CRISPR-Cas12b (clustered regularly interspaced short palindromic repeats-CRISPR-Cas12b) temperature control one-step method pathogen nucleic acid

Abstract

The invention discloses a CRISPR-Cas12b (clustered regularly interspaced short palindromic repeats-associated 12b) temperature control one-step method pathogen nucleic acid detection kit as well as a use method and application thereof, belonging to the technical field of pathogen detection. By applying the kit provided by the invention, the rapid detection of pathogen nucleic acid can be realized, the sensitivity is high, the lowest detection limit is 1 copy, the detection result is consistent with the detection result of qPCR, the detection accuracy is high, the requirement on equipment is low, the operation steps required by detection are simpler, and the time required by detection is shorter; according to the kit provided by the invention, after the components and the proportion are optimized, the temperature characteristic of AapCas12b and the characteristic of an ERA amplification kit are fully utilized, the compatibility of the two systems is greatly improved, the pathogen nucleic acid is detected by a one-step method, and the risk that errors are possibly introduced by fractional step operation is eliminated on the premise of ensuring high sensitivity and specificity of a detection method.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection, and in particular to a CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit, and a use method and application thereof. Background Art

[0002] Pathogen infection is one of the main causes of many diseases, especially microbial infections such as viruses, bacteria, and fungi, which may lead to a series of clinical symptoms and health hazards. Pathogen infection usually manifests as mild symptoms such as fever, cough, sore throat, and fatigue, but in some severe cases, it may cause pneumonia, sepsis, respiratory failure, and even death. Rapid and accurate detection of pathogens is crucial for early diagnosis of diseases, timely treatment, and formulation of prevention and control measures. Taking fever with thrombocytopenia syndrome (SFTS) as an example, the main clinical manifestations of SFTS pathogen-infected people are fever, gastrointestinal symptoms, thrombocytopenia, leukopenia, liver and kidney damage, and some infected people have bleeding symptoms. SFTS disease mainly occurs in hilly and mountainous areas. Patients are mainly adult farmers engaged in agricultural production, and some patients are bitten by ticks. Commonly used diagnostic methods are often based on empirical judgment or the detection of a single pathogen. There are few products for the overall detection of common pathogens based on syndromes. In order to achieve early detection of fever with thrombocytopenia syndrome virus (SFTSV), it is very important to develop low-cost, accurate, efficient, and rapid diagnostic methods for detecting SFTS pathogens.

[0003] At present, the commonly used pathogen diagnosis methods in clinical practice include culture, immunological detection and molecular biological detection. Culture is a traditional method for detecting bacteria and fungi. It has high specificity, but it takes a long time and usually takes several days to obtain results. In addition, some pathogens such as viruses are difficult to detect through culture. Immunological detection (such as enzyme-linked immunosorbent assay ELISA) identifies pathogen infection by detecting antigens or antibodies. It is easy to operate, but the sensitivity and specificity are not high, and false positive or false negative results are prone to occur. Molecular biological detection methods (such as PCR) have become the mainstream method for pathogen diagnosis due to their high sensitivity and specificity, especially in virus detection. Taking SFTS pathogen detection as an example, the real-time fluorescence quantitative PCR method is still the most recognized accurate method. However, real-time fluorescence PCR requires complex equipment and strict experimental conditions, such as thermal cyclers and high-quality DNA / RNA extraction steps. The entire detection process also includes steps such as sampling and sample processing, and the total time is usually more than two hours, which greatly limits its application in on-site instant diagnosis.

[0004] Currently, the application of step-by-step detection based on amplification and CRISPR in pathogen detection is becoming increasingly popular. It does not require expensive instruments and equipment, has low cost, and has the advantages of high sensitivity, strong specificity, and much shorter time than real-time fluorescence quantitative PCR detection methods. However, the operation of the step-by-step detection method based on amplification and CRISPR is prone to introduce errors and cause false positives. Therefore, there is an urgent need for a highly sensitive kit that can react in a one-step manner and quickly and accurately detect pathogen nucleic acids. Summary of the invention

[0005] The purpose of the present invention is to provide a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit and its use method and application, so as to simplify the pathogen detection steps, eliminate false positives caused by errors, improve detection efficiency, and reduce the requirements for instruments and equipment while ensuring high sensitivity and accuracy of the detection results.

[0006] To achieve the above object, the present invention provides a CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit, comprising the following components:

[0007] (1) sgRNA for detecting pathogen nucleic acid;

[0008] (2) AapCas12b nuclease;

[0009] (3) Nucleic acid detection probes;

[0010] (4) upstream primers and downstream primers for amplifying pathogen-specific regions;

[0011] (5) Commercially available Xinda Gene Basic Nucleic Acid Amplification Kit;

[0012] (6) Sterile ddH2O after DEPC treatment.

[0013] Preferably, the system for detection using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit is: 3 μM sgRNA for detecting pathogen nucleic acid, 5 μM AapCas12b nuclease, 10 μM nucleic acid detection probe, 10 μM each of the upstream primer and downstream primer for amplifying the pathogen-specific region, and DPEC sterile and enzyme-free sterilized ddH2O is used to make up the required reaction system volume.

[0014] Preferably, the nucleic acid detection probe sequence is shown as SEQ ID NO.2.

[0015] A method for using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described above is to add the test liquid to the prepared detection reaction system, place it in a GS8 real-time fluorescence reader, react at 37°C for 20 minutes, and then react at 60°C for 5-20 minutes, and then interpret the fluorescence value.

[0016] Preferably, the fluorescence value interpretation standard is: after removing the sample background fluorescence, a fluorescence value that is 3 times or more than the fluorescence value of the negative control sample is defined as positive, and a fluorescence value that is less than 3 times the fluorescence value of the negative control sample is defined as negative; the negative control is sterilized ddH2O after DEPC treatment.

[0017] A method for detecting SFTS using the above-mentioned CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit, wherein the sgRNA sequence for detecting SFTS pathogen nucleic acid is shown in SEQ ID NO.1; the upstream primer sequence for amplifying the SFTS pathogen-specific region is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4.

[0018] An application of the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described above in pathogen detection.

[0019] A method for detecting SFTS using a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described above is used in the detection of SFTS for non-medical purposes.

[0020] The AapCas12b selected by the present invention has low activity at 37°C without the addition of cutting buffer, but can show excellent cutting activity at 60°C; and the ERA amplification reaction can be carried out quickly at 37°C; at the same time, the compatibility of the CRISPR system and the ERA amplification system in a single tube without the addition of cutting buffer is also better. Therefore, the whole tube system of the present invention can realize one-step detection by directly adding samples without the intervention of microfluidics, mainly using the temperature of 60°C as the switch for CRISPR-Cas12b cutting. The pre-incubation of the CRISPR system and the amplification of the target fragment are completed simultaneously in one tube at 37°C. At this time, the activity of AapCas12b is very low and hardly interferes with the amplification in the tube; and when entering the 60°C stage, the CRISPR-Cas12b cutting activity is quickly started, and the discrimination and reporting can be completed in a very short time.

[0021] Therefore, the CRISPR-Cas12b temperature-controlled one-step detection kit for pathogen nucleic acid provided by the present invention and its use method and application have the following specific technical effects:

[0022] (1) The kit provided by the present invention can be used to achieve rapid detection of pathogen nucleic acid with high sensitivity and a minimum detection limit of 1 copy. The detection result is consistent with the detection result of qPCR, with high detection accuracy and low equipment requirements. The operation steps required for detection are simpler and the detection time is shorter.

[0023] (2) The kit provided by the present invention optimizes the composition and ratio, fully utilizes the temperature characteristics of AapCas12b and the characteristics of the ERA amplification kit, greatly improves the compatibility of the two systems, and realizes the one-step detection of pathogen nucleic acid. While ensuring the high sensitivity and specificity of the detection method, it eliminates the risk of errors that may be introduced by the step-by-step operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0025] Figure 1 It is a detection process and principle schematic diagram of the kit provided by the present invention;

[0026] Figure 2 It is a structural diagram of a simulated sample (plasmid) containing the S fragment of the nucleic acid of the SFTS pathogen in Example 3 of the present invention;

[0027] Figure 3 is the result of the test using the kit provided by the present invention in Example 3 of the present invention; wherein mock is the test result of the negative control, 1copy is the test result of the test simulated sample aqueous solution containing 1 molecule copy number, and 10copy is the test result of the test simulated sample aqueous solution containing 10 molecule copies;

[0028] Figure 4 is the result of the qPCR method in Example 4 of the present invention;

[0029] Figure 5 It is the result of detection using the kit provided by the present invention in Example 4 of the present invention; wherein water is the negative control detection result, N1 is the blank control detection result; P1-P6 are the detection results of 6 samples determined to be positive by the qPCR detection method. DETAILED DESCRIPTION

[0030] The present invention provides a CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit, and the detection process and principle of pathogens are as follows Figure 1As shown. In order to simplify the detection steps of pathogens, eliminate false positives caused by errors, improve detection efficiency, and reduce the requirements for instruments and equipment while ensuring high sensitivity and accuracy of the detection results.

[0031] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0032] In order to make the purpose, technical scheme and advantages of the present application more clear, thorough and complete, the following is a clear and complete description of the technical scheme of the present invention by taking the detection of SFTS pathogen nucleic acid as an example through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0033] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the methods and steps not described in detail are all conventional methods and steps in the art.

[0034] Embodiment 1

[0035] The sgRNA for detecting SFTS pathogen nucleic acid was designed as follows:

[0036] (1) Obtain the genome sequence of the SFTS pathogen, and find the specific identification region of the SFTS pathogen through bioinformatics analysis and comparison. The specific steps are as follows: Search the whole genome sequence of the SFTS pathogen HB-29 owned by the inventor's laboratory in the NCBI nucleic acid sequence library to obtain its whole genome sequence. Search for the sequence of "TTN" in the HB-29 whole genome sequence, and use these sequences as an alternative database for sgRNA targeting sequences.

[0037] (2) According to the screening principle, such as the GC content of the sequence, base uniformity, sequence conservation and other parameters, a target site recognition sequence of 24 nt in size is finally screened from the candidate database obtained in step (1). Then a direct repeat sequence of 91 nt in size is added to the target site recognition sequence of 24 nt in size obtained above, and finally an sgRNA for detecting SFTS pathogen nucleic acid is obtained, which is named sgRNA-1. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.1, wherein the last 24 nucleotides are a target site recognition sequence of 24 nt in size screened from the candidate database obtained in step (1).

[0038] SEQ ID NO.1:

[0039] GUCUAGAGGACAGAAUUUUUCACGGGGUGCCAAUGGCCACUUUCCA

[0040] GGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCGCAG

[0041] AGCCUUCCCACUUGGACAU

[0042] Embodiment 2

[0043] A CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid was prepared, including the following components:

[0044] (1) sgRNA-1 for detecting nucleic acid of SFTS pathogen;

[0045] (2) AapCas12b nuclease (Aidygene AapCas12b nuclease (C2c1));

[0046] (3) Nucleic acid detection probes;

[0047] (4) a first upstream primer and a first downstream primer;

[0048] (5) Commercially available ERA method of the X-Gene basic nucleic acid amplification kit;

[0049] (6) Sterile ddH2O after DEPC treatment.

[0050] The sequence of the nucleic acid detection probe is FAM-TTTTTTTT-BHQ-1 (SEQ ID NO. 2); the nucleotide sequence of the first upstream primer is shown in SEQ ID NO. 3; the nucleotide sequence of the first downstream primer is shown in SEQ ID NO. 4. The sequence information is sent to the company to synthesize the required nucleic acid detection probe, the first upstream primer, and the first downstream primer.

[0051] SEQ ID NO.3:CAAGAGAAATATGGACTGGTTGAGA

[0052] SEQ ID NO.4:ACTGGGAGATACTCCTTTAGAGCTG

[0053] Embodiment 3

[0054] The minimum detection limit of the CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid prepared in Example 2 was investigated to test the detection of a simulated sample (plasmid) containing the S fragment of the SFTS pathogen nucleic acid. The preparation method of the simulated sample (plasmid) containing the S fragment of the SFTS pathogen nucleic acid is as follows: first, the S fragment gene is cloned by PCR using the cDNA of SFTSV as a template; then, the pHH21 vector and the S fragment are subjected to enzyme digestion and homologous recombination, and the structure diagram is shown in FIG. Figure 2 The specific test steps are as follows:

[0055] (1) Thoroughly mix 3 μL of a 10 μM first upstream primer aqueous solution, 3 μL of a 10 μM first downstream primer aqueous solution, 20 μL of the dissolving agent in the ERA amplification kit, 10 μL of DEPC-treated sterilized ddH2O, and a tube of basic amplification reagent in the ERA amplification kit to prepare an ERA premix.

[0056] (2) 0.5 μL of 5 μM AapCas12b nuclease, 1 μL of 3 μM sgRNA-1 for detecting SFTS pathogen nucleic acid, 1 μL of 10 μM nucleic acid detection probe, 18 μL of ERA premix prepared in step (1), 3 μL of detection simulation sample aqueous solution containing molecular copy numbers of 1 and 10, and 1 μL of activator in the ERA amplification kit were fully mixed to obtain a reaction system. Sterile ddH2O treated with DEPC was used as a negative control (referred to as mock).

[0057] The reaction system was placed in a GS8 real-time fluorescence reader and reacted at 37°C for 20 min and then at 60°C for 15 min. The results of the three repeated experiments are shown in Figure 3 As shown, mock is the test result of the negative control, 1copy is the test result of the test simulated sample aqueous solution containing 1 molecule copy number, and 10copy is the test result of the test simulated sample aqueous solution containing 10 molecule copies.

[0058] The fluorescence value of the test result is interpreted according to the following criteria: after removing the background fluorescence of the sample, a fluorescence value that is 3 times or more than that of the negative control sample is defined as positive, and a fluorescence value that is less than 3 times that of the negative control sample is defined as negative.

[0059] Depend on Figure 3 It can be seen that the detection limit can be as low as a single copy, and it can basically be judged as positive within 10 minutes at the 60°C stage; after the sample content is increased to 10 copies, it can basically be judged as positive within 5 minutes at the 60°C stage.

[0060] Embodiment 4

[0061] Using qPCR as a control, the detection accuracy of the CRISPR-Cas12b temperature-controlled one-step method for detecting SFTS pathogen nucleic acid kit prepared in Example 2 was investigated, and the SFTS pathogen cDNA sample was tested. The specific steps are as follows:

[0062] (1) SFTSV was cultured using VERO, and the supernatant was collected after 10 days; after centrifugation at 3000 rpm for 10 min, the supernatant was taken out with a needle, collected in a new centrifuge tube through a 0.22 μm filter membrane, and then dispensed into EP tubes; RNA in the collected supernatant was extracted using the RNA virus genome extraction kit with the product number R2000 of Solebow, and the concentration of the obtained RNA was directly measured using the NanoDrop method for measuring nucleic acid concentration. Six RNA solutions with good quality were selected and reverse transcribed using the Yisheng Biological Reverse Transcription Kit 11139ES60. The reverse transcription operation was as follows: 14 μL of RNA was first prepared with 2 μL of RNase-free H2O and 1 μL of Random Primers N6 (50 μM), and the mixture was gently shaken to mix, and placed in a PCR instrument set at 65°C for 5 min and 4°C for 3 min; after taking it out, 2 μL of 10× III Super Buffer and 1 μL III RT Enzyme Mix, shake gently to mix, put into PCR instrument and set the program at 25℃5min, 55℃15min, 85℃5min, and 4℃∞ for reverse transcription to obtain cDNA solutions, which are recorded as P1, P2, P3, P4, P5, and P6 respectively.

[0063] (2) The upstream primer for amplifying the S fragment is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6. The cDNA solution obtained was subjected to qPCR using the qPCR kit with the catalog number ZF501 of Zhuangmeng Bio. The sterilized ddH2O treated with DEPC was used as the negative control (denoted as water), and the solution obtained by the same RNA extraction and reverse transcription method using the culture supernatant of uninfected Vero cells was used as the blank control (denoted as N1). The sample addition method was to add 10 μL of 2×HQ SYBR qPCR Mix, 0.4 μL of SF, 0.4 μL of SR, 7.2 μL of ddH2O, and 2 μL of cDNA to each tube. The results are shown in the figure. Figure 4 shown.

[0064] SEQ ID NO.5:GGGTCCCTGAAGGAGTTGTAAA

[0065] SEQ ID NO.6: TGCCTTCACCAAGACTATCAATGT

[0066] All results are the average of three parallel experiments, with the results of the water treatment group as the negative standard. For the qPCR results of other groups, Cq values ​​(or CT values) ≤ 35 can be directly judged as positive; Cq values ​​between 35 and 38 are repeatedly tested, and if Cq value ≤ 37, it is judged as positive, and Cq value > 37 is judged as negative; Cq value ≥ 38 or not detected is directly judged as negative. It can be seen from the results that the N1 group is also a negative result, and the P1 to P6 groups are all positive results. This result will be compared with the test results of the kit below.

[0067] (3) Thoroughly mix 3 μL of a 10 μM first upstream primer aqueous solution, 3 μL of a 10 μM first downstream primer aqueous solution, 20 μL of the dissolving agent in the ERA amplification kit, 10 μL of DEPC-treated sterilized ddH2O, and a tube of basic amplification reagent in the ERA amplification kit to prepare an ERA premix.

[0068] (4) Thoroughly mix 0.5 μL of 5 μM AapCas12b nuclease, 1 μL of 3 μM sgRNA-1 for detecting SFTS pathogen nucleic acid, 1 μL of 10 μM nucleic acid detection probe, 18 μL of ERA premix prepared in step (3), 3 μL of 6 cDNA solutions obtained in step (1), and 1 μL of activator in the ERA amplification kit to obtain a reaction system. Place the reaction system in a GS8 real-time fluorescence reader, react at 37°C for 20 minutes, and then react at 60°C for 15 minutes, and take the fluorescence value for judgment. Sterile ddH2O treated with DEPC was used as the negative control (denoted as water), and the solution obtained by the same RNA extraction and reverse transcription method using the culture medium supernatant of uninfected Vero cells was used as the blank control (denoted as N1). The results are as follows. Figure 5 shown.

[0069] The test results were interpreted according to the following criteria: after removing the background fluorescence of the sample, a fluorescence value that was 3 times or more than that of the negative control sample was defined as positive, and a fluorescence value that was less than 3 times that of the negative control sample was defined as negative.

[0070] Depend on Figure 5 It can be seen that for the 6 samples (P1-P6) judged as positive by qPCR, the CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid prepared in Example 2 was used, and all of them were judged as positive, while for the sample (N1) judged as negative by qPCR, the CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid prepared in Example 2 was still judged as negative.

[0071] Therefore, the kit provided by the present invention can realize rapid detection of pathogen nucleic acid, with high sensitivity, a minimum detection limit of 1 copy, the detection result is consistent with the detection result of qPCR, the detection accuracy is high, the equipment requirements are low, the operation steps required for detection are simpler, and the detection time is shorter; the provided kit optimizes the composition and ratio, makes full use of the temperature characteristics of AapCas12b and the characteristics of the ERA amplification kit, greatly improves the compatibility of the two systems, and realizes the one-step detection of pathogen nucleic acid. On the premise of ensuring the high sensitivity and specificity of the detection method, the risk of errors that may be introduced by the step-by-step operation is eliminated.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit, characterized in that: Includes the following components: (1) sgRNA for detecting pathogen nucleic acid; (2) AapCas12b nuclease; (3) Nucleic acid detection probes; (4) upstream primers and downstream primers for amplifying pathogen-specific regions; (5) Commercially available Xinda Gene Basic Nucleic Acid Amplification Kit; (6) Sterile ddH2O after DEPC treatment.

2. A CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit according to claim 1, characterized in that, The system for detection using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit is: 3 μM sgRNA for detecting pathogen nucleic acid, 5 μM AapCas12b nuclease, 10 μM nucleic acid detection probe, 10 μM upstream primers and downstream primers for amplifying pathogen-specific regions, and DPEC sterile and enzyme-free sterilized ddH2O is used to make up the required reaction system volume.

3. A CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit according to claim 1, characterized in that: The nucleic acid detection probe sequence is shown in SEQ ID NO.

2.

4. A method for using the CRISPR-Cas12b temperature-controlled one-step detection kit for pathogen nucleic acid as described in any one of claims 1 to 3, characterized in that: After adding the test solution to the prepared detection reaction system, place it in the GS8 real-time fluorescence reader, react at 37°C for 20 minutes, then react at 60°C for 5-20 minutes, and then read the fluorescence value.

5. The method for using a CRISPR-Cas12b temperature-controlled one-step method for detecting pathogen nucleic acid kit according to claim 4, characterized in that: The standard for judging fluorescence values ​​is: after removing the background fluorescence of the sample, a fluorescence value that is 3 times or more than the fluorescence value of the negative control sample is defined as positive, and a fluorescence value that is less than 3 times the fluorescence value of the negative control sample is defined as negative; the negative control is sterilized ddH2O after DEPC treatment.

6. A method for detecting SFTS using the CRISPR-Cas12b temperature-controlled one-step detection kit for pathogen nucleic acid according to any one of claims 1 to 3, characterized in that: The sgRNA sequence for detecting SFTS pathogen nucleic acid is shown in SEQ ID NO.1; the upstream primer sequence for amplifying the SFTS pathogen-specific region is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.

4.

7. An application of a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described in any one of claims 1 to 3 in pathogen detection.

8. An application of the method for detecting SFTS using a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as claimed in claim 6 in the detection of SFTS for non-medical purposes.

Images