Fusion type novel adeno-associated virus and application thereof

Abstract

The invention relates to the field of biological medicine, and discloses a fusion type novel adeno-associated virus and application thereof. The invention provides a fusion type adeno-associated virus AAV2-ACM202 capsid protein. The fusion type adeno-associated virus AAV2-ACM202 capsid protein is obtained by inserting a polypeptide as shown in SEQ ID No: 4 into a 587 site and a 588 site of an amino acid sequence of a wild type adeno-associated virus AAV2 capsid protein. The fusion adeno-associated virus provided by the invention is administrated through intravitreal injection, can efficiently and specifically infect retinal ganglion cells in eyes, and can be widely applied to gene therapy of related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a fusion-type novel adeno-associated virus and its application. Background Art

[0002] Hereditary eye diseases are caused by gene defects and often manifest as familial diseases. Blinding eye diseases seriously affect people's quality of life. There are about 5 million blind people in my country, of which hereditary eye diseases account for about 1 / 3 of children's blindness and visual impairment, and 80% of blindness and severe visual impairment; patients with single-gene hereditary eye diseases account for about 4% of the total population. Among them, hereditary retinal diseases (IRDs) are relatively rare blinding eye diseases caused by genetic mutations. They are also the leading cause of legal blindness in China and the world, and there is no effective treatment. With the development of science and technology, gene therapy has provided a new treatment idea for blinding eye diseases, which is expected to bring bright prospects for patients with blinding eye diseases.

[0003] Retinal ganglion cells (RGCs) are the only output neurons that transmit visual information from the retina to the brain. A variety of injuries and pathological conditions can cause degeneration of RGC cell bodies and axons, leading to irreversible vision loss. For example, Leber's hereditary optic neuropathy (LHON) is a blinding eye disease caused by a mitochondrial DNA point mutation caused by maternal missense inheritance. It is characterized by selective degeneration of retinal ganglion cells (RGCs). The loss of elongation of RGCs and their axons leads to optic nerve atrophy and severe defects in central vision, which eventually leads to blindness in patients. Glaucoma, as one of the irreversible blinding eye diseases, is mainly caused by abnormal drainage of aqueous humor in the eye, which leads to increased intraocular pressure, which in turn causes damage to optic nerve cells, leading to optic nerve atrophy, and causing visual field defects and decreased vision in patients. Traditional drug therapy cannot effectively treat these diseases, while gene therapy methods can introduce exogenous genes, small RNAs or gene editing tools into target cells to correct or compensate for diseases caused by genetic defects and abnormalities to achieve therapeutic purposes. At present, viral vector-mediated gene therapy is widely used in clinical trials to treat many ophthalmic diseases.

[0004] A key to gene therapy is delivery, and the effectiveness and harmlessness of the vector are crucial. Among them, adeno-associated virus (AAV) has been successful in the field of gene therapy as a safe gene delivery vector. Leber's hereditary optic neuropathy is a rare hereditary eye disease caused mainly by mitochondrial gene mutations, and patients usually present with acute or subacute progressive binocular vision loss. In recent years, researchers have used AAV as a vector to conduct some preliminary trials in the field of gene therapy, trying to treat this disease by delivering normal mitochondrial genes. However, the current injection method involves injecting the viral vector directly under the retina, which poses a risk of damaging the fragile retinal tissue, and the virus has a weak ability to spread laterally, and each injection can only target a small number of cells near the injection point. Therefore, it is necessary to develop better viral vectors suitable for gene therapy of eye diseases to more effectively treat similar hereditary ophthalmic diseases. In addition to LHON, diseases such as retinal degenerative diseases and congenital glaucoma are also gene-related hereditary eye diseases, and some gene therapy trials are currently underway. As an emerging treatment method, gene therapy has important application prospects in the field of ophthalmology. Summary of the invention

[0005] In view of the shortcomings of the prior art mentioned above, for ophthalmology, so far, gene therapy for eye diseases based on AAV viral vectors requires the viral vector to be injected directly under the retina. This technology can only be performed in specialized hospitals with high-level experts and equipment, and this injection method has the risk of damaging the fragile retinal tissue. Another disadvantage of this method is that due to the weak lateral diffusion ability of the AAV virus, each injection can only target a small number of cells near the injection point. Therefore, it is necessary to develop AAV vectors that can efficiently reach the retina through intravitreal injection, reduce the difficulty of surgery, and improve the treatment effect.

[0006] The purpose of the present invention is to provide a new fusion adeno-associated virus and its application, to develop a better viral vector suitable for gene therapy of eye diseases, so as to more effectively treat similar hereditary ophthalmic diseases. The fusion adeno-associated virus provided by the present application can be administered by intravitreal injection, can efficiently and specifically infect retinal ganglion cells in the eye, and can be widely used in gene therapy of related diseases.

[0007] To achieve the above-mentioned purpose and other related purposes, the first aspect of the present application provides a fusion adeno-associated virus AAV2-ACM202 capsid protein, which is obtained by inserting a polypeptide as shown in SEQ ID No: 4 into the 587 and 588 sites of the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein.

[0008] The second aspect of the present application provides a nucleic acid, wherein the nucleic acid encodes the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein.

[0009] The third aspect of the present application provides a construct, which is the aforementioned nucleic acid.

[0010] A fourth aspect of the present application provides a host cell, wherein the host cell comprises the aforementioned construct or the aforementioned nucleic acid is integrated heterologously into its genome.

[0011] The fifth aspect of the present application provides a fusion adeno-associated virus, wherein the capsid structure of the capsid protein of the fusion adeno-associated virus contains the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein.

[0012] The sixth aspect of the present application provides a cell, which is obtained by transformation using the aforementioned fusion adeno-associated virus.

[0013] The seventh aspect of the present application provides a fusion-type adeno-associated virus vector system, which comprises a packaging plasmid, and the packaging plasmid comprises the aforementioned nucleic acid.

[0014] The eighth aspect of the present application provides a pharmaceutical composition or conjugate, wherein the pharmaceutical composition comprises the aforementioned fusion adeno-associated virus and a pharmaceutically acceptable excipient; the conjugate comprises the aforementioned fusion adeno-associated virus and a biologically active polypeptide connected thereto.

[0015] The ninth aspect of the present application provides the use of the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein, or the aforementioned nucleic acid, or the aforementioned construct, or the aforementioned fusion adeno-associated virus, or the aforementioned host cell, or the aforementioned cell, or the aforementioned fusion adeno-associated virus vector system, or the aforementioned pharmaceutical composition or conjugate in the preparation of a drug for preventing or treating a disease.

[0016] Beneficial effects of this application:

[0017] 1. The present application provides a novel adeno-associated vector AAV-ACM202, which can mediate the specific expression of the target gene in the whole retina of adult mice under the condition of vitreous injection.

[0018] 2. The AAV-ACM202-mediated target gene expression provided in this application is more flexible and efficient than traditional transgenic methods, and is more convenient to use and has lower costs.

[0019] 3. The adeno-associated vector AAV-ACM202 provided in this application is injected into the vitreous body, which is simpler to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 .Plasmid map of pAAV-ACM202.

[0021] Figure 2 .Computer-simulated AAV-ACM202 structure diagram. a. Schematic diagram of AAV-ACM202 sequence. b. AAV-ACM202 structure simulation diagram.

[0022] Figure 3 .AAV-ACM202 infection of retinal ganglion cells. This figure shows a retinal section injected with rAAV-ACM202 virus. Green shows the fluorescent protein expressed by viral infection, and blue shows the cell nucleus staining. The results show that rAAV-ACM202 also has a high infection rate on retinal ganglion cells and can be used for ophthalmic gene therapy.

[0023] Figure 4 .AAV-ACM202, 9-peptide insertion: WRNGQSELE and AAV2 infection of retinal ganglion cell layer. The figure shows the tissue sections of mouse eyeballs injected with the same titer of AAV-ACM202, 9-peptide insertion: WRNGQSELE and AAV2 viruses. Green shows the fluorescent protein expressed by viral infection, and blue shows the cell nucleus staining. The results show that at the same titer, rAAV-ACM202 has a higher ability to infect retinal ganglion cells than AAV2, and the insertion of 9-peptide: WRNGQSELE has almost no infection. DETAILED DESCRIPTION

[0024] On the one hand, the present application provides a fusion adeno-associated virus AAV2-ACM202 capsid protein, which is obtained by inserting a polypeptide as shown in SEQ ID No: 4 into sites 587 and 588 of the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein.

[0025] The polypeptide shown in SEQ ID No: 4 is specifically:

[0026] RPSVGTSSP.

[0027] In some embodiments, the polypeptide fragment specifically refers to: a polypeptide fragment obtained by replacing, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids of the amino acid sequence as shown in SEQ ID No: 4, or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids at the N-terminus and / or C-terminus, and having the function of the polypeptide fragment as shown in SEQ ID No: 4, and the amino acid sequence in b) may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more with SEQ ID No: 4.

[0028] Furthermore, the nucleotide sequence corresponding to the amino acid sequence of SEQ ID No: 4 includes one or more. In a specific embodiment, the nucleotide sequence is the nucleotide sequence shown in SEQ ID No: 5. Specifically, it is:

[0029] CGGCCCAGCGTGGGGCACCAGCAGCCCC (SEQ ID No: 5).

[0030] Under an electron microscope, the nucleocapsid of an adeno-associated virus is generally nearly circular. This nearly circular capsid is actually a closed icosahedral symmetrical hollow capsid composed of multiple protein capsomeres, in which the genomic nucleic acid is encapsulated. An icosahedral symmetrical structure contains three types of rotational symmetry: 3-fold, 2-fold, and 5-fold symmetry (3-, 2-, 5-fold symmetry). That is, this symmetrical three-dimensional structure has a 3-fold symmetry axis passing through the center points of the two opposite faces of the virus particle, and the capsomeres rotate 120° around the 3-fold symmetry axis three times to reset, forming a triangular face.

[0031] In some embodiments, in the fusion adeno-associated virus capsid protein, the three-fold symmetric axis protrusion of AAV-ACM202 is affected by the insertion sequence, and its computer simulated structure schematic diagram is as follows Figure 2 As shown in b.

[0032] In the fusion adeno-associated virus AAV2-ACM202 capsid protein provided in the present application, the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein is shown in SEQ ID No: 1. Specifically, it can be:

[0033] *(SEQ ID No: 1).

[0034] In the fusion adeno-associated virus AAV2-ACM202 capsid protein provided in the present application, the amino acid sequence of the fusion adeno-associated virus AAV2 capsid protein is shown in SEQ ID No: 3. Specifically, it can be:

[0035] *(SEQ ID No: 3).

[0036] On the other hand, the present application provides a nucleic acid encoding the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein.

[0037] In some embodiments, the nucleotide sequence corresponding to the amino acid sequence of SEQ ID No: 3 includes one or more. In a specific embodiment, the nucleotide sequence is the nucleotide sequence shown in SEQ ID No: 2. Specifically, it can be:

[0038]

[0039] The present application also provides a construct, which contains the aforementioned nucleic acid. The construct is obtained by inserting the aforementioned nucleotide sequence into a suitable expression vector, and a person skilled in the art can select a suitable expression vector.

[0040] On the other hand, the present application provides a host cell, which comprises the aforementioned construct or has the aforementioned nucleic acid integrated into its genome.

[0041] In some embodiments, the host cell is selected from any one of mammalian cells (such as CHO, COS and N2A), plant cells, human cells (human cervical cancer cells such as HELA and human embryonic kidney cells such as HEK293T), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). In a preferred embodiment, the host cell is an animal cell, and more preferably a human cell. The host cell is a passage cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). The host cell is an adherent cell or a suspended cell, i.e., a cell growing in the form of a suspension.

[0042] On the other hand, the present application provides a fusion adeno-associated virus, the capsid structure of the capsid protein of the fusion adeno-associated virus contains the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein. In some preferred embodiments, the fusion adeno-associated virus is rAAV-ACM202.

[0043] In the fusion adeno-associated virus provided in the present application, the fusion adeno-associated virus also includes a heterologous nucleotide sequence encoding a target product.

[0044] In some embodiments, the heterologous nucleotide sequence encoding the target product is a construct, and the construct is a nucleic acid containing the target product. The construct is constructed by inserting the nucleic acid encoding the target product into a suitable expression vector. A person skilled in the art can select a suitable expression vector, for example, the expression vector is selected from any one of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV expression vectors.

[0045] In some embodiments, the heterologous nucleotide sequence encoding the target product is capable of being encapsulated and carried by various capsid proteins. Specifically, the target product is encoded as a nucleic acid or a protein, and the nucleic acid is selected from small guide RNA (sgRNA) and interfering RNA (RNAi).

[0046] On the other hand, the present application provides a cell, which is obtained by transformation using the aforementioned fusion-type adeno-associated virus. The cell is a eukaryotic cell and / or a prokaryotic cell. As a representative example of suitable cells, it is selected from any one of mammalian cells (such as CHO, COS and N2A), plant cells, human cells (human cervical cancer cells such as HELA and human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell is a passage cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). The host cell is an adherent cell or a suspended cell, i.e., a cell grown in the form of a suspension.

[0047] On the other hand, the present application provides a fusion adeno-associated virus vector system, which comprises a packaging plasmid, and the packaging plasmid comprises the aforementioned nucleic acid.

[0048] In some embodiments, the packaging plasmid further comprises a rep gene fragment of an adeno-associated virus, wherein the rep gene fragment comprises an intron, and the intron comprises a transcription termination sequence.

[0049] In the fusion adeno-associated virus vector system provided in the present application, the adeno-associated virus vector system further comprises an expression plasmid, wherein the expression plasmid comprises a heterologous nucleotide responsible for encoding a target product. In some embodiments, the nucleotide is selected from a small guide RNA (sgRNA), an interfering RNA (RNAi).

[0050] In the fusion adeno-associated virus vector system provided in the present application, the adeno-associated virus vector system also includes a helper virus plasmid or a helper virus, and the fusion adeno-associated virus vector system also includes a host cell. In some embodiments, the packaging plasmid, the expression plasmid, and the helper virus plasmid are transferred into the host cell, and the nucleic acid sequences therein are all integrated into the host cell to produce the fusion adeno-associated virus. In some embodiments, all the nucleic acid sequences are integrated together at a single locus in the host cell genome. In some embodiments, the nucleic acid sequences encoding various genes exist as separate expression cassettes, which prevent any risk of recombination to form a virus capable of replication; the nucleic acid sequences encoding the rep and cap genes are present in the same expression cassette. In the fusion adeno-associated virus vector system provided in the present application, the packaging plasmid also contains a rep gene fragment of the adeno-associated virus.

[0051] On the other hand, the present application provides a pharmaceutical composition or conjugate, the pharmaceutical composition comprising the aforementioned fusion adeno-associated virus and a pharmaceutically acceptable excipient; the conjugate comprises the aforementioned fusion adeno-associated virus and a biologically active polypeptide connected thereto. The pharmaceutical composition or conjugate is administered by a systemic route or a local route, selected from inner ear administration, ophthalmic administration, intravenous administration, intramuscular administration, subcutaneous administration, oral administration, local contact, intraperitoneal administration, and intralesional administration. The pharmaceutical composition or conjugate dosage form is one or more of an injection, a tablet, a capsule, an aerosol, an eye drop, or a nasal drop.

[0052] In the pharmaceutical composition or conjugate provided in the present application, the dosage form of the pharmaceutical composition or conjugate is one or more of injection, tablet, capsule, aerosol, eye drops or nasal drops.

[0053] In some embodiments, adjuvants include various excipients and diluents, which are not necessary active ingredients and have no excessive toxicity after administration. The adjuvants include sterile water or saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.) or adhesives. The adjuvants also include other low molecular weight polypeptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol or sorbitol. The adjuvant is selected from saline, glucose isotonic solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-manno or sugar alcohol isotonic solution when used for aqueous solution for injection. The aqueous solution for injection includes a solubilizing agent. The solubilizing agent is selected from alcohol (ethanol), polyol (propylene glycol or PEG) and / or nonionic surfactant (Tween 80 or HCO-50).

[0054] In the pharmaceutical composition provided in the present application, the fusion adeno-associated virus AA2-ACM202 is a single active ingredient, and can also be combined with one or more other active components useful for the treatment of eye diseases to form a combined preparation. The active components are other various drugs for the treatment of eye diseases. The content of the active ingredient in the pharmaceutical composition is a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the fusion adeno-associated virus AA2-ACM202 and the active ingredient of the pharmaceutical composition depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the bifunctional compound as an active ingredient is 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day.

[0055] On the other hand, the present application provides the use of the aforementioned fusion adeno-associated virus AAV2-ACM202 capsid protein, or the aforementioned nucleic acid, or the aforementioned construct, or the aforementioned fusion adeno-associated virus, or the aforementioned host cell, or the aforementioned cell, or the aforementioned fusion adeno-associated virus vector system, or the aforementioned pharmaceutical composition or conjugate in the preparation of a drug for preventing or treating a disease.

[0056] In the use provided in the present application, the disease is selected from one or more of ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, and neurodegenerative inflammatory diseases.

[0057] In some embodiments, the ophthalmic disease is also selected from age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM) and macular hole, angioid streaks, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of retinal pigment epithelium (RPE), hypertrophic lesions of retinal pigment epithelium (RPE), retinal vein occlusion, chorioretinal vein occlusion, macular edema, pterygium conjunctiva, subretinal edema and intraretinal edema, retinitis pigmentosa, Stargardt's disease, glaucoma, inflammatory diseases, cataracts, refractory abnormalities, keratoconus, retinopathy of prematurity, angiogenesis of the anterior part of the eye, corneal angiogenesis after keratitis, or corneal transplantation or corneal shaping. In some preferred embodiments, the ophthalmic disease is a retinal layer related disease.

[0058] In some embodiments, the inflammation is selected from skin inflammation, vascular inflammation, allergy, autoimmune disease, fibrosis, scleroderma or transplant rejection; the autoimmune disease is selected from one or more of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, Sjögren's syndrome or polymyositis.

[0059] In some embodiments, the cancer is selected from lymphoma, hematological tumor or solid tumor; specifically, the cancer is selected from adrenocortical carcinoma, bladder urothelial carcinoma, breast cancer, cervical squamous cell carcinoma, endocervical adenocarcinoma, bile duct carcinoma, colon adenocarcinoma, lymphoid tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma , hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, ovarian cancer, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic cancer, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphoid leukemia, chronic lymphoid leukemia, chronic myeloid leukemia, T-cell lymphoma or B-cell lymphoma.

[0060] In some embodiments, the metabolic disease is selected from diabetes, selected from type I and type II diabetes and diseases and conditions associated with diabetes; the metabolic disease is selected from one or more of atherosclerosis, cardiovascular disease, nephropathy, neuropathy, retinopathy, β-cell dysfunction, dyslipidemia, hyperglycemia, insulin resistance or chronic obstructive pulmonary disease. In some more preferred embodiments, gene therapy refers to the treatment of eye diseases. The fusion adeno-associated virus or pharmaceutical composition can deliver the target product to eye cells under low-dose conditions of AAV virus infection to achieve the treatment of eye diseases.

[0061] The purposes provided in this application include at least one of the following:

[0062] 1) The ophthalmic disease is a disease related to cell damage;

[0063] 2) The ophthalmic disease is a related disease caused by a gene defect;

[0064] 3) The ophthalmic disease is a disease related to environmental factors;

[0065] 4) The ophthalmic disease reported is a disease related to aging;

[0066] 5) The ophthalmic disease is a disease related to primary tumor;

[0067] 6) The ophthalmic disease is a disease related to cancer cell migration;

[0068] 7) The ophthalmic disease is a retinal layer related disease.

[0069] In the use provided in the present application, the drug includes at least one of the following functions:

[0070] 1) Under the condition of intravitreal injection, mediate the expression of the target gene specifically in the retina;

[0071] 2) Able to infect retinal ganglion cells.

[0072] The target gene of the present application is a gene that can be expressed in the eye and is well known to those skilled in the art. In a specific embodiment of the present application, the target gene can be, for example, EGFP. The provided fusion adeno-associated virus AAV-ACM202, host cell, vector system, pharmaceutical composition or conjugate is used to deliver the target product to eye cells under low-dose conditions of AAV virus infection to achieve the treatment of eye diseases. The target product is delivered for non-diagnostic treatment purposes, including in vitro delivery of the target product to eye cells.

[0073] The present application also provides a method for treating an ocular disease, the method comprising administering an effective amount of the fusion adeno-associated virus, host cell, vector system or pharmaceutical composition or conjugate provided by the present application to a subject in need thereof. A physician can determine the actual dosage that is most suitable for a single patient and it will vary according to the age, weight and response of a specific individual.

[0074] In the present invention, the fusion adeno-associated virus or host cell or vector system or pharmaceutical composition of the present invention can be administered to a patient. A person skilled in the art can determine the appropriate administration method and dosage.

[0075] The fusion adeno-associated virus or host cell or vector system or pharmaceutical composition provided in the present application can be adapted to any form of administration, which can be injection, oral administration, spraying, dripping and other suitable administration methods.

[0076] The delivery of one or more therapeutic genes by the fusion adeno-associated virus provided in the present application can be used alone or in combination with other treatment methods or therapeutic components.

[0077] The fusion adeno-associated virus of the present application is used to infect cells, thereby delivering genes and / or linked (for example, but not limited to, covalently linked) biologically active polypeptides to cells. Therefore, the present invention provides a method for delivering heterologous genes to cells, the method infecting cells by allowing one or more fusion adeno-associated viruses or conjugates of the present invention to the cells, wherein the fusion adeno-associated virus or conjugate comprises one or more heterologous genes.

[0078] The present application also provides a method for producing a stable fusion adeno-associated virus vector production cell line, which comprises:

[0079] (a) introducing a fusion adeno-associated virus vector as defined herein into a culture of mammalian host cells; and / or,

[0080] (b) selecting in culture mammalian host cells that have the nucleic acid sequence encoded on the vector integrated into an endogenous chromosome of the mammalian host cell.

[0081] The AAV vector production cell is a mammalian cell. In some embodiments, the mammalian cell is selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells or derivatives thereof. In some embodiments, the mammalian host cell is a HEK293 cell, or is derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0082] The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, Rep proteins, and capsid proteins are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. The disclosures thereof are incorporated herein by reference for AAV nucleic acid and amino acid sequences.

[0083] In the compounds of the present invention and their use, when the fusion adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agents. "Co-administered" means that they are administered simultaneously in the same preparation or in two different preparations via the same or different routes, or sequentially by the same or different routes. "Sequential" administration means that there is a time difference of seconds, minutes, hours or days between the administration of two or more different compounds.

[0084] In certain embodiments, the fusion adeno-associated virus and method thereof of the present application can be used to prevent eye diseases and can be administered as a preventive treatment method before eye damage or after a period of time after exposure to an environment susceptible to eye damage.

[0085] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art.

[0086] The term "vector" refers to a macromolecule or combination of macromolecules that contains or is associated with a polypeptide and can be used to mediate the delivery of the polypeptide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes or other gene delivery vectors.

[0087] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives.

[0088] The term "recombinant AAV vector" refers to an AAV vector containing a heterologous polynucleotide sequence, usually a sequence of interest for genetic transformation of cells. Generally, the heterologous polynucleotide is flanked by at least one, usually two, AAV inverted terminal repeats (ITRs).

[0089] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle of an AAV vector comprising at least one AAV capsid protein and an encapsidated polynucleotide.

[0090] The term "packaging" refers to the series of intracellular processes that lead to the assembly and encapsulation of AAV particles.

[0091] The terms AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and packaging proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes".

[0092] The term "helper virus" of AAV refers to a virus that enables AAV to be replicated and packaged by mammalian cells. Various such AAV helper viruses are known in the art, including adenovirus, herpes virus, and pox virus (eg, vaccinia).

[0093] The term "infectious" virus or viral particle is one that contains a polynucleotide component capable of delivering the virus to cells tropistic for that virus species. The term does not necessarily imply that the virus has any ability to replicate.

[0094] The term "producer cell" refers to a cell line that has the AAV packaging genes (rep and cap genes), required helper viral genes, and the DNA genome of the recombinant AAV vector (e.g., the transgene of interest flanked by two AAV inverted terminal repeats (ITRs)) stably integrated into the host cell genome.

[0095] The terms "include", "including", etc. should be understood as having an inclusive meaning rather than an exclusive or exhaustive meaning; that is, the meaning is "including but not limited to".

[0096] The term "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., who can benefit from treatment using the formulation, kit or combination formulation.

[0097] The term "therapeutically effective amount" generally refers to an amount that can achieve the effect of treating the diseases listed above after an appropriate administration period.

[0098] The terms "therapeutic" and "prophylactic" are to be understood in their broadest sense. The term "therapeutic" does not necessarily imply that the mammal is treated until full recovery. Similarly, "prophylactic" does not necessarily mean that the subject will not eventually contract a disease condition. Thus, treatment and prevention include alleviating the symptoms of a particular condition or preventing or reducing the risk of a particular condition developing. The term "prevention" may be understood as reducing the severity of an attack of a particular condition. Treatment may also reduce the severity of an existing condition or the frequency of acute attacks.

[0099] In the present invention, the subject or individual for therapeutic or preventive treatment is preferably a mammal, such as, but not limited to, a human, a primate, livestock (such as sheep, cattle, horses, donkeys, pigs), a pet (such as dogs, cats), a laboratory test animal (such as mice, rabbits, rats, guinea pigs, hamsters), or a captured wild animal (such as foxes, deer). The subject is preferably a primate. The subject is most preferably a human.

[0100] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0101] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0102] Example 1. Obtaining a novel adeno-associated virus AAV-ACM202

[0103] a. Construction of Rep-Cap plasmid of AAV-ACM202

[0104] The serotype of AAV is determined by the sequence of the Cap protein in the Rep-Cap plasmid required for AAV packaging. Therefore, AAVs produced by packaging with different Cap sequences have different infection tropisms. The existing natural serotype was modified by inserting a 9-amino acid polypeptide RPSVGTSSP (SEQ ID No: 4, Figure 2 a) thus creating a new AAV serotype, named pAAV-ACM202 ( Figure 1 ), whose nucleotide sequence is SEQ ID No: 2 and amino acid sequence is SEQ ID No: 3. The outer surface of the capsid showed the presence of capsid fragments from the inserted polypeptide, and indicated that the three-fold symmetric axis projection of AAV-ACM202 was affected by the inserted sequence ( Figure 2 b).

[0105] b. Preparation and purification of rAAV-ACM202 virus

[0106] The sequence of the coding gene of pAAV-ACM202 obtained in the above sequencing results was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. to obtain Rep-Cap plasmid, i.e., pAAV-ACM202. The obtained pAAV-ACM202 was co-transfected into HEK-293T cells with 80, 60, and 110ug of plasmid per dish of cells expressing a genomic plasmid pAAV-CMV-EGFP and pHelper plasmid (the full sequence of the plasmid is the same as that of AAV-ie patent document CN110437317A) and purified by iodixanol density gradient centrifugation. The final product is rAAV-ACM202. The virus titer was measured at 2E+13GC / mL as the appropriate concentration and placed at -80°C for standby use.

[0107] Example 2 In vivo verification of the novel adeno-associated virus rAAV-ACM202 in the visual system

[0108] Place an anesthetized adult mouse under a stereo microscope and drop 1-2 drops of tropicamide eye drops on the eyeball to dilate the pupil. Hold the eyeball from the optic disc with elbow forceps in the left hand and fix it. Hold a 1ml syringe or glass needle in the right hand to puncture the cornea to reduce intraocular pressure. Gently wipe away the fluid around the eye with a tissue. Hold the eyeball with forceps in the left hand and hold a glass needle with 2μl of virus in the right hand. Insert the needle at 50° between the posterior edge of the corneosclera and the iris plane and slowly inject rAAV-ACM202 with a titer of 8E12 GC / ml. After the injection, the glass needle stays for 30s and then slowly withdraws. After applying erythromycin ointment on the wound, the mouse is placed in a mouse cage in a 41℃ water bath to keep warm. After the mouse wakes up, it is moved to the mouse room for breeding. After 11 days, the eye cup is taken. The mouse is killed by spinal dislocation. After removing the eyeball, the cornea is punctured with a 1ml syringe to release the aqueous humor. The eyeball was placed in a small culture dish filled with PBS solution and dissected under a microscope. The cornea was clamped with pointed forceps, and ophthalmic scissors were inserted into the wound of the cornea to cut the cornea circumferentially. The lens was removed with forceps, and about 2 mm of the optic nerve was retained. The eye cup was fixed in 4% PFA for 12 hours at 4°C. The fixed eye cup was dehydrated in 30% sucrose for 12 hours at 4°C. After frozen sectioning, sections with better results and intact tissue were selected for staining under a fluorescence microscope, and the staining was performed according to routine procedures. Immunofluorescence results showed that rAAV-ACM202 can infect retinal ganglion cells. The results are shown in the figure. Figure 3 shown.

[0109] Comparative Example 1

[0110] The AAV control was constructed by the same method as in Example 1, except that the AAV control was prepared by inserting a 9-amino acid polypeptide: WRNGQSELE (SEQ ID No: 6) between the 587 and 588 positions of the Cap protein amino acid sequence of AAV2 (SEQ ID No: 1). The same titer of rAAV-ACM202, AAV2 and AAV control was injected into the mouse eyes, and the eye cup was taken 14 days later. The immunofluorescence results of frozen sections of the eyeball tissue showed that rAAV-ACM202 infected retinal ganglion cells more strongly than AAV2, and the AAV control virus with the 9-peptide: WRNGQSELE inserted had almost no infection. The results are as follows: Figure 4 shown.

[0111] Therefore, the 9-amino acid polypeptide inserted in the rAAV-ACM202 modification of the present application is preferred, which can infect retinal ganglion cells with high specificity and can further mediate the specific expression of the target gene in the entire retina of adult mice under the condition of vitreous injection.

Claims

1. A fusion adeno-associated virus AAV2-ACM202 capsid protein, characterized in that: The fusion adeno-associated virus AAV2-ACM202 capsid protein is obtained by inserting a polypeptide as shown in SEQ ID No: 4 into sites 587 and 588 of the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein.

2. The fusion adeno-associated virus AAV2-ACM202 capsid protein according to claim 1, characterized in that The amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein is shown in SEQ ID No:

1.

3. The fusion adeno-associated virus AAV2-ACM202 capsid protein according to claim 1, characterized in that The amino acid sequence of the fusion adeno-associated virus AAV2 capsid protein is shown in SEQ ID No:

3.

4. A nucleic acid, characterized in that The nucleic acid encodes the fusion adeno-associated virus AAV2-ACM202 capsid protein as described in any one of claims 1 to 3.

5. A construct, characterized in that The construct contains the nucleic acid of claim 4.

6. A host cell, characterized in that The host cell comprises the construct of claim 5 or has the heterologous nucleic acid of claim 4 integrated into its genome.

7. A fusion adeno-associated virus, characterized in that: The capsid structure of the capsid protein of the fusion adeno-associated virus contains the fusion adeno-associated virus AAV2-ACM202 capsid protein according to any one of claims 1 to 3.

8. The fusion adeno-associated virus according to claim 7, characterized in that The fusion adeno-associated virus also includes a heterologous nucleotide sequence encoding a target product.

9. A cell, characterized in that The cells are transformed using the fusion-type adeno-associated virus as described in claim 7 or 8.

10. A fusion adeno-associated virus vector system, characterized in that: The fusion adeno-associated virus vector system comprises a packaging plasmid, and the packaging plasmid comprises the nucleic acid according to claim 4.

11. The fusion adeno-associated virus vector system according to claim 10, characterized in that: The packaging plasmid also contains the rep gene segment of adeno-associated virus.

12. The fusion adeno-associated virus vector system according to claim 10, characterized in that: The adeno-associated virus vector system also includes an expression plasmid comprising a heterologous nucleotide encoding a desired product.

13. The fusion adeno-associated virus vector system according to any one of claims 10 to 12, characterized in that: The adeno-associated virus vector system further comprises a helper virus plasmid or a helper virus, and the fusion adeno-associated virus vector system further comprises a host cell.

14. A pharmaceutical composition or conjugate, characterized in that: The pharmaceutical composition comprises the fusion adeno-associated virus as described in claim 7 or claim 8 and a pharmaceutically acceptable excipient; the conjugate comprises the fusion adeno-associated virus as described in claim 7 or claim 8 and a biologically active polypeptide connected thereto.

15. The pharmaceutical composition or conjugate according to claim 14, characterized in that: The pharmaceutical composition or conjugate dosage form is one or more of injection, tablet, capsule, aerosol, eye drops or nasal drops.

16. Use of the fusion adeno-associated virus AAV2-ACM202 capsid protein as described in any one of claims 1 to 3, or the nucleic acid as described in claim 4, or the construct as described in claim 5, or the fusion adeno-associated virus as described in claim 7 or claim 8, or the host cell as described in claim 6, or the cell as described in claim 9, or the fusion adeno-associated virus vector system as described in any one of claims 10 to 13, or the pharmaceutical composition or conjugate as described in claim 14 or claim 15 in the preparation of a medicament for preventing or treating a disease.

17. The use according to claim 16, characterized in that The disease is selected from one or more of ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, and neurodegenerative inflammatory diseases.

18. The use according to claim 17, characterized in that Include at least one of the following: 1) The ophthalmic disease is a disease related to cell damage; 2) The ophthalmic disease is a related disease caused by a gene defect; 3) The ophthalmic disease is a disease related to environmental factors; 4) The ophthalmic disease reported is a disease related to aging; 5) The ophthalmic disease is a disease related to primary tumor; 6) The ophthalmic disease is a disease related to cancer cell migration; 7) The ophthalmic disease is a retinal layer related disease.

19. The use according to claim 16, characterized in that The drug has at least one of the following functions: 1) Under the condition of intravitreal injection, mediate the expression of the target gene specifically in the retina; 2) Able to infect retinal ganglion cells.

Images