MGMT gene promoter methylation detection kit and application in temozolomide curative effect prediction

Abstract

The invention discloses an MGMT gene promoter methylation detection kit and application in temozolomide curative effect predication, the kit performs primer design for MGMT gene promoter methylation sites related to temozolomide curative effect predication, the detection result covers 12 CPG islands of an MGMT gene, and the accuracy is high. And the detection primer is a common PCR primer and is low in price. According to the present invention, the gold standard pyrosequencing is performed, the positive-negative determination standard for detecting the MGMT gene promoter methylation based on the nucleic acid mass spectrometry platform is constructed, and the kit can provide the MGMT degree so as to provide the reference for the temozolomide therapy drug.

Description

Technical Field

[0001] The present invention relates to the technical field of gene methylation detection, in particular to a MGMT gene promoter methylation detection kit and its application in the prediction of temozolomide efficacy. Background Art

[0002] MGMT (O6-methylguanine-DNA methyltransferase) is a DNA repair enzyme that can reverse DNA damage caused by alkylating agents, resulting in tumor insensitivity to temozolomide and nitrosourea-based chemotherapy. In gliomas, the MGMT promoter region is often methylated to a certain extent, resulting in decreased MGMT protein activity or expression, making individuals more sensitive to certain tumor drugs to a certain extent. Methylation of the CpG island of the MGMT gene promoter is of great significance in determining the prognosis of patients with brain gliomas and predicting tumor resistance to alkylating agents.

[0003] Methylation of the MGMT gene can be used as a predictive indicator for glioma patients' sensitivity to temozolomide chemotherapy and good prognosis. Methylation of the MGMT gene promoter region is related to the sensitivity to alkylating drugs. The higher the degree of methylation, the better the effect of temozolomide may be. In addition, MGMT promoter methylation is associated with the survival benefit of glioblastoma and is used for risk stratification in clinical trials. Patients with methylation of the MGMT promoter have significantly better efficacy with alkylating agents than those without methylation, and their overall survival rate and progression-free survival rate are higher. Methylation of the MGMT promoter region has predictive value for the chemotherapy efficacy of glioma with TMZ, a first-line chemotherapy drug, and is an independent indicator of good prognosis. Patients with unmethylated MGMT promoter benefit less from conventional TMZ treatment regimens, and other more effective chemotherapy regimens that help overcome drug resistance should be used for such patients.

[0004] At present, due to the complexity of methylation detection, although there are many detection methods with their own characteristics, they all have certain defects. For example, pyrophosphate sequencing, as the gold standard for methylation detection, has the advantages of being fast and highly sensitive, but the detection is often limited by operation, sequence length and other issues. Secondly, fluorescent quantitative PCR, as a new technology, has the advantages of being fast and simple in data analysis, but due to the high cost and the limitation of only qualitative but not quantitative, it cannot fully meet the clinical needs for methylation ratio and multi-CpG site detection. High-throughput gene detection technologies, such as high-throughput sequencing technology, have high costs, long detection cycles, and high technical requirements for experimental operators and data analysts, so they have not yet been widely used in clinical detection.

[0005] In summary, there is an urgent need for an economical, rapid, and easy-to-operate MGMT methylation detection method to personalize the use of temozolomide for different patients in order to achieve precise medication and treatment needs. Summary of the invention

[0006] The present invention provides MGMT gene promoter methylation detection primers, and applies them to a nuclear mass spectrometry platform for methylation detection, thereby realizing economical, rapid, and easy-to-operate methylation detection, and can evaluate the efficacy of temozolomide for different patients in a personalized manner, thereby meeting the needs of accurate medication and treatment.

[0007] The first aspect of the present invention is to provide primers for detecting methylation of the promoter of MGMT gene, the nucleotide sequences of which are shown in SEQ ID NO: 1-2.

[0008] The second aspect of the present invention is to provide a kit for detecting methylation of the promoter of the MGMT gene, characterized in that it comprises the primers described in the first aspect.

[0009] Furthermore, the kit also includes one or more of a CT conversion reagent, an amplification reaction solution, dNTPs, water, and a DNA polymerase.

[0010] The third aspect of the present invention is to propose the use of the primers described in the first aspect or the kit described in the second aspect in the preparation of a product for detecting methylation of the MGMT gene promoter.

[0011] The fourth aspect of the present invention is to propose a method for detecting MGMT gene promoter methylation based on a nucleic acid mass spectrometry platform for non-diagnostic purposes, the steps comprising:

[0012] The sample to be tested is subjected to sulfite treatment;

[0013] Perform DNA amplification on the sample to be tested using the primers described in the first aspect;

[0014] Perform SAP reaction and enzyme digestion on the amplified product;

[0015] The products after enzyme digestion are desalted by resin and spotted on the chip;

[0016] The detection is performed based on a mass spectrometer, and the methylation results are analyzed based on the detection data.

[0017] The fifth aspect of the present invention is to propose the use of the primers described in the first aspect or the kit described in the second aspect in the preparation of a product for predicting the efficacy of temozolomide.

[0018] Furthermore, the predicted product detects MGMT gene promoter methylation through a nucleic acid mass spectrometry platform.

[0019] Furthermore, the predicted product also includes one or more of a SAP reaction reagent, an enzyme cleavage reaction reagent, a desalting resin and a spotting chip.

[0020] Furthermore, the working concentration of the primer is 1 μM.

[0021] Furthermore, the prediction product also includes a quality control line; the MGMT gene promoter methylation detection process is based on the average of multiple test results and their SD value, and then combined with the quality control line to make a negative or positive judgment

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention designs primers for major methylation sites related to the prediction of temozolomide efficacy, can realize specific detection of methylation conditions related to the prediction of temozolomide efficacy, and the detection results cover a total of 12 CPG islands of the MGMT gene, with high accuracy; the detection primers are common PCR primers, without fluorescent labels, and the detection cost is low; and the positive and negative judgment standards are constructed by benchmarking the gold standard pyrophosphate sequencing to indicate the methylation degree, realizing the leap from theoretical application to practical application of methylation detection based on a nucleic acid mass spectrometry platform, and providing a reference for individualized temozolomide medication.

[0024] The primers provided by the present invention are obtained through modification optimization and large sample test screening, and can accurately type the samples, and can also meet the requirements of mass spectrometry detection technology, thereby realizing the application of the MassARRAY platform to perform rapid and effective detection of temozolomide efficacy prediction. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a ROC curve diagram drawn according to the pyrophosphate sequencing results of Example 1 of the present invention.

[0026] Figure 2 This is a result diagram of the pyrophosphate sequencing ROC curve threshold delineation table according to Example 1 of the present invention.

[0027] Figure 3 This is a diagram of the MassArray results of the MGMT_1_CpG_1.2 CpG island provided in Example 1 of the present invention.

[0028] Figure 4 This is a diagram of the MassArray results of the MGMT_1_CpG_3.4.5 CpG island provided in Example 1 of the present invention.

[0029] Figure 5 This is a diagram of the MassArray results of the MGMT_1_CpG_6.7 CpG island provided in Example 1 of the present invention.

[0030] Figure 6 This is a diagram of the MassArray results of the MGMT_1_CpG_8.9.10 CpG island provided in Example 1 of the present invention.

[0031] Figure 7This is a diagram of the MassArray results of the MGMT_1_CpG_11.12 CpG island provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0032] The technical solution of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] In the first embodiment, a primer pair for detecting CPG islands related to the prediction of temozolomide efficacy is provided, and the main methylation sites related to the prediction of temozolomide efficacy are designed, and the methylation conditions related to the prediction of temozolomide efficacy can be specifically detected, and the detection results cover a total of 12 CPG islands of the MGMT gene, with high accuracy; the detection primers are ordinary PCR primers, without fluorescent labels, and the detection cost is high; and the gold standard pyrophosphate sequencing is used to construct a positive and negative judgment standard to indicate the degree of methylation, so as to achieve a leap from theoretical application to practical application of methylation detection based on a nucleic acid mass spectrometry platform, and provide a reference for individualized temozolomide medication. In addition, the primer set provided is obtained by modification optimization and large sample test screening, and all primer sequences can accurately type the samples, and can also meet the requirements of mass spectrometry detection technology, so as to realize the application of MassARRAY platform to rapid and effective detection of temozolomide efficacy prediction.

[0034] In the above embodiment, the CPG islands corresponding to the prediction of temozolomide efficacy include: MGMT_1_CpG_1.2, MGMT_1_CpG_3.4.5, MGMT_1_CpG_6.7, MGMT_1_CpG_8.9.10, and MGMT_1_CpG_11.12.

[0035] It is understandable that the above embodiment treats the nucleic acid with bisulfite so that the methylated cytosine (C) remains unchanged, and the unmethylated cytosine (C) becomes uracil (U), and then the target fragments are enriched by PCR technology for the nucleic acid treated with bisulfite, and the technical principle of T7 reverse transcription and RNaseA specifically cutting the connection between uracil (U) and other nucleotides is used to achieve reverse transcription and enzyme fragmentation of the enriched fragments. After the above process, the unmethylated cytosine (C) in the nucleic acid becomes adenine (A), and the methylated cytosine (C) becomes guanine (G), and the difference in the molecular weight of the adenine (A) and guanine (G) bases is used to judge the degree of methylation of the product after enzyme cleavage.

[0036] It is understandable that the primer pair described in the above embodiment is a PCR primer pair. When designing the CPG island of the above MGMT gene, first locate the CPG island in the target sequence, and modify the target sequence according to the CPG island information (the C base of the CPG island remains unchanged, and the C base of the non-CPG island is modified to the T base); secondly, design the amplification primers, and use the primer design software (Primer5, NCBI blast, etc.) to complete the primer design and specificity comparison; then add the adapter of the forward and reverse primers and perform TM value analysis. The TM value of the primer after adding the adapter is recommended to be between ±2; finally, perform the process test and make further optimization according to the offline results. .

[0037] Further, the genotypes of each site are listed, as shown in the following table:

[0038] Table 1: Correspondence table of genotypes at each site

[0039]

[0040] In the above embodiment, the temozolomide efficacy prediction test detects the methylation status of the human MGMT gene by means of gene detection technology to find out the temozolomide medication levels of different individuals.

[0041] It should be noted that in order to solve the problem of unevenness in the bisulfite treatment process of CT conversion in methylation detection (due to problems such as reagent purity, sample and processing time, CT conversion may be incomplete or over-converted, resulting in false negative or false positive results), this scheme adopts a three-parallel test on a single sample and performs the following analysis on the result data:

[0042] (1) If the average of three replicates was <0.14 and the mean SD was ≤0.05, the result was considered negative;

[0043] (2) If all data points tested were < 0.14, the result was considered negative;

[0044] (3) The mean of the three repeated means < 0.14 and the mean SD > 0.05. If the mean of the three repeated values ​​is < 0.14, the result is considered negative;

[0045] (4) The result was considered positive if the average of the three replicate means was ≧0.14 and the SD of the three means was ≦0.10 and the SD of at most one of the five sites was >0.15;

[0046] (5) If all data points tested were ≥ 0.14, the result was considered positive;

[0047] (6) The average of the three replicates was ≥ 0.14 and the mean SD was > 0.10 or more than one of the five sites had a SD > 0.15. If the average of the three replicates was ≥ 0.14, the result was considered positive;

[0048] The calculation results according to this scheme can greatly reduce the unstable effect of bisulfite treatment;

[0049] It should be noted that in order to save samples and costs as much as possible in the pre-test of temozolomide efficacy, all 12 CpG islands were tested in the same test well;

[0050] It should be noted that, due to the large sequence changes after bisulfite treatment, the proportion of A / T bases in the sequence increases, so a 10-base tag (AGGAAGAGAG) is added to the forward primer to balance the Tm value of the forward and reverse primers to ensure the normal operation of the PCR reaction;

[0051] It should be noted that in order to ensure normal reverse transcription and subsequent amplification, a T7 promoter sequence (CAGTAATACGACTCACTATAGGG) is added to the reverse primer, and an 8-base sequence (AGAAGGCT) is inserted to avoid failure of the PCR cycle.

[0052] It is understood that in order to ensure that the PCR amplification primers have no non-specific matches, the design results are compared with the human genome using a professional website (h ttps: / / www.ncbi.nlm.nih.gov / ) to ensure specificity;

[0053] It should be noted that the design results still need to be evaluated by experimental results. For the adjustment of the yield of the bisulfite treatment product, the bisulfite experimental process is taken as an example. Process 1: 5μL M-Dilution Buffer + 45μL DNA pure compound, gently shake for 3-5s, centrifuge, place the sample at 37℃ for 15min, and optimize it to incubate at 37℃ for 25min; Process 2: CT transformation place the sample at 50℃ for 12-16h, and the incubation conditions are optimized to (95℃, 30s; 50℃15min) 20cycles, 4℃hold; Process 3: Before nucleic acid elution, add a step to change the collection tube and leave it empty for 3min; change the collection tube, open the cover and evaporate for 5min; Process 4: 30ul enzyme-free water is used for elution, and the enzyme-free water is optimized to be incubated at 56℃ in advance during elution, 2 elutions, 15ul is added each time, and centrifugation is collected after standing for 3min. After optimization, the concentration of bisulfite nucleic acid has been significantly improved, as shown in Table 2 and Table 3.

[0054] Table 2: Bisulfite treatment experimental process before optimization

[0055] sample A260 / 280 A260 / A230 concentration 1-Before optimization 1.99 1.74 23.7 2- Before optimization 1.75 1.04 11.8 3- Before optimization 1.79 1.32 14.7 4-Before optimization 2 1.49 27.7 5-Before optimization 2.04 1.93 17.4 6-Before optimization 1.98 1.46 29 7-Before optimization 2.07 1.77 25.3 8-Before optimization 2.05 1.79 28.6 9-Before optimization 1.96 1.57 18.6 10-Before optimization 1.82 1.42 16.8

[0056] Table 3: Bisulfite treatment experimental process after optimization

[0057] sample A260 / 280 A260 / A230 concentration 1-After optimization 2.12 2.03 45.7 2-After optimization 2.24 1.49 20.6 3-After optimization 2.44 1.7 21.2 4-After optimization 2.03 1.73 30.4 5-After optimization 2.02 1.93 24.6 6-After optimization 2 1.58 36.7 7-After optimization 2 1.62 29.5 8-After optimization 1.98 1.86 33.1 9-After optimization 2.03 2.42 28.3 10-After optimization 2.05 1.78 20.8

[0058] It should be noted that the design results still need to be evaluated by experimental results, and unqualified primers should be adjusted. Taking the MGMT primer as an example, the primer was optimized from: aggaagagagGGATATGTTGGGATAGTTCG CGTTTTT to: aggaagagagGGATATGTTGGGATAGTT. After optimization, the detection results were significantly improved as shown in Tables 4 and 5.

[0059] Table 4: Primer experimental results before primer design optimization

[0060]

[0061] Table 5: Experimental results after primer design optimization;

[0062]

[0063] It should be noted that in the actual detection process, the primer ratio will have a direct impact on the detection effect. Taking MGMT primers as an example,

[0064] The working concentration of forward and reverse primers was optimized from 0.5 pmol / ul to 1 pmol / ul. After optimization, the detection results were significantly improved as shown in Tables 6 and 7.

[0065] Table 6: Experimental results before optimization of primer working concentration

[0066]

[0067] Table 7: Experimental results after optimization of primer working concentration

[0068]

[0069] It is understandable that there will be a variety of sheared nucleic acid fragments in the detection well. In order to ensure that the detection results of each CpG island do not interfere with each other, professional software is required to classify and set each fragment. At the same time, the quality of each sheared fragment is calculated through manual verification, and unqualified fragments are adjusted.

[0070] Specifically, the corresponding relationship between the detected CpG islands and the types of drugs is shown in Table 8 below:

[0071] Table 8: Detection sites and corresponding disease types

[0072]

[0073] It should be noted that in order to ensure the accuracy of the test results, the present invention uses the gold standard of methylation detection industry - pyrophosphate sequencing to perform the same sample test and draws the ROC curve through professional analysis software to determine that the threshold of MGMT methylation detection in the present invention is 0.14. Figure 1 , Figure 2 shown.

[0074] In the second embodiment, the use of the above-mentioned primer set for the CPG island related to the prediction and detection of temozolomide efficacy in the preparation of a temozolomide efficacy prediction and detection product is provided.

[0075] In a third embodiment, a product for predicting the efficacy of temozolomide is provided, wherein the product comprises the above-mentioned primer set.

[0076] This product can specifically detect site mutations related to the prediction of temozolomide efficacy. It has low detection cost, short cycle, simple operation and high accuracy. It has great clinical application value and very broad market promotion prospects.

[0077] In some specific embodiments, the product for detecting the prediction of temozolomide efficacy also includes reagents and / or devices for detecting CPG islands.

[0078] It is to be understood that the reagents and / or devices for detecting CPG islands may be conventional general reagents and / or devices commercially available for detecting CPG island nucleotides in the art, for example, may be reagents or kits for detecting CPG island nucleotides, or may be kits comprising reagents for detecting CPG island nucleotides.

[0079] In some specific embodiments, the reagents include Complete EpiTYPER Methylation Reagent Set, EZ DNA Methylation Kit, HotStar Taq DNA Polymerase (250 U), MGMTMethylation and ultrapure water; the equipment includes a device for detecting C PG island nucleotides using MassARRAY, and the equipment includes MassARRAY CPM.

[0080] In a fourth embodiment, a method for detecting CPG islands related to the prediction of temozolomide efficacy is provided, the method comprising using the above-mentioned primer set to detect nucleotides of the CPG islands in the genome of the sample to be tested.

[0081] The method can detect 12 CPG islands of the MGMT gene related to the prediction of temozolomide efficacy based on the primer set provided above, and has the characteristics of high accuracy, high sensitivity, good repeatability, low cost, short detection cycle, intuitive results, etc.

[0082] It can be understood that the method can detect the entire genome of the sample to be tested, or it can screen specific genes for detection (for example, detecting specific genes such as MGMT_1_CpG_1.2, MGMT_1_CpG_3.4.5, MGMT_1_CpG_6.7, MGMT_1_CpG_8.9.10, and MGMT_1_CpG_11.12). When specific genes are detected, there is less interference and the test results are more accurate.

[0083] In some preferred embodiments, the above primer pairs are used to perform PCR amplification and enzyme digestion reactions on the genome of the sample to be tested, and then the MassARRAY system is used to detect the reaction products to determine the nucleotides of the CPG island in the genome of the sample to be tested.

[0084] MassARRAY gene analysis technology is based on MALDT-TOF time-of-flight mass spectrometry technology. It first treats the sample with sulfite, then amplifies the target sequence by PCR, and then adds specific endonucleases as needed to specifically shear the amplified sequence. This technology uses the high sensitivity of mass spectrometry to mass, which can effectively distinguish two gene sequences with different bases, and then infer the proportion of MGMT methylation.

[0085] In the preferred embodiment, the MassARRAY system is used for detection, which realizes the detection method of multiple gene loci using a single platform, greatly improves the detection efficiency, is particularly suitable for batch detection, and provides a reference for personalized temozolomide medication.

[0086] Preferably, the method further comprises the step of enzymatically digesting the reaction product after amplification, and then detecting the reaction product using MassARRAY. Specifically, the reaction product can be purified by resin salt removal.

[0087] The main reagent information used in the examples is as follows:

[0088]

[0089] The main instrument information used in the examples is as follows:

[0090]

[0091] Example 1 Primer design and reaction system establishment

[0092] Through MassARRAY primer design software (Assay Design Suite), adjust the relevant parameters, complete the pre-design of PCR primers and enzyme fragments for 12 sites, export the designed primers and parameter files, and synthesize primers. Table 9 is the preparation of PCR primer mix, and then perform primer testing.

[0093] Table 9: PCR primer mix preparation

[0094] Well Gene Concentration (pmol / ul) add(μl) W1 MGMT 100 / 100 5 / 5 W1 water 0 490

[0095] The specific steps are as follows:

[0096] 1. Bisulfite treatment

[0097] 1) Take 45 μL DNA, add 5 μL M-Dilution Buffer, shake gently for 3-5 seconds, centrifuge, and incubate the sample at 37℃ for 25 minutes; do not shake violently or repeatedly.

[0098] 2) Prepare CT Conversion Reagent according to Table 10:

[0099] Table 10: CT Conversion Reagent Preparation

[0100]

[0101] After preparation, vortex and shake for 5-10 minutes until completely dissolved, and mix well until use within 5 minutes. Turn off the fluorescent light on the workbench when preparing and using the conversion reagent;

[0102] 3) After incubation, centrifuge immediately. Add 100 μL of prepared CT Conversion Reagent to each sample, vortex to mix, and centrifuge immediately. Do not vortex violently or repeatedly.

[0103] 4) Put it on the PCR instrument and perform the following thermal cycle incubation:

[0104]

[0105] 5) Prepare M-Wash Buffer by adding 24 mL of anhydrous ethanol to M-Wash Buffer Concentrate and shaking to mix.

[0106] 6) After the PCR is completed, the samples are quickly separated and placed on ice for 15 minutes. The tube cap does not need to be covered with ice;

[0107] 7) After the ice bath is complete, transfer the sample to a 1.5 mL centrifuge tube. Add 400 μL M-Binding Buffer and mix by pipetting 20 times.

[0108] 8) Transfer the sample to a centrifuge column and centrifuge at a speed of more than 10,000 g for 1 min;

[0109] 9) Add 200 μL M-Wash Buffer to the centrifuge column and centrifuge at a speed of more than 10,000 g for 1 min;

[0110] 10) Add 200 μL M-DesμLphonation Buffer to the centrifuge column and place at room temperature (20-30°C) for 15 min. Centrifuge at a speed of more than 10,000 g for 1 min.

[0111] 11) Add 200 μL M-Wash Buffer to the centrifuge column and centrifuge at a speed of more than 10,000 g for 1 min. Repeat the operation once;

[0112] 12) Replace the collection tube and leave it empty for 3 minutes, discard the remaining liquid and open the cover to evaporate for 5 minutes;

[0113] 13) Add 15 μL of 56°C enzyme-free water to the center of the centrifuge column membrane, incubate at room temperature for 3 minutes, and then centrifuge at a speed of more than 10,000 g for 1 minute. Repeat the operation once;

[0114] 2. PCR reaction

[0115] 1) Prepare the PCR reaction system according to Table 11 (the following is the amount of a single sample)

[0116] Table 11: PCR reaction system

[0117]

[0118] Note: The samples treated with bisulfite need to be repeated three times and the results will be analyzed later.

[0119] 2) After the PCR mix is ​​prepared, mix it with a Vortext instrument, centrifuge it, and transfer it to a 384-well plate. Add 3 μL of the mixture and 2 μL of DNA to each well.

[0120] 3) After adding the sample, seal the plate, centrifuge to the maximum speed, and place the plate on the PCR instrument for the following thermal cycles:

[0121]

[0122] 4) Shrimp alkaline phosphatase digestion (SAP)

[0123] Take out the PCR plate, centrifuge at 4000 rpm for 1 minute, and prepare the SAP reaction system according to Table 12 (the following is the amount of a single sample):

[0124] Table 12: SAP reaction system

[0125]

[0126] Add 2 μL of SAP mixture to each reaction well, seal the film, vortex mix for 30 seconds, centrifuge at 4000 rpm for 1 minute, and place the plate on the PCR instrument for the following thermal cycle:

[0127] Temperature(℃) time 37 20min 85 5min 10 Insulation

[0128] 3. MassCLEAVE reaction

[0129] After SAP, take out the 384 plate, centrifuge at 4000 rpm for 1 minute, and prepare the MassCLEAVE reaction system according to Table 13 (the following is the amount of a single sample):

[0130] Table 13: EXT reaction system

[0131]

[0132] After the MassCLEAVE mix is ​​prepared, take a new 384 plate, add 5 μL of MassCLEAVE mix to each well, then add 2 μL of SAP product, seal the plate with a sealing film, and centrifuge at 4000 rpm for 1 minute;

[0133] Place the plate in the PCR machine and perform the following thermal cycles:

[0134] Temperature(℃) time 37 3h 10 Insulation

[0135] 4. Resin desalting and dispensing

[0136] The samples were desalted by resin using MassARRAY CPM and spotted onto the corresponding SpectroCHIP (chip).

[0137] 5.MALDI-TOF

[0138] The data were obtained using a MALDI-TOF (matrix-assisted laser desorption ionization-time of flight) mass spectrometer. The results of the MassARRAY test at each site were as follows: Figure 3-7 shown.

[0139] See Tables 14 and 15 for specific primer sequences and detection sequences.

[0140] Table 14: PCR primer sequences

[0141]

[0142] Table 15: CpG detection sequences

[0143] Location CpG detection sequence MGMT_1_CpG_1.2 TCAAGCGCAAAAA MGMT_1_CpG_3.4.5 TGCAAAACGCAAAGC MGMT_1_CpG_6.7 TGCAAGCA MGMT_1_CpG_8.9.10 TCCAAAAGCGCCACGCA MGMT_1_CpG_11.12 TAGCAAACGC

[0144] Example 2: Verification of the accuracy of the reaction system

[0145] During the system optimization process, each detection site has 55 samples with known results (2 Sanger and 48 MassArray) for verification and validation to confirm that the results of the detection of the present invention are accurate. After confirming the optimal reaction system, the present invention conducted an accuracy verification experiment. The specific verification scheme is as follows:

[0146] (1) Accuracy test verification plan: 55 samples were used to complete the accuracy test (see Table 10), and the test results were compared with the original results. If the consistency was greater than 90%, the verification was passed.

[0147] The specific verification process is as follows: first, according to the system provided in Example 1 of the present invention, CT conversion MIX, amplification primer MIX and enzyme digestion reaction MIX are prepared in the dosage form, and then according to the operating steps in Example 1, CT conversion, PCR amplification, shrimp alkaline phosphatase consumption, enzyme digestion reaction, resin desalting and MassARRAY CPM spot analysis are performed respectively, and the results are analyzed. The accuracy results are shown in Table 16 below.

[0148] Table 16: Raw validation results for accuracy

[0149]

[0150]

[0151]

[0152]

[0153]

[0154] By comparing the MassARRAY results of 55 samples with the original results, it can be seen that the accuracy of the system verification experiment of the present invention is 94.55%. Through verification, considering that there is a certain fluctuation in the bisulfite treatment, and the 3 inconsistent samples are all samples near the threshold, the accuracy of the present invention is better.

[0155] Example 3 Repeatability verification of the reaction system

[0156] In the process of system optimization, each detection site has 3 samples with known results and 5 replicates for intra-batch and inter-batch precision verification. The comparison results are consistent, confirming that the stability of the detection of the present invention is good. After confirming the optimal reaction system, the present invention also conducted an accuracy verification experiment. The specific verification scheme is as follows:

[0157] Repeatability test verification plan: Use 3 samples to perform 3 replicates within the batch and 3 replicates between batches to complete the repeatability test (see Table 17), and compare the test results with the original results. If the consistency is greater than 95%, the verification is passed.

[0158] The specific verification process is as follows: first, according to the system provided in Example 1 of the present invention, the CT conversion MIX, the amplification primer MIX and the enzyme digestion reaction MIX are prepared in the dosage form, and then according to the operating steps in Example 1, the CT conversion, PCR amplification, shrimp alkaline phosphatase consumption, enzyme digestion reaction, resin desalting and MassARRAY CPM spot analysis are respectively performed, and the results are analyzed. The accuracy results are shown in Table 17 below.

[0159] Table 17: Original validation results for repeatability

[0160]

[0161]

[0162] By comparing the MassARRAY results of the repeatability results with the original results, it can be seen that the repeatability accuracy of the system verification experiment of the present invention is 100%, so the present invention has good stability.

[0163] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. MGMT gene promoter methylation detection primers, characterized in that, The nucleotide sequence thereof is shown in SEQ ID NO: 1-2.

2. A MGMT gene promoter methylation detection kit, characterized in that: Comprising the primer of claim 1.

3. The kit according to claim 2, characterized in that The kit further comprises one or more of a CT conversion reagent, an amplification reaction solution, dNTPs, water and a DNA polymerase.

4. Use of the primers according to claim 1 or the kit according to any one of claims 2 to 3 in preparing a product for detecting methylation of the MGMT gene promoter.

5. A method for detecting methylation of the MGMT gene promoter based on a nucleic acid mass spectrometry platform for non-diagnostic purposes, characterized in that the steps include: The sample to be tested is subjected to sulfite treatment; Using the primers described in claim 1 to perform DNA amplification on the sample to be tested; Perform SAP reaction and enzyme digestion on the amplified product; The products after enzyme digestion are desalted by resin and spotted on the chip; The detection is performed based on a mass spectrometer, and the methylation results are analyzed based on the detection data.

6. Use of the primer according to claim 1 or the kit according to any one of claims 2 to 3 in preparing a product for predicting the efficacy of temozolomide.

7. The use according to claim 6, characterized in that: The predicted product detects MGMT gene promoter methylation through a nucleic acid mass spectrometry platform.

8. The use according to claim 7, characterized in that: The predicted product also includes one or more of a SAP reaction reagent, an enzyme cleavage reaction reagent, a desalting resin and a spotting chip.

9. The use according to claim 7, characterized in that: The working concentration of the primers was 1 μM.

10. The use according to claim 7, characterized in that: The prediction product also includes a quality control line; the MGMT gene promoter methylation detection process is based on taking the average and SD value of multiple detection results, and then combining the quality control line to make a negative or positive judgment.

Images