kozak, 4511bp to 7258bp is mGabre, 7259bp to 7324bp is 3*Flag, 7325bp to 7327bp is TAG, 7328bp to 7915bp is WPRE, and 7916bp to 8147bp is polyA.

[0128]

[0129]

[0130]

Claims

1. A method for constructing a prefrontal cortex-specific Gabre overexpression mouse model, characterized in that: The following steps are involved: Using CRISPR / Cas9 technology, the CAG-LSL-mGabre-3-3xFlag-WPRE-PolyA gene fragment was site-specifically inserted into the H11 site of the mouse; the sequence after the H11 site of the recombinant mouse is shown in SEQ ID NO.

1.

2. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 1, characterized in that: The CRISPR / Cas9 system and homologous recombination vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice to obtain F0 mice; the F0 positive mice verified by PCR and sequencing were mated with C57BL / 6JGpt mice to obtain a stably inherited F1 positive mouse model; the F1 mice were mated with Cntnap2-CreERT2 mice to obtain F2 mice and their genes were identified.

3. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 2, characterized in that: A homologous recombination vector carrying the target site homologous region and the target fragment was constructed; the transcribed gRNA and Cas9 system and the purified homologous recombination vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice to obtain F0 generation mice.

4. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 3, characterized in that: The identification primers of the homologous recombination vector are as follows: 1213515-SeqF1:tccccatcaagctgataaca; 1213515-SeqR2:GCTCTGATTTCATTCCTGGC; 1213515-SeqF5:tgtcaccacaatgctctcct; H11-3arm-TR: CTCAGGACCTCTGAAAGACC.

5. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 1, characterized in that: The sequence of gRNA is 5′-CTGAGCCAACAGTGGTAGTA-3′.

6. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 2, characterized in that: The primers for identification of F0 generation mice are as follows: H11-tF2:ATGCCCACCAAAGTCATCAGTGTAG; H11-CAG-5tR2: AGGCGGGCCATTTACCGTAAGTTA; H11-tF1: TCACGTTCAGACTCCTCAGAATGT; H11-CAG-5tR1:TCAATGGAAAGTCCCTATTGGCGT; WPRE-tF1: TCAATCCAGCGGACCTTCCTT; H11-tR2:TCACAGAAACCATATGGCGCTCC; WPRE-tF1: TCAATCCAGCGGACCTTCCTT; H11-tR1: GACCCACTATTCTGCACCACTCATTAG; H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT; H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

7. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 2, characterized in that: The primers for identification of F1 generation mice are as follows: H11-tF2:ATGCCCACCAAAGTCATCAGTGTAG; H11-CAG-5tR2: AGGCGGGCCATTTACCGTAAGTTA; H11-tF1: TCACGTTCAGACTCCTCAGAATGT; H11-CAG-5tR1:TCAATGGAAAGTCCCTATTGGCGT; WPRE-tF1: TCAATCCAGCGGACCTTCCTT; H11-tR2:TCACAGAAACCATATGGCGCTCC; WPRE-tF1: TCAATCCAGCGGACCTTCCTT; H11-tR1: GACCCACTATTCTGCACCACTCATTAG; H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT; H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

8. The method for constructing a prefrontal cortex-specific Gabre overexpression mouse model according to claim 2, characterized in that: The primers for identification of F2 generation mice are as follows: H11-tF3:GGGCAGTCTGGTACTTCCAAGCT; CAG-tR1: TGGCGTTACTATGGGAACATACGTC; WPRE-tF1: TCAATCCAGCGGACCTTCCTT; H11-tR3:ATATCCCCTTGTTCCCTTTCTGC; H11-wt-tF1a:AGTCTTTCCCTTGCCTCTGCT; H11-wt-tR1a: GGGTCTTCCACCTTTCTTCAG.

9. Use of the prefrontal cortex-specific Gabre overexpression mouse model constructed by the method according to any one of claims 1 to 8 in the preparation of drugs.

10. The use according to claim 9, characterized in that: The drug is a schizophrenia drug.

Images