Construction method and application of genetic gene editing vector based on mediation of cucumber mosaic virus

Abstract

The invention relates to the field of biotechnology and biological breeding, and particularly relates to a method for constructing a single-chain guide RNA (sgRNA) vector for delivering CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) by utilizing a cucumber mosaic virus (CMV), carrying out site-specific editing on a target gene in a Cas9 transgenic plant, causing site-specific mutagenesis of plant genome DNA (Deoxyribose Nucleic Acid) by the vector to be inherited to a progeny, and not carrying the CMV in the progeny. The invention discloses a construction method of a vector pCB301R3-sgPDS and an application of the vector pCB301R3-sgPDS. The pCB301R3-sgPDS is a genetic gene editing vector based on mediation of a cucumber mosaic virus. According to the invention, sgRNA is delivered through CMV for the first time, so that fixed-point editing and seed transmission of plant target genes are efficiently realized in crops.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and biological breeding, and specifically comprises using cucumber mosaic virus (CMV) to construct a single-stranded guide RNA (sgRNA) vector for delivering CRISPR, and performing site-directed editing of target genes in Cas9-transfected plants. The site-directed mutation of plant genomic DNA caused by the vector can be inherited to offspring, and the offspring does not carry CMV. Background Art

[0002] In recent years, the emergence of CRISPR / Cas genome site-specific editing technology has opened up new avenues for plant functional genomics research and crop precision breeding, and has shown great application prospects in functional genomics research and genetic improvement of crops. Currently, more than 50 species of plants have used this technology for genome site-specific editing, including model plants, crops, fruits and vegetables, and flowers.

[0003] The most important means to obtain heritable modification of target genes by delivering CRISPR / Cas editing components into plant cells through transgenics is currently, but almost all stable heritable genomic DNA site-directed mutations obtained through plant genetic transformation currently rely on tissue culture, which has many disadvantages: it is only applicable to limited species and genotypes, is laborious and time-consuming, and may lead to unexpected trait changes. Some developmental regulators, such as transcription factors such as WUSCHEL, BABY BOOM, and GROWTHREGULATING FACTOR, have been used to improve the efficiency of genetic transformation and plant regeneration during tissue culture, but the constitutive expression of these genes interferes with the normal development of plants and still requires tissue culture. Therefore, there is an urgent need for a gene editing delivery technology platform that can deliver CRISPR components to plant germ cells or meristems to achieve gene site-directed editing that is independent of genotype and can be stably inherited to the next generation, without the need for tissue culture or by reducing tissue culture operations.

[0004] Viruses have the characteristics of fast genome replication, high protein translation efficiency, and systemic infection of the entire plant. A large number of viruses have been transformed into vectors for delivering exogenous proteins. Currently, many plant viruses have been transformed into virus-induced genome editing (VIGE) vectors. Site-directed editing of plant genomic DNA through VIGE has the following advantages: a) The efficient reproduction characteristics of viruses result in high expression of CRISPR / Cas editing components; b) viruses are transient infective in plants, and the Cas proteins / sgRNAs they express cannot be inherited to offspring; c) viruses can infect the meristems of plants, thereby causing efficient seed-transmitted gene editing; d) overcoming the species / genotype restrictions of plant transgenics. Since the loading capacity of most virus-based delivery vectors does not exceed 2.0 kb, currently only sgRNA is delivered by viruses, and heritable site-directed mutations of genomic DNA are achieved with the help of transgenic Cas9 gene plants, such as tobacco rattle virus (TRV), pea early brown virus (PEBV), barley streak virus (BSMV), and foxtail mosaic virus (FoMV) and many other plant viruses.

[0005] The large-scale expression of gene editing components in the meristem of plants is a key limiting factor in achieving heritable gene editing. Delivering Cas9 and sgRNA to meristems or egg cells can achieve relatively high seed-transmitted editing efficiency, but this has only been successful in Arabidopsis and its close relatives. By fusing a mobile RNA element (FT) or tRNA to the 3' end of sgRNA, a TRV-based heritable gene editing system was established in Cas9 transgenic Nicotiana benthamiana, and a 65-100% gene mutation efficiency can be obtained in the next generation of target gene-edited plants. The principle is that recombinant TRV carrying mobile RNA is more conducive to entering the meristem of plants. Similarly, in Arabidopsis transgenic with CBE or Cas9, offspring with genomic DNA mutations can be obtained by delivering sgRNA carrying Ile-tRNA at the 3' end through TRV. BSMV is a virus that can be seed-transmitted in wheat. The sgRNA of the target gene was inserted into the γRNA of the viral genome. The recombinant BSMV carrying sgRNA was propagated in Nicotiana benthamiana and then transferred to Cas9-transfected wheat. In the three tested wheat varieties, a gene editing seed-transmission efficiency of 12.9% to 100% was obtained, but the virus rate of the edited offspring plants was as high as 100%, which limits the practical application value of BSMV as a sgRNA delivery vector for heritable DNA site-specific modification.

[0006] In dicotyledons, the most commonly used method is to deliver sgRNA via TRV vectors to perform site-directed mutations in genomic DNA in plants with nucleases, but only in the model plants Arabidopsis thaliana and Nicotiana benthamiana can gene editing that can be directly transmitted by seeds be obtained. At present, many projects have inoculated TRV recombinant with sgRNA carrying target genes into Cas9-transfected tomato leaves, which can obtain up to 70% somatic cell editing efficiency, but the inheritance of site-directed mutations of target genes to the next generation requires tissue culture. Recently, the Voytas research group at the University of Minnesota in the United States infiltrated TRV carrying cytokinin synthesis genes (ipt) and target sgRNA into the axillary area of ​​Cas9-transfected tomato plants with the top removed, and found that the site-directed mutations of the target gene in the plants regenerated from scratch in the potential meristem of the axilla can be inherited to the next generation. This is the first time in the world that heritable gene editing has been obtained in crops by delivering sRNA via viruses in plants with Cas proteins. The main process of this method is as follows: a) TRV carrying ipt and sgRNA is inoculated into the axillary area of ​​tomato branches through Agrobacterium infiltration, b) When tomatoes are inoculated with recombinant TRV, the top must be removed and the virus-inoculated plants must be grown at 18°C ​​for 1 month, c) buds regenerated from scratch in the axillary area of ​​plant branches must be cut off individually and planted in the soil again, and grown at 28°C until the fruit is ripe. The whole process is relatively cumbersome, which prolongs the growth cycle of tomatoes. In addition, since the recombinant TRV is directly inoculated into the axillary area of ​​tomatoes through Agrobacterium infiltration, ipt is expressed in large quantities in this area, resulting in serious deformities of the regenerated buds in the potential meristem in the axillary area of ​​the plant, and there may be insertions of viral T-DNA in the regenerated buds.

[0007] Cucumber mosaic virus (CMV) is one of the pathogens with the widest host range among plant viruses and is distributed worldwide. It can infect more than 1,200 host plants, including monocots and dicots. In addition to model plants such as Nicotiana benthamiana and Arabidopsis thaliana, it also includes crops with important economic value, such as tomato, soybean, corn, pepper and cotton. CMV is a positive-sense single-stranded RNA. Its genome consists of three RNA molecules: RNA1 encodes the replication-related enzyme 1a, RNA2 encodes RNA polymerase 2a and gene silencing suppressor 2b, and RNA3 encodes movement protein (MP) and coat protein (CP). At present, the 2b region in RNA2 has been deleted to form a virus-induced gene silencing vector, and the coat CP of CMV has been deleted to transform it into an exogenous protein expression vector that cannot move systemically. The 2b protein encoded by RNA2 of the CMV genome is a gene silencing suppressor, which participates in the virus defense plant disease resistance response and is also a key factor in regulating the meristem of CMV infection of host plants. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a method for constructing a heritable gene editing vector mediated by cucumber mosaic virus and its application.

[0009] In order to solve the above technical problems, the present invention provides a method for constructing a vector pCB301R3-sgPDS: inserting the sgRNA of the target gene into the region between the CP and 3'UTR of the infectious clone pCB301R3 of the genomic RNA3 of cucumber mosaic virus (CMV) to obtain pCB301R3-sgPDS; the sgRNA of the target gene is 5'

[0010] -ggactcttgccagcaatgct-3'. pCB301R3-sgPDS is a heritable gene editing vector mediated by cucumber mosaic virus.

[0011] As an improvement of the construction method of the vector pCB301R3-sgPDS of the present invention, the following steps are included:

[0012] 1) Artificially synthesizing a 5'-3' sequence, which is a CP sequence, 20 bases containing two BsaI restriction sites, a BamHI restriction site, a Cas9 scaffold sequence, a StuI restriction site, a CMV 3'UTR, an HDV ribozyme sequence containing a SacI restriction site, and a DNA sequence with a length of 1155 bp; the DNA sequence is SEQ ID NO: 1;

[0013] 2) Plasmid pCB301R3 was double-digested with SalI and SacI, and then connected with the DNA sequence obtained in step 1) by the same enzyme digestion, and transformed to obtain vector pCB301R3-sgBsaI;

[0014] That is, the CMV genomic RNA3 infectious cloning vector pCB301R3 was double-digested with SalI and SacI, connected with the artificially synthesized sequence digested with the same enzymes, and transformed to obtain the control vector pCB301R3-sgBsaI;

[0015] 3) The editing target site 5'-ggactcttgccagcaatgct-3' of the tomato PDS gene was selected by CRISPOR-target (http: / / crispor.gi.ucsc.edu / ) online software, and primers were designed and PCR amplified. The PDS target sequence was cloned into the plasmid pCB301R3-sgBsaI with BamHI and SacI to obtain the vector pCB301R3-sgPDS.

[0016] The present invention also provides an application of a CMV-mediated heritable gene editing vector:

[0017] The plasmid pCB301R3-sgBsaI was used to construct a vector pCB301R3-sgRNA (specifically, pCB301R3-sgPDS) expressing sgRNA, and the vector was transferred into Agrobacterium, and co-infiltrated with Agrobacterium pCB301R1 and pCB301R2 into Cas9-transfected plants to directly obtain offspring with site-directed editing of the target gene.

[0018] Description: Through only one Cas9 plant genetic transformation and tissue culture operation, the sgRNA of the target gene can be delivered in the plant through recombinant CMV. No subsequent tissue culture process is required to obtain offspring with site-directed mutations of the target gene, and there is no virus in the offspring.

[0019] As an improvement of the application of the present invention: the vectors pCB301R3-sgBsaI and pCB301R3-sgPDS were transformed into Agrobacterium GV3101, respectively, and mixed with Agrobacterium pCB301R1 and pCB301R2, respectively, and then inoculated into Cas9-transformed tomatoes by infiltration.

[0020] As a further improvement of the application of the present invention: the plant phenotypes of CMV-sgPDS-infected Cas9-transformed tomatoes at different stages and high-throughput sequencing were used to detect the PDS editing efficiency in tomato system leaves at different stages.

[0021] As a further improvement of the application of the present invention:

[0022] The target recombinant virus CMV carrying the plant endogenous gene is inoculated into Cas9-transfected tomatoes. The target gene in the virus-infected plants undergoes site-directed mutation and the edited target gene is inherited to the offspring. The offspring with site-directed editing of the target gene do not carry CMV.

[0023] As a further improvement of the application of the present invention: the mixture of pCB301R3-sgBsaI Agrobacterium and pCB301R1 and pCB301R2 Agrobacterium is the recombinant virus CMV-sgBsaI, and the mixture of pCB301R3-sgPDS Agrobacterium and pCB301R1 and pCB301R2 Agrobacterium is the recombinant virus CMV-sgPDS.

[0024] The present invention relates to a method for constructing sgRNA based on CMV delivery: constructing a vector pCB301R3-sgRNA capable of inserting and expressing sgRNA based on the CMV genomic RNA3 Agrobacterium-infectious clone pCB301R3 reported by the research group in the early stage, and inoculating the vector and CMV genomic RNA1 and RNA2 into Cas9-transformed tomatoes through Agrobacterium infiltration, directly obtaining offspring with site-directed editing of the target gene. That is, by inserting the sgRNA of the target gene into the region between the CP and 3'UTR of the plasmid pCB301R3, the CMV carrying the sgRNA infects the Cas9-transformed tomatoes, and the genomic RNA3 containing the sgRNA proliferates in large quantities in the plant cells, and binds to the Cas9 protein in the cells, performing highly efficient site-directed mutation on the target gene, and the site-directed edited gene is inherited to the offspring.

[0025] In the present invention,

[0026] The acquisition of Cas9 gene-transfected tomatoes and the inoculation of viruses with Agrobacterium are as follows:

[0027] The Cas9 transgenic vector was purchased from Addgene, and the Cas9 gene transfer of tomatoes (the variety is Ailsa Craig) was commissioned to a third party, which also provided tomato seeds with high expression of Cas9;

[0028] The vectors pCB301R3-sgBsaI and pCB301R3-sgPDS were transformed with Agrobacterium and expanded, mixed with CMV Agrobacterium RNA1 and RNA3, and then inoculated into Cas9-transformed tomatoes at the 3-4 leaf stage.

[0029] The phenotypic records of recombinant CMV carrying the PDS target in Cas9-transfected tomato leaves and fruits and the detection of the efficiency of PDS gene site-directed editing in tomato leaves are as follows:

[0030] The phenotypes of CMV-sgBsaI and CMV-sgPDS were recorded in the early stage of virus inoculation, and after the CMV-sgPDS-inoculated plants showed a photobleaching phenotype, only the phenotypes of CMV-sgPDS-infected tomato leaves and fruits in the later stage were recorded;

[0031] Leaves of two recombinant CMVs at different stages were collected for genomic DNA extraction, and a DNA fragment of 280 bp in length containing the target sequence was obtained by PCR amplification. The site-directed mutagenesis efficiency of PDS was detected by high-throughput sequencing.

[0032] The present invention also relates to: determination of editing efficiency of target gene in offspring of CMV-sgPDS edited plants and genotype analysis of offspring; and RT-PCR detection of CMV in edited offspring.

[0033] The technical solution of the present invention can be specifically described as follows:

[0034] 1. Use the CMV genomic RNA3 infectious clone to construct the vector pCB301R3-sgBsaI;

[0035] Note: The CMV genome RNA3 infectious clone pCB301R3 can be found in the previous article published by our research group, "Construction of Cucumber Mosaic Virus (CMV) Gene Silencing Vector" (Journal of Agricultural Biotechnology, 2015, 23(12): 1550-1558). The accession number of the RNA3 sequence in the NCBI database is D10538.1.

[0036] 2. Construct the vector pCB301R3-sgPDS of the editing site of the target gene;

[0037] Description: The target gene of tomato in the present invention is phytoene desaturase (PDS) involved in chlorophyll synthesis. After the gene is inactivated, the plant exhibits a photodrifting phenotype. The accession number in the Solanaceae genome database is Solyc03g123760, and the target sequence is 5'-ggactcttgccagcaatgct-3'.

[0038] 3. The vectors pCB301R3-sgBsaI and pCB301R3-sgPDS were respectively transferred into Agrobacterium GV3101, cultured, and mixed with CMV Agrobacterium pCB301R1 and pCB301R2, and then inoculated;

[0039] 4. Transgenic tomato Cas9 and planting of Cas9-transfected tomato seeds;

[0040] Description: Cas9 transgenic vector (Addgene Plasmid #91158), tomato Cas9 genetic transformation was entrusted to a third party.

[0041] 5. CMV-sgBsaI and CMV-sgPDS were inoculated into Cas9-transfected tomatoes at different stages, and the phenotypes of plants and fruits were recorded. The top leaves of the plants were collected at 30, 60 and 120 days for genomic DNA extraction. Primers covering the target region and genomic DNA of leaves of two recombinant CMV-infected Cas9-transfected tomato systems were used as templates to amplify a DNA fragment of ~280 bp for high-throughput sequencing to detect editing efficiency.

[0042] 6. After the fruits of CMV-sgBsaI and CMV-sgPDS-inoculated plants mature, the seeds in the fruits are collected, dried and kept as seeds; the seeds are germinated and planted in nutrient soil. After they emerge from the soil, the plant phenotypes are recorded and the seedlings are collected for analysis of the offspring genotype and virus detection.

[0043] The present invention constructs a vector for delivering sgRNA based on CMV, and edits the target gene in the Cas9-transformed plant, and the target gene edited by CMV-sgRNA can be inherited to the next generation. The technical advantages are: only one plant Cas9 genetic transformation and tissue culture operation are required, and the sgRNA of the target gene is delivered in the plant by CMV to efficiently and quickly site-specifically mutate the target gene, and the site-specific editing of the target gene in the plant can be inherited to the next generation, and the offspring of the target gene editing do not carry CMV, and the subsequent site-specific mutation and seed transmission of other genes do not require tissue culture processes.

[0044] The present invention changes the region between the CP and the 3' non-coding region (UTR) in the CMV genome RNA3 into a vector that can insert the target gene sgRNA, and inoculates the Agrobacterium containing RNA3, RNA1 and RNA2 carrying sgRNA into the Cas9-transformed tomato by co-infiltration, and the plant inoculated with the sgRNA-carrying recombinant CMV grows under 25°C greenhouse conditions to obtain somatic gene site-directed mutations and gene site-directed editing that can be inherited to the next generation. The present invention is the first domestic and foreign CMV with a host plant range of more than 1,000 species as an sgRNA delivery vector, and with the help of Cas9-transformed plants, the offspring of the target gene site-directed mutation is directly obtained, and the operation is simple, the somatic editing efficiency is high, and the seed transmission efficiency of the genomic DNA site-directed editing is high.

[0045] In summary, the present invention is a method for constructing a sgRNA delivery viral vector, and uses the recombinant virus to perform gene site editing in plants with Cas9 gene transfer, and quickly obtain offspring with complete mutations in the target gene; it is achieved by only one genetic transformation and tissue culture operation of Cas9 plant transfer, and the sgRNA of the target gene is delivered in the plant by CMV, and the offspring with different target gene site mutations can be obtained without subsequent tissue culture process, and there is no virus in the offspring. That is, the present invention constructs a CMV vector for delivering sgRNA, and is applied to fast, efficient, tissue culture-free, and heritable site-specific editing of plant genomes. The present invention is the first domestic and foreign method to efficiently achieve site-specific editing of plant target genes and seed transmission in crops by delivering sgRNA through CMV. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0047] Figure 1 Schematic diagram of the vector for infectious cloning of CMV-sgRNA;

[0048] Figure 2 Phenotype of Cas9-transfected tomatoes 30 days after inoculation with CMV-sgBsaI and CMV-sgPDS;

[0049] Figure 3Phenotypes of Cas9-transfected tomatoes at 90 and 120 days after inoculation with CMV-sgPDS;

[0050] Figure 4 The editing efficiency of PDS was measured after inoculation of Cas9-transfected tomatoes for CMV-sgBsaI and CMV-sgPDS for 30, 60, and 120 days;

[0051] Figure 5 These are photos of ripe tomato fruits infected with CMV-sgBsaI and CMV-sgPDS;

[0052] Figure 6 This is the phenotype of the offspring of tomato infected by CMV-sgPDS; Figure 6 Middle: The left picture shows the phenotype of tomato seeds of the edited plant after they were unearthed in a culture pot, and the right picture shows the green seedlings and albino seedlings in the soil;

[0053] Figure 7 This is the genotype analysis diagram of the offspring PDS of tomatoes infected with CMV-sgPDS;

[0054] Figure 8 Virus detection in the progeny of CMV-sgPDS-edited tomatoes;

[0055] Fig. 9 The sequence of SEQ ID NO: 1;

[0056] Fig.10 The sequence is SEQ ID NO:2. DETAILED DESCRIPTION

[0057] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0058] Example 1. Construction of vector pCB301R3-sgPDS

[0059] 1) Construction of vector pCB301R3-sgBsaI:

[0060] Based on the CMV genomic RNA3 infectious cloning vector pCB301R3 vector (Construction of Cucumber Mosaic Virus (CMV) Gene Silencing Vector, Journal of Agricultural Biotechnology, 2015, 23(12): 1550-1558), the 5'-3' sequence is CP sequence, 20 bases containing 2 BsaI restriction sites, BamHI restriction site, Cas9 scaffold sequence, StuI restriction site, CMV 3'UTR, HDV ribozyme sequence, SacI restriction site, and a sequence with a length of 1155bp, which was commissioned to Beijing Qingke Biotechnology Co., Ltd. to synthesize the synthetic sequence cloning vector pUC57. The vector containing the synthetic sequence is named pUC57-CP-sgBsaI-UTR, and the synthetic sequence is shown in SEQ ID NO: 1.

[0061] The vector pCB301R3 was double-digested with SalI / SacI (Baoriyi Biotechnology Co., Ltd., #1636 / #1627) to recover the large fragment vector, and the pUC57-CP-sgBsaI-UTR plasmid was double-digested with SalI / SacI to recover the synthetic fragment. The vector after digestion and the synthetic fragment were connected by T4 DNA ligase (NEB New England Biolabs, #M0202V) and transformed into Escherichia coli HB101 to obtain the vector pCB301R3-sgBsaI. The operating instructions of the double digestion reaction of SalI / SacI and the connection reaction of T4 DNA ligase were carried out according to the instructions for use of the product, and the pCB301R3-sgBsaI vector was obtained. The plasmid pCB301R3-sgBsaI was verified to be correct by conventional sequencing, and the CMV genome RNA3 sequence in the pCB301R3-sgBsaI vector is shown in SEQ ID NO:2.

[0062] Note: The 20 bases containing two BsaI restriction sites are 5'-tgagacctcgctcggtctcg-3', which is the control sequence for plant endogenous gene target sites.

[0063] 2) Construction of vector pCB301R3-sgPDS:

[0064] The tomato phytoene desaturase (PDS) editing target was designed using the CRISPOR-target (http: / / crispor.gi.ucsc.edu / ) online software. After comprehensive evaluation of editing efficiency and off-target rate, the target sequence of the tomato PDS gene (Solanaceae genome data accession number: Solyc03g123760) was selected as 5'-ggactcttgccagcaatgct-3'.

[0065] The vector pCB301R3-sgBsaI was used as a template and the primer pair P1 (5'cgGGATCCggactcttgccagcaatgctGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA 3'

[0066] ) / P2(5'GCgagctcTCCCTTAGCCATCCGAGTG 3') was used for PCR amplification to obtain a sgPDS-UTR fragment of ~500 bp in size; the target fragment was recovered by tapping and then double-digested with BamHI (Baori Medical Biotechnology Co., Ltd., #1605) / SacI, and ligated into the pCB301R3-sgBsaI vector that had been digested with the same enzymes, and then ligated and transformed to obtain the vector pCB301R3-sgPDS. The vector schematic diagram of pCB301R1, pCB301R2, pCB301R3-sgBsaI and pCB301R3-sgPDS is shown in the figure. Figure 1 shown.

[0067] The DNA polymerase used in PCR amplification is High-Fidelity DNA Polymerase (NEB New England Biolabs, #M0491V), PCR system: 5×Q5 reaction buffer 8μL, 5×Q5 buffer 8μL, dNTP (2.5mmol / L) 3.2μL, P1 / P2 (10μmol / L) 2μL each, pCB301R3-sgBsaI vector 10ng, Q5polymerase (1U / μL) 0.4μL and ddH2O to 40μL; PCR reaction program: 98℃3min, 98℃10s, 58℃15s, 72℃30s, 30 cycles, 72℃5min. The vector pCB301R3-sgPDS was verified by conventional sequencing. The vector schematic diagram of pCB301R3-sgPDS is shown in the figure below. Figure 1 shown.

[0068] Description: PDS is involved in the synthesis of chlorophyll. When the gene is inactivated, the plant exhibits a photobleaching phenotype. The tomato PDS accession number in the Solanaceae genome database is Solyc03g123760. In primer P1, GGATCC is the BamHI restriction site, ggactcttgccagcaatgct is the target sequence, and gagctc in primer P2 is the SacI restriction site.

[0069] Example 2: Genetic transformation of Cas9 in tomatoes and planting of Cas9-transformed tomato seeds

[0070] The Cas9 transgenic vector was purchased from Addgene (Plasmid #91158), and the transgenic tomato variety used was Ailsa Craig, which was commissioned by Wuhan Boyuan Biotechnology Co., Ltd. The genetic transformation of tomatoes was carried out according to the literature (Transgenic Res. 2007; 16 (2): 169-175.), and Cas9 tomato seeds were provided. The Cas9-transfected tomato seeds were moisturized and germinated in a culture dish for 3 to 4 days, sown in culture soil after germination, transplanted into culture pots after emergence, and cultivated in a greenhouse at 25°C for 3 to 4 true leaf stages for CMV Agrobacterium infiltration inoculation.

[0071] Example 3: Agrobacterium transformation, expansion culture and infiltration inoculation of pCB301R3 vector

[0072] The specific methods of transformation of pCB301R3-sgBsaI and pCB301R3-sgPDS vectors into Agrobacterium GV3101 by freeze-thaw and expansion culture and infiltration inoculation of Agrobacterium can be found in the article published by our research group (Journal of Agricultural Biotechnology, 2015, 23(12): 1550-1558).

[0073] After amplification of pCB301R1, pCB301R2, pCB301R3-sgBsaI and pCB301R3-sgPDS Agrobacterium, the cells were collected, the cells were suspended with Agrobacterium infiltration inoculation buffer, and the concentration of each bacterium was adjusted to OD600 of 0.5; pCB301R1, pCB301R2 and pCB301R3-sgBsaI or pCB301R3-sgPDS Agrobacterium were mixed in equal proportions, and the viruses CMV-sgBsaI and CMV-sgPDS were infiltrated and inoculated into the first and second true leaves of Cas9-transformed tomatoes (obtained in Example 2) using a 1 mL syringe, respectively, and each virus was inoculated with 5 tomatoes.

[0074] Note: pCB301R1, pCB301R2 and pCB301R3-sgBsaI Agrobacterium were mixed in equal proportions to produce the virus CMV-sgBsaI. CB301R1, pCB301R2 and pCB301R3-sgPDS Agrobacterium were mixed in equal proportions to produce the virus CMV-sgPDS. Agrobacterium pCB301R1 and pCB301R2 were derived from the previous article published by the research group (Journal of Agricultural Biotechnology, 2015, 23(12):1550-1558).

[0075] Example 4: Phenotypes of CMV-sgPDS-inoculated Cas9-transfected tomato plants at different stages

[0076] The viruses CMV-sgBsaI and CMV-sgPDS were inoculated into the first and second true leaves of Cas9-transfected tomatoes by Agrobacterium infiltration for 30 days. All systemic leaves of tomatoes infected with CMV-sgPDS showed a photobleached spot phenotype, while no such phenotype appeared in the systemic leaves of tomatoes infected with CMV-sgBsaI (see Figure 2 ); 90 days, most leaves of the whole tomato plant inoculated with CMV-sgPDS also showed a photobleaching phenotype, and the top leaves of some branches were white, and the skin of some tomato fruits was also white. At 120 days, the color of the white tomato fruit skin turned orange (see Figure 3 ). The above results indicate that the loss of PDS function in Cas9-transgenic tomato plants infected with CMV-sgPDS resulted in a photobleaching phenotype in both tomato leaves and fruits.

[0077] Example 5: Determination of the editing efficiency of PDS in Cas9-transfected tomatoes at different stages of CMV-sgPDS infection

[0078] The upper systemic leaves of CMV-sgBsaI and CMV-sgPDS-transfected Cas9 tomatoes were collected at 30, 60 and 120 days after Agrobacterium inoculation, and 2 virus-infected tomatoes were collected at each time point. The genomic DNA of each sample was extracted using a plant genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., #DP350) and used as a template for amplifying a partial fragment of the PDS gene. The PCR amplification primers were P3 (5'ggagtgagtacggtgtgcAGCCATCTTAAAGAATAACGAAATGC 3') and P4 (5'gagttggatgctggatggGAGAGGCAGGTAGACAATCTAACACC 3'), and the length of the amplified PCR product was ~280 bp. The PCR system was: 8 μL of 5×Q5 reaction buffer, 8 μL of 5×Q5 buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL of P3 / P4 (10 μmol / L), 1 μg of tomato genomic DNA, 0.4 μL of Q5 polymerase (1 U / μL), and ddH2O to make up to 40 μL; the PCR reaction program was: 98°C for 3 min, 98°C for 10 s, 62°C for 15 s, 72°C for 30 s, 35 cycles, and 72°C for 5 min. After the PCR reaction was completed, 5 μL of the PCR product of each sample was taken for agarose gel electrophoresis to determine whether the target fragment was in line with the expectation. The PCR products of the remaining samples were sent to the HI-TOM platform of the China National Rice Research Institute for high-throughput sequencing. The sequencing data was analyzed and processed on the online website (http: / / www.hi-tom.net / ). The analysis of the results is as follows: Figure 4As shown. Figure 4 It can be seen that in the systemic leaves of Cas9-transformed tomatoes at different stages of CMV-sgBsaI infection, the site-specific editing efficiency of PDS was 0, indicating that base deletions or insertions occurred at the target site of PDS and its adjacent areas; in the systemic leaves of tomatoes inoculated with CMV-sgPDS for 30 days, the editing efficiency of the PDS gene was 56.45%±1.38%; with the increase of virus infection time, the efficiency of PDS site-specific mutation in CMV-sgPDS-inoculated plants was significantly improved. At 60 days and 120 days, the somatic cell editing efficiency of PDS in the systemic leaves of Cas9-transformed tomatoes was 72.57%±2.47% and 90.00±4.01%, respectively. The above results show that recombinant CMV carrying the target site can quickly and efficiently site-specifically mutate the target gene in Cas9-transformed tomatoes.

[0079] Note: The "ggagtgagtacggtgtgc" in primer P3 is the adapter for high-throughput sequencing, and the "gagttggatgctggatgg" in primer P4 is the adapter for high-throughput sequencing.

[0080] Example 6: Phenotypic and genotypic analysis of offspring of tomatoes infected with CMV-sgPDS

[0081] The color of tomato fruits after ripening with photobleaching phenotype in CMV-sgPDS infected plants Figure 5 As shown, the fruits of tomato plants infected with CMV-sgBsaI are red when ripe, and the fruit stalks and fruit stems are green, while the white fruits of tomato plants infected with CMV-sgPDS are orange-red when ripe, and the fruit stalks and fruit stems are white, indicating that PDS in tomato fruits has also lost its function.

[0082] The seeds in the orange-red fruit germinate and are planted in a culture pot. The phenotype of the tomato seedlings after they emerge from the soil is as follows: Figure 6 As shown, 13 of the 36 seedlings were albino seedlings and 23 were green seedlings, indicating that CMV-sgPDS infection mediated the site-specific editing of tomato PDS and inherited it to the next generation, so that the PDS in the genome of its offspring also lost its function. The genomic DNA of 36 tomato seedlings was extracted and used as a template for amplifying a partial fragment of the PDS gene containing the editing target sequence. The PCR amplification primers, reaction system and reaction parameters were the same as those in Example 5. The high-throughput sequencing data of the PCR products of the 36 tomato seedlings were analyzed by an online website, and the data were processed according to the method for high-throughput sequencing data analysis of progeny tomatoes of Liu et al. (Proc Natl Acad Sci US A. 2024; 121(39): e2406486121.). The results are shown in Figure 5. Figure 7 shown. Figure 7The results showed that 8 of the 23 green seedlings had no base deletion / insertion in PDS, which was wild type (WT), accounting for 22.22%; the remaining 15 green seedlings had ~50% PDS with base deletion and ~50% PDS with WT, that is, one allele of PDS in the 15 green seedlings was edited and the other allele was WT, which was heterozygous (Mo), accounting for 36.11%; 2 copies of PDS in 13 albino seedlings had base mutations, which was biallelic editing (Bi), accounting for 41.67%; 8 of the 36 offspring seedlings infected with CMV-sgPDS had wild type PDS, and the seed transmission efficiency of CMV-sgPDS-mediated PDS site-directed mutation was 77.78%. The above results show that recombinant CMV carrying target sequences can quickly and efficiently perform gene site-directed editing in Cas9-transfected plants without transgenics, and can be inherited to the next generation.

[0083] Note: The tomato genome is diploid, so PDS has two alleles in the tomato genome. Only when both alleles of PDS simultaneously undergo a mutation that causes an ORF frameshift can the gene be completely inactivated, resulting in a photobleaching phenotype in the plant and a completely albino phenotype after seed germination.

[0084] Example 7. Virus detection in the progeny of CMV-sgPDS infected tomatoes

[0085] In order to determine whether the tomato offspring with site-directed mutation of PDS still carry CMV, total RNA of 5 green seedlings with PDS genotype Mo and 5 albino seedlings were extracted by Trizol kit (Thermofisher, #15596026). Total RNA was used as template and HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, #R212-01) was used for cDNA synthesis. The primers were P6 (5'TGGTCTCCTTTTGGAGGCC 3') and P8 (5'AACATCACACTTCATAATAGAGTTGTAGGTAGTC 3'). The specific method was carried out according to the kit instructions. The above cDNA was used as a template, the primer pairs were P5 (5'ATCTGGAGTGCTCCCAGTCTGA 3') / P6 and P7 (5'CACCGAGAGAGGTTACATGTTCACC 3') / P8, and 2×Rapid Taq Master Mix (Vazyme, #P222-01) was used for PCR amplification. The PCR reaction system was as follows: 2×Mix was 10 μL, primers P5, P6, P7 and P8 were each 0.4 μL, cDNA was 0.5 μL, and ddH2O was 7.9 μL; PCR cycle parameters were: 94°C for 3 min, 94°C for 15 s, 58°C for 20 s, 72°C for 30 s, 30 cycles, and 72°C for 5 min. After the PCR reaction was completed, 6 μL of the PCR product of each sample was taken for agarose gel electrophoresis. The results were as follows: Figure 8 shown. Figure 8 The results showed that the internal reference gene Actin was detected in all 10 tomato offspring after PDS site-directed editing, but the target band in the CMV genome could not be detected; Actin and CMV genomic RNA3 were detected simultaneously in tomatoes inoculated with CMV-sgPDS, and the size of the target band in the virus was consistent with that of the positive control plasmid pCB301R3-sgPDS of PCR, and CMV could not be detected in the tomato offspring with PDS site-directed mutation. The above results show that in the process of high-efficiency and heritable site-directed gene editing of plants mediated by CMV vectors carrying the target site, the virus cannot be passed on to the next generation.

[0086] Description: Primer pair P5 / P6 is used to detect RNA3 of the CMV genome, and the size of the amplified product is 432bp; primer pair P7 / P8 is used to detect the Actin (gene accession number: NM_001321306) gene in tomato, which is an internal reference for CMV detection, and the size of the amplified product is 283bp.

[0087] It should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. The construction method of the vector pCB301R3-sgPDS is characterized by: The sgRNA of the target gene was inserted into the region between the CP and 3'UTR of the infectious clone pCB301R3 of the cucumber mosaic virus (CMV) genomic RNA3 to obtain pCB301R3-sgPDS; the sgRNA of the target gene was 5'-ggactcttgccagcaatgct-3'.

2. The method for constructing the vector pCB301R3-sgPDS according to claim 1, characterized in that The following steps are involved: 1) Artificially synthesizing a DNA sequence; the DNA sequence is SEQ ID NO: 1; 2) The plasmid pCB301R3 was double-digested with SalI and SacI, and then connected with the DNA sequence obtained in step 1) by the same enzyme digestion, and transformed to obtain the vector pCB301R3-sgBsaI; 3) The editing target site 5'-ggactcttgccagcaatgct-3' of the tomato PDS gene was selected by CRISPOR-target online software, and primers were designed and PCR amplified. The PDS target sequence was cloned into the plasmid pCB301R3-sgBsaI using BamHI and SacI to obtain the vector pCB301R3-sgPDS.

3. Application of CMV-mediated heritable gene editing vector, characterized in that: The plasmid pCB301R3-sgBsaI was used to construct the sgRNA-expressing vector pCB301R3-sgRNA, which was then transformed into Agrobacterium and co-infiltrated into Cas9-transfected plants together with Agrobacterium pCB301R1 and pCB301R2, and the offspring with site-directed editing of the target gene were directly obtained.

4. The use according to claim 3, characterized in that: The vectors pCB301R3-sgBsaI and pCB301R3-sgPDS were transformed into Agrobacterium GV3101, respectively, and mixed with Agrobacterium pCB301R1 and pCB301R2, respectively, and then inoculated into Cas9-transfected tomatoes.

5. The use according to claim 3 or 4, characterized in that: The phenotypes of CMV-sgPDS-infected and Cas9-transfected tomatoes at different stages and high-throughput sequencing were used to detect the PDS editing efficiency in tomato systemic leaves at different stages.

6. The use according to any one of claims 3 to 5, characterized in that: The target recombinant virus CMV carrying the plant endogenous gene is inoculated into Cas9-transfected tomatoes. The target gene in the virus-infected plants undergoes site-directed mutation and the edited target gene is inherited to the offspring. The offspring with site-directed editing of the target gene do not carry CMV.

7. The use according to claim 6, characterized in that: The mixture of pCB301R3-sgBsaI Agrobacterium and pCB301R1 and pCB301R2 Agrobacterium is the recombinant virus CMV-sgBsaI, and the mixture of pCB301R3-sgPDS Agrobacterium and pCB301R1 and pCB301R2 Agrobacterium is the recombinant virus CMV-sgPDS.

Images