A high-yield claryol Pichia yeast engineered strain and its construction method and application

Abstract

The present invention belongs to the field of microbial metabolic engineering and synthetic biology technology applications, and particularly relates to a Pichia pastoris engineered strain that produces high sclareol production, as well as its construction method and application. A sclareol biosynthesis pathway is constructed in a host strain, and the intracellular mevalonate metabolic pathway and the central metabolic pathway are optimized, thereby obtaining an engineered bacterial strain A; the host strain is Pichia pastoris; or, metabolic regulatory factors are overexpressed or knocked out in the above-obtained engineered bacterial strain A, thereby obtaining an engineered bacterial strain B; or, in the above-obtained engineered bacterial strain B, a cell compartmentalization strategy is used to target the synthesis pathway to the peroxisome and optimize it, thereby obtaining an engineered bacterial strain C. The present invention provides a Pichia pastoris chassis cell for synthesizing the diterpenoid compound sclareol and an engineered strain for synthesizing sclareol; by introducing and optimizing the expression of the sclareol synthesis pathway, the sclareol yields in shake flask batch fermentation and bioreactor batch fed-batch fermentation reach 631.6 mg / L and 10.5 g / L, respectively.

Description

Technical Field

[0001] The present invention belongs to the field of microbial metabolic engineering and synthetic biology technology applications, and particularly relates to an engineered Pichia pastoris strain capable of producing high-yield sclareol, a construction method thereof, and an application thereof. Background Art

[0002] Pichia pastoris (Komagataella), especially Komagataella phaffii (Pichia pastoris), is a methylotrophic yeast widely used in the field of biotechnology. It is favored by the industrial microbiology community because it is generally recognized as safe (GRAS) by the US FDA (Ciofalo et al., Pharmacol., 2006, 45, 1-8). With the continuous development and improvement of Pichia pastoris gene editing technology and synthetic biology components (Cai et al., Nucleic Acids Res., 2021, 49(13):7791-7805), it has become an important chassis for the biosynthesis of many important compounds, capable of efficiently producing fatty acids (Cai et al., Proc Natl Acad Sci US A., 2022, 119(29):e2201711119), polyketides (Liu et al., Metab Eng, 2018, 45:189-199) and complex alkaloids (Gao et al., Nat. Synth, 2023, 2, 231-242), etc. Sclareol is a diterpene alcohol derived from Salvia plants. It not only has multiple physiological and pharmacological activities, but is also an important raw material for the current industrial synthesis of ambroxan, with high value and broad market demand.

[0003] Although Pichia pastoris has made significant progress in heterologous protein expression and biopharmaceutical production (Schwarzhans et al., Biotechnology Advances, 2017, 35(6): 681-710), there is currently no literature reporting its application in the production of diterpenoids. Summary of the Invention

[0004] The purpose of the present invention is to provide an engineered Pichia yeast strain capable of producing a high yield of the diterpene compound sclareol.

[0005] Another object of the present invention is to provide a method for constructing the engineered strain.

[0006] Another object of the present invention is to provide the use of the Pichia pastoris engineered strain in the production of sclareol.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] The host strain is selected from any one of the yeasts of the genus Komagataella.

[0009] Preferably, the host strain is Pichia pastoris Komagataella phaffii.

[0010] A method for constructing an engineered Pichia pastoris strain that produces high levels of sclareol, comprising constructing a sclareol biosynthesis pathway in a host strain and optimizing the intracellular mevalonate metabolic pathway and the central metabolic pathway to obtain an engineered bacterial strain A; the host strain is Pichia pastoris;

[0011] Alternatively, the metabolic regulatory factor is overexpressed or knocked out in the engineered bacteria A obtained above, thereby obtaining the engineered bacteria strain B;

[0012] Alternatively, in the above-mentioned engineered bacteria B, a cell compartmentalization strategy is used to target the synthetic pathway to the peroxisome and optimize it, thereby obtaining engineered bacteria strain C.

[0013] The engineered bacterial strain A is regulated by integrating the sclareol synthase gene (SsTPS) and the lysoleyl pyrophosphate synthase gene (SsLPPS) into the chromosome PNSII-5 site in the host strain, optimizing the integration of at least one or more synthase genes or isoenzymes with the same / similar functions in the host strain mevalonate pathway into the host strain chromosome, weakening the competitive pathway for squalene synthesis, increasing the supply of precursor acetyl-CoA, and increasing the supply of reducing power NADPH.

[0014] The SsLPPS and SsTPS gene fusion expression is that the amino terminus of SsTPS and the carboxyl terminus of SsLPPS are connected by a flexible connecting peptide GGGGS (the nucleotide sequence of the fusion gene fragment is shown in SEQ ID NO: 1); integrated into the host genome through a promoter; wherein the promoters of different strengths include P TEF1 、P GAP 、P GCW14 At least one of the following. The fusion gene nucleotide sequence is shown in SEQ ID NO: 1;

[0015] The optimized host strain mevalonate pathway (including the ERG10 gene, ERG13 gene, truncated tHMGR gene, ERG12 gene, ERG8 gene, ERG19 gene, IDI1 gene, ERG20 gene or BTS1 gene) includes at least one of 1) to 7);

[0016] 1) DNA fragment P TEF1 -tHMG1-T DAS1integrated into the host PNSII-1 site; the nucleotide sequence of the truncated HMG1 gene is shown in SEQ ID NO: 2;

[0017] 2) DNA fragment P TEF1 -ERG20 F98C -T DAS2 Integrate into the host PNSII-7 site; the mutant gene is the endogenous ERG20 gene where the phenylalanine at position 98 is replaced by cysteine; the ERG20 F98C The nucleotide sequence from position 292 to 294 after the gene mutation is tgc;

[0018] 3) DNA fragment P TEF1 -PaGGPPS~BTS1-T ADH2 Integrate into the host PNSII-4 site; the fusion expression construction method is to connect the carboxyl end of PaGGPPS and the amino end of BTS1 using a flexible connecting peptide GGGGS; the nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO: 3; the nucleotide sequence of the flexible connecting peptide GGGGS is shown in SEQ ID NO: 4;

[0019] Furthermore, the geranylgeranyl pyrophosphate synthase gene PaGGPPS from Phomopsis amygdali is integrated into the host strain chromosome. Alternatively, the PaGGPPS gene can be expressed as a fusion protein gene with the endogenous BTS1 gene; preferably, the carboxyl terminus of the PaGGPPS gene is linked to the amino terminus of the BTS1 gene using a GGGGS linker peptide for optimal results.

[0020] 4) DNA fragment P HXT1 -ERG10-ERG13-T AOX1 Integration into the host PNSII-6 site;

[0021] Furthermore, the endogenous ERG10 and ERG13 genes are integrated into the host strain chromosome. Alternatively, the ERG10 gene can be constructed into a fusion protein gene with the ERG13 gene for expression. Preferably, the amino terminus of the ERG13 gene is linked to the carboxyl terminus of the ERG10 gene using a GGGGS linker peptide for better results.

[0022] 5) DNA fragment T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T ERG8 Integration into the host PNSII-8 site;

[0023] 6) DNA fragment P MSR1c3 -ERG19-TERG19 Integration into the host PNSII-9 site;

[0024] 7) Connect the degradation protein tag CLN2 to the carboxyl end of the host strain ERG9 gene PEST .

[0025] Furthermore, a protein degradation tag is added to the carboxyl terminus of the ERG9 gene in the host strain. Optionally, the degradation tag is the endogenous cell cycle regulator CLN2 of Pichia pastoris. PEST The CLN2 PEST The nucleotide sequence of the gene is shown in SEQ ID NO:5.

[0026] Optionally, the construction method further comprises increasing the copy number of one or more genes among the above genes.

[0027] The method for increasing the supply of precursor acetyl-CoA comprises introducing at least one of the phosphoketolase gene PK, the phosphotransacetylase gene PTA, the ATP-dependent citrate lyase gene ACL and the citrate and α-ketoglutarate transporter gene YHM2 or isoenzymes with the same or similar functions into the chromosome;

[0028] The nucleotide sequence of the PK gene is shown in SEQ ID NO: 6; the nucleotide sequence of the PTA gene is shown in SEQ ID NO: 7; and the nucleotide sequence of the ACL gene is shown in SEQ ID NO: 8.

[0029] The method for increasing NADPH supply comprises introducing at least one of the NADP-specific isocitrate dehydrogenase 2 gene IDP2, the 6-phosphate glucose dehydrogenase gene ZWF1, the phosphate glucose dehydrogenase isomer 1 gene GND1, the fructose 1,6-bisphosphatase gene FBP1, the transketolase gene TKL and the transaldolase gene TAL or isoenzymes with the same or similar functions into the chromosome;

[0030] The nucleotide sequence of the IDP2 gene is shown in SEQ ID NO: 9;

[0031] Going further,

[0032] The method for increasing the supply of precursor acetyl-CoA includes at least one of 7) to 9):

[0033] 7) DNA fragment T FDH1 -PK-P HTX1 -PTA-T FBP1 integrated into the PNSIII-5 site;

[0034] 8) DNA fragment P GCW14-ACL-T FAA1 integrated into the PNSI-11 locus;

[0035] 9) DNA fragment P TPI1 -YHM2-T AOX1 integrated into the PNSI-1 locus;

[0036] The method for increasing the supply of reducing power NADPH includes at least one of 10) to 13):

[0037] 10) DNA fragment P GAP -IDP2-T DAS2 integrated into the PNSI-4 locus;

[0038] 11) DNA fragment P TEF1 -ZWF1-T AOX1 -T PMP20 -GND1-P PGI1 integrated into the PNSIV-8 locus;

[0039] 12) DNA fragment P TEF1 -FBP1-T FBP1 integrated into the PNSI-13 locus;

[0040] 13) DNA fragment T ADH2 -TKL-P TPI -P ADH2 -TAL-T DAS1 integrated into the PNSI-10 locus;

[0041] The engineered bacterial strain B is a potential metabolic regulatory factor that regulates the synthesis of sclareol; wherein the regulation method is one or more of knocking out the metabolic regulatory factor, overexpressing the metabolic regulatory factor, and weakening the metabolic regulatory factor;

[0042] The knocked-out metabolic regulatory factor is one or more of YPR065W, DOS2, VBA5, YNR063W, SER33, ARP6, ERG24, RPB1, ECM25, YNL010W, PDR5, PDR15, YIA6, UTP30, ECM33, YNL096C, NDT80, URE2, SSP1, LAC1, PGM1, KEX1, NSG2, YPK9, MPD1, GEA2, YNR034W, YKR001C, MOD5, LAM5, LAM4, CAB1, SUT2, VPS4, and STE20 genes;

[0043] The overexpressed metabolic regulatory factor is one or more of the YNL010W gene, the ECM33 gene, and the UPC2-1 gene;

[0044] and / or at least one of the weakened YNL096C gene or isozymes with the same / similar functions is integrated into the chromosome.

[0045] Furthermore, it includes at least one of 5) to 9);

[0046] 5) knocking out at least one of the YPR065W gene, DOS2 gene, VBA5 gene, YNR063W gene, SER33 gene, ARP6 gene, ERG24 gene, PRB1 gene, ECM25 gene, YNL010W gene, PDR5 gene, PDR15 gene, YIA6 gene, UTP30 gene, ECM33 gene, YNL096C gene, NDT80 gene, URE2 gene, SSP1 gene, LAC1 gene, PGM1 gene, KEX1 gene, NSG2 gene, YPK9 gene, MPD1 gene, YJR031C gene, YNR034W gene, YKR001C gene, MOD5 gene, LAM5 gene, LAM4 gene, CAB1 gene, SUT2 gene, VPS4 gene or STE20 gene of the host strain.

[0047] 6) DNA fragment P GCW14 -UPC2-1-T FBP1 Integrate into the host genome PNSIV-2 site; the UPC2-1 gene is a mutation of glycine at position 397 of the endogenous UPC2 gene to aspartic acid;

[0048] 7) DNA fragment P GCW14 -YNL010W-T FBP1 Integrated into the host genome PNSI-12 site;

[0049] 8) DNA fragment P GCW14 -ECM33-T FBP1 Integrates into the host genome PNSI-1 site;

[0050] 9) Integrate and express the cell cycle regulator CLN2 at the carboxyl terminus of the YNL096C gene PEST , in order to achieve the weakening of YNL096C expression. PEST The nucleotide sequence of the gene is shown in SEQ ID NO:5.

[0051] The engineered bacterial strain C is to integrate the sclareol synthesis pathway and the MVA pathway into the peroxisome for compartmentalization and optimization. The compartmentalization pathway includes ERG10, ERG13, truncated tHMG1, ERG12, ERG8, ERG19, IDI1, GGPPS, ERG20 F98CAt least one of the BTS1, LPPS and TPS genes or isoenzymes with the same or similar functions is integrated into the chromosome;

[0052] The optimization method further includes knocking out the peroxisome proliferator gene PEX11, overexpressing at least one of the endogenous 3-ketoacyl-CoA thiolase gene POT1, the peroxisome biogenesis factor gene PEX10, the peroxisome adenine nucleoside transporter gene ANT1, the peroxisome membrane signaling receptor gene PEX5, the NADH-dependent 3-hydroxy-3-methylglutaryl-CoA reductase gene HMGR, or isoenzymes with the same / similar functions;

[0053] The peroxisome targeting method is achieved by utilizing the peroxisome signal peptide SKL at the carboxyl end of the target gene.

[0054] The nucleotide sequence of the peroxisome-targeted HMGR gene is shown in SEQ ID NO: 10.

[0055] The cell compartmentalization strategy comprises at least one of 10) to 15);

[0056] 10) DNA fragment P GCW14 -SsTPS~SsLPPS-T FBP1 Integrates into the host genome PNSII-8 site;

[0057] 11) DNA fragment P TEF1 -PaGGPPS~BTS1-T ADH2 Integrates into the host genome PNSIII-5 site;

[0058] 12) DNA fragment P TEF1 -ERG20 F98C -T DAS2 -T DAS1 -tHMG1-P GAP Integrates into the host genome PNSIII-4 site;

[0059] 13) DNA fragment T TAL2 -ERG19-P HTX1 -ERG10~ERG13-T AOX1 Integrates into the host genome PNSIII-6 site;

[0060] 14) DNA fragment T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T DAS1 Integrates into the host genome PNSIII-7 site;

[0061] 15) DNA fragment P ADH2 -IDI1-T FBP1 Integrates into the host genome PNSIII-10 site;

[0062] Optionally, the optimization method of the cell compartmentalization strategy comprises at least one of 16) to 20);

[0063] 16) DNA fragment P GCW14 -HMGR-T DAS1 Integrates into the host genome PNSIII-11 site;

[0064] 17) DNA fragment T DAS2 -ANT1-PG CW14 -P TEF1 -POT1-T GAP Integrates into the host genome PNSIII-12 site;

[0065] 18) DNA fragment P TEF1 -PEX10-T GAP Integrated into the host genome PNSI-12 site;

[0066] 19) DNA fragment P PGI1 -PEX5-T FBP1 Integrated into the host genome PNSI-6 site;

[0067] 20) Inserting upstream and downstream homology arm sequences of the CDS region into the PEX11 gene locus to knock out the gene;

[0068] Optionally, the promoter of each expression cassette is the promoter P of Pichia pastoris. TEF1 、P GCW14 、P GAP 、P PGI1 、P ADH2 、P FBA1 or P TPI1 Any one of; the terminator is the terminator T of Pichia pastoris AOX1 、T DAS2 、T CAT1 、T DAS1 、T PGI1 、T GPM1 、T ADH2 、T FBA1 、T TPI1 、T FDH1 、T FLD1 、T FBA2 or T PMP20 Any one of .

[0069] The construction method also includes complementing the HIS4 gene.

[0070] A method for obtaining a Pichia pastoris engineered strain with high sclareol production, and a method for constructing a Pichia pastoris engineered strain with high sclareol production.

[0071] An application of the Pichia pastoris engineered strain capable of producing high sclareol yield, and an application of the engineered strain in large-scale cell culture to synthesize the diterpenoid compound sclareol.

[0072] As an implementation plan,

[0073] The beneficial effects of this application include:

[0074] The present invention provides a Pichia pastoris chassis cell for synthesizing a diterpenoid compound, sclareol, and an engineered strain for synthesizing sclareol. The chassis cell construction method comprises strengthening the MVA pathway, weakening the competitive pathway, increasing the supply of NADPH and the precursor acetyl-CoA, regulating metabolic regulatory factors related to sclareol synthesis, and adopting a cell compartmentalization strategy to target the synthesis pathway to the peroxisome. The engineered strain for synthesizing sclareol is based on the chassis cell, and by introducing and optimizing the expression of the sclareol synthesis pathway, the sclareol yields in shake flask batch fermentation and bioreactor batch fermentation reach 631.6 mg / L and 10.5 g / L, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 The metabolic engineering strategy for constructing a Pichia pastoris chassis cell for synthesizing the diterpenoid compound sclareol is presented.

[0076] Figure 2 The gas chromatogram, mass spectrum and yield graph of the sclareol product in the integrated sclareol synthesis engineered strain are shown, wherein A is the gas chromatogram and corresponding mass spectrum of the fermentation broth extract of the engineered strain and the sclareol standard, and B is the sclareol yield graph of the engineered strain;

[0077] Figure 3 The diagram shows the sclareol production after strengthening the MVA pathway and weakening the competitive pathway, where A is the production graph of the engineered strain after strengthening the MVA pathway, and B is the production graph of sclareol after further weakening the competitive pathway and increasing the number of synthase copies;

[0078] Figure 4 The figure shows the production of sclareol after strengthening the supply of acetyl-CoA and NADPH;

[0079] Figure 5The diagram shows the sclareol production after adapting the metabolic regulatory factors, where A is a graph showing the sclareol production after knocking out or overexpressing the metabolic regulatory factors one by one in the engineered strain MY38, and B is a graph showing the sclareol production after combining the metabolic regulatory factors in the engineered strain MY55;

[0080] Figure 6 The figure shows the production of sclareol after integrating and optimizing the peroxisome biosynthesis pathway;

[0081] Figure 7 The sclareol production by shake flask fed-batch fermentation is shown;

[0082] Figure 8 The yield of sclareol in bioreactor fermentation is shown. DETAILED DESCRIPTION

[0083] In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from commercial channels.

[0084] The present invention constructs a biosynthetic pathway for sclareol in Pichia pastoris, combines it with a combination of rational metabolic engineering strategies such as strengthening its endogenous mevalonate pathway, weakening competitive branches, and enhancing the supply of precursors and cofactors of the central metabolic pathway. At the same time, it widely screens and adapts regulatory gene targets related to the enhanced synthesis of diterpenoid compounds. On this basis, it superimposes a peroxisome compartmentalization strategy to successfully construct an engineered strain of Pichia pastoris that efficiently produces sclareol, and the yield is significantly improved compared with the strain that only integrates the synthetic pathway.

[0085] The initial strain sampled in the following examples is based on the recombinant Pichia pastoris PC111 (genotype Mut+, his4-, AOX1, AOX2, HIS4::PGAP-PpRAD52-TAOX1, PNSI-2::PGAP-hCas9-TDAS, the strain is derived from the report in Cai et al., Nucleic Acids Res. 2021; 49(13): 7791-7805) that was independently modified in the laboratory in the early stage, and the engineered strain was genetically modified with the help of CRISPR-Cas9 technology (the strain construction method was carried out in accordance with the records in Cai et al., Nucleic Acids Res. 2021; 49(13): 7791-7805).

[0086] The present invention provides a Pichia pastoris chassis cell for efficiently synthesizing sclareol; the construction method includes optimizing enzyme expression, strengthening the mevalonate pathway, weakening the product competition pathway, strengthening the supply of reducing power NADPH and acetyl-CoA, and screening for potential metabolic regulatory factors related to sclareol synthesis; the schematic diagram of the specific transformation is shown in FIG. Figure 1 shown.

[0087] Example 1

[0088] 1) Expression and optimization of lysoleyl pyrophosphate synthase and sclareol synthase

[0089] First, a donor DNA expression cassette (SsTPS-GGGGS-SsLPPS) was constructed for the fusion expression of the codon-optimized lysine pyrophosphate synthase gene SsLPPS and the sclareol synthase gene SsTPS. The donor DNA fragment included 750 bp of upstream and downstream homology arms of the PNSII-5 site amplified using PC111 as a template (the gene integration site refers to Yu et al. Synth Syst Biotechnol 2021, 6: 63-68), the promoter P TEF1 , terminator T FBP1 and structural genes (for the construction process of fusion fragments, refer to Zhou et al. J Am Chem Soc 2012, 134: 3234-3241);

[0090] With the help of CRISPR-Cas9 technology (for the transformation process, refer to Cai et al., Nucleic Acids Res. 2021; 49(13): 7791-7805), the donor DNA and gRNA II-5 were transformed into the starting strain PC111 by electroporation, spread on YPD plates containing G418 antibiotics, and cultured at 30°C for 3-4 days for screening. The correctness was verified by colony PCR, and the cells were subcultured in YPD liquid medium for plasmid loss;

[0091] The obtained engineered strain was fermented, extracted and tested, and it was confirmed that the integration of SsLPPS and SsTPS could produce sclareol (engineered strain MY01); and P GCW14 The MY03 that initiated transcription was most conducive to the synthesis of sclareol, and the yield after promoter optimization was 0.22 mg / L ( Figure 2 ).

[0092] Specifically:

[0093] Using Pichia pastoris PC111 as a template, the neutral site on the chromosome (neutral site reference Cai et al., Nucleic Acids Res. 2021; 49(13): 7791-7805) II-5 upstream and downstream 750 bp homology arm fragments PNSII-5UP, PNSII-5DN, and the promoter P TEF1 , terminator T FBP1The lysyl pyrophosphate synthase gene SsLPPS and the sclareol synthase gene SsTPS were synthesized after codon optimization. The two gene fragments were connected by a GGGGS linker peptide. The sequence is shown in SEQ ID NO: 1. TEF1 ,SsTPS~GGGGS~SsLPPS,T FBP1 , PNSII-5DN was fused into a long fragment (refer to J Am Chem Soc 2012, 134: 3234-3241 for the construction process of the fusion fragment), and the donor DNA expression cassette (PNSII-5UP-P TEF1 -SsTPS~GGGGS~SsLPPS-T FBP1 -PNSII-5DN); and optimized expression donor DNA: the promoter was replaced by P GAP or P GCW14 . The PNSII-5gRNA expression vector (gRNA vector from Cai et al., Nucleic Acids Res. 2021; 49(13): 7791-7805) and 500 ng of donor DNA were transformed into Pichia pastoris PC111 strain by electroporation, spread on YPD screening plates supplemented with antibiotic G418, and cultured at 30°C for 3-4 days. The transformants were cultured in liquid YPD medium containing G418 and verified by colony PCR. The fermentation broth was inoculated into antibiotic-free YPD liquid for plasmid loss. The strains after plasmid loss were named engineered bacteria MY01, MY02, and MY03.

[0094] The engineered strain was activated in MM medium, cultured at 30°C, 220 rpm for 16-20 h, and then transferred to 20 mL MM medium / 100 mL shake flask. The initial OD 600 =0.2, 30 ° C, 220 rpm conditions for 96 h, determination of biomass and yield; after fermentation extraction detection fusion gene expression MY01 can synthesize sclareol from scratch to reach 0.16 mg / L, and P GCW14 The MY03 that initiated transcription was most conducive to the synthesis of sclareol, and the yield after promoter optimization was 0.22 mg / L ( Figure 2 B) The following engineering bacteria construction, transformation, and fermentation followed the same conditions.

[0095] Table 1: Amplification primers involved in the construction of donor DNA in the examples of this application

[0096]

[0097] 2) Strengthening MVA pathway genes to improve chassis cell product synthesis capacity

[0098] Based on the engineered strain MY03, the MVA pathway was enhanced. Using the CRISPR / Cas9 system, MVA pathway genes were engineered using different promoters and terminators to construct donor DNA expression cassettes. These cassettes were then integrated into different genomic sites, resulting in the MVA pathway-optimized strain MY25. The main genes and sites (not limited to) are listed in Table 2.

[0099] Table 2 Gene-related information involved in strengthening the MVA synthesis pathway in the examples of this application

[0100]

[0101] The specific steps for constructing and integrating the MVA pathway-related gene expression cassette into the genome are as follows: First, the Pichia pastoris PC111 genome is used as a template to amplify the 750-bp homology arm sequences upstream and downstream of the integration site, the promoter, the terminator, and the structural gene, respectively. Fusion PCR is then used to obtain the complete donor DNA fragment. Subsequently, the gRNA expression vector and the gene expression cassette (500 ng each) are transformed into Pichia pastoris by electroporation, plated onto resistance-containing selection plates, and incubated at 30°C for 3–4 days. Colony PCR is performed to verify the correctness of the transfection, and the strain is then transferred to YPD liquid medium for plasmid loss. The strain after plasmid loss is then stored for future use. Other genome editing procedures described below follow a similar process.

[0102] After fermentation, extraction and testing, the production of the engineered strain MY25 with enhanced MVA pathway reached 98 mg / L ( Figure 3 ).

[0103] Based on the engineered strain MY25, the squalene synthase ERG9 gene (NCBI accession number: 8200142) was weakened. First, the ERG9 gene was amplified from the genome using PC111 as a template, and the terminator T ADH2 , upstream and downstream homology arms (750-1000bp upstream and 750-1000bp downstream of the ERG9 gene CDS region are homology arms), degrading protein CLN2 PEST gene, and then fused ERG9 with a degradation protein tag using fusion PCR to construct a donor DNA fragment (ERG9UP-ERG9-CLN2 PEST -T ADH2 -ERG9DN); then, a gRNA targeting the genomic ERG9 terminator was constructed. Subsequently, the gRNA expression vector and the gene expression cassette (500 ng each) were transformed into Pichia pastoris by electroporation, plated onto a resistance screening plate, and cultured at 30°C for 3-4 days. The correctness was verified by colony PCR, and the strain was transferred to YPD liquid medium for plasmid loss. The strain MY30 after plasmid loss was stored for future use.

[0104] On the basis of the engineered strain MY30, the MVA pathway was further strengthened, and the copy number of the fusion gene of SsLPPS gene and SsTPS gene was increased at the PNSIV-5 and / or PNSIV-9 loci (the donor DNA was PNSIV-5UP-P GCW14 -SsTPS~SsLPPS-T GAP -PNSIV-5DN;PNSIV-9UP-P GCW14 -SsLPPS~SsTPS-T FBP1 -PNSIV-9DN) to obtain the engineered strain MY38.

[0105] After fermentation extraction testing, the production of the engineered strain MY38, which strengthens the MVA pathway and weakens the competitive pathway, reached 213.6 mg / L ( Figure 3 ).

[0106] Specifically, based on the engineered bacteria MY03, the MVA pathway was enhanced. The mutant gene ERG20 of endogenous erg20p was overexpressed at its PNSII-7 site. F98C (ERG20 986C The nucleotide sequence from position 292 to position 294 after gene mutation is tgc)(donor DNA is PNSII-7UP-P TEF1 -ERG20 F98C -T DAS2 -PNSII-7DN); integrate the GGPP synthase gene from Phomopsis amygdali at the PNSII-4 site to construct a synthase-only expression donor DNA expression cassette (PNSII-4UP-P TEF1 -PaGGPPS-T ADH2 -PNSII-4DN) and optimized expression donor DNA: PaGGPPS gene and endogenous BTS1 fusion expression (PaGGPPS was fused to the 5' end and 3' end of the BTS1 gene, respectively, with a connecting peptide of GGGGS, the nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO: 3; the sequence of the flexible connecting peptide GGGGS is shown in SEQ ID NO: 4; the fusion gene PaGGPPS~BTS1:PNSII-4UP-P TEF1 -PaGGPPS~BTS1-T ADH2 -PNSII-4DN and BTS1~PaGGPPS:PNSII-4UP-P TEF1 -BTS1~PaGGPPS-T ADH2-PNSII-4DN); the truncated tHMG1 gene (truncated with reference to the Saccharomyces cerevisiae tHMGR sequence, Polakowski et al., Appl Microbiol Biotechnol, 1998, 49: 66-71, the nucleotide sequence of which is encoded by the gene is shown in SEQ ID NO: 2) was integrated into the PNSII-1 locus, and the second copy of the fusion gene of SsTPS and SsLPPS (donor DNA is PNSII-1UP-T GAP -SsTPS~SsLPPS-P GCW14 -P TEF1 -tHMG1-T DAS1 -PNSII-1DN); ERG10 gene and ERG13 gene were separately integrated at the PNSII-6 locus (donor DNA was PNSII-6UP-T TAL2 -ERG10-P HXT1 -ERG13-T AOX1 -PNSII-6DN) and optimized expression donor DNA: ERG10 gene and ERG13 gene fusion expression (ERG10 was fused to the 5' end and 3' end of the BTS1 gene, respectively, with a connecting peptide of GGGGS to obtain the fusion gene ERG10~ERG13:PNSII-6UP-P HXT1 -ERG10~ERG13-T AOX1 -PNSII-6DN and ERG13~ERG10:PNSII-6UP-P HXT1 -ERG13~ERG10-T AOX1 -PNSII-6DN); ERG8 and ERG12 genes were integrated at the PNSII-8 locus (donor DNA was PNSII-8UP-T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T ERG8 -PNSII-8DN); ERG19 gene was integrated into the PNSII-9 locus (donor DNA was PNSII-9-P MSR1c3 -ERG19-T ERG19 -PNSII-9DN); preferably, the truncated tHMG1 gene and the second copy of the TPS-LPPS gene are integrated again at the PNSI-14 site (donor DNA is PNSI-14UP-T GAP -SsTPS~SsLPPS-P GCW14 -P TEF1 -tHMG1-T DAS1-The specific steps for constructing the MVA pathway-related gene expression cassette and integrating it into the genome were the same as described above. Unless otherwise specified, the above-mentioned endogenous gene elements were obtained by PCR amplification from the PC111 strain genome.

[0107] After fermentation extraction testing, the MY25 yield of the enhanced MVA pathway reached 98 mg / L ( Figure 3 A).

[0108] Adding the endogenous cell cycle regulator CLN2 to the carboxyl terminus of the ERG9 gene in the engineered strain PEST , as a protein degradation tag to weaken the expression of ERG9 gene (the CLN2 PEST The nucleotide sequence of the gene is shown in SEQ ID NO: 5, and the donor DNA is ERG9UP-CLN2 PEST -T ADH2 -ERG9DN), and then construct a gRNA targeting the genomic ERG9 gene terminator (plasmid backbone primers, the underline is the gRNA sequence, gF: GCGTACATATCAAACGTATG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG; gR: CATACGTTTGATATGTACGC The specific steps for constructing the relevant gene expression cassette and integrating it into the genome were the same as described above. Unless otherwise specified, the above elements were amplified by PCR from the PC111 genome. The engineered strain MY30 was obtained.

[0109] Preferably, on the basis of the engineered strain MY30, the third and / or fourth copies of the TPS-LPPS fusion gene are again integrated into the PNSIV-5 or / and PNSIV-9 loci (donor DNA is PNSIV-5UP-P GCW14 -SsTPS~SsLPPS-T GAP -PNSIV-5DN;PNSIV-9UP-P GCW14 -SsTPS~SsLPPS-T FBP1 -PNSIV-9DN); preferably, after integrating the third copy of the TPS-LPPS fusion gene, the engineered strain MY38 is obtained, and on this basis, the gene copy number is further increased, and the sclareol production no longer increases.

[0110] After fermentation extraction testing, the production of the engineered strain MY38, which strengthens the MVA pathway and weakens the competitive pathway, reached 213.6 mg / L ( Figure 3 B).

[0111] Table 3 Amplification primers involved in the construction of donor DNA in the examples of this application

[0112]

[0113]

[0114]

[0115] 3) Strengthen the supply of precursor acetyl-CoA and reducing power NADPH to improve the ability of chassis cell product synthesis

[0116] Based on the engineered strain MY38, the supply of the precursor acetyl-CoA in the strain was enhanced. Using the CRISPR / Cas9 system, donor DNA expression cassettes containing the Leuconostoc mesenteroides-derived phosphoketolase gene PK, the Clostridium kluyveri-derived phosphotransacetylase gene PTA, and the Mus musculus-derived ATP-dependent citrate lyase gene ACL were constructed and integrated into different genomic sites via electroporation. The main genes and sites (not limited to) are shown in Table 4.

[0117] Table 4. Gene-related information related to enhancing acetyl-CoA supply in this application example

[0118]

[0119] The above-mentioned endogenous gene elements were obtained by PCR amplification from the PC111 strain genome, and the structural genes were amplified from the strain independently modified in our laboratory in the early stage (refer to Cao et al., Metab Eng. 2023; 75: 19-28).

[0120] After fermentation, extraction and testing, it was found that the integrated expression of PK and PTA was most conducive to the synthesis of sclareol, and the engineered strain was named MY50, with a yield of 255.2 mg / L ( Figure 4 ).

[0121] Based on the engineered strain MY50, the supply of reducing power NADPH was enhanced. With the help of the CRISPR / Cas9 system, the IDP2, ZWF1, GND1, FBP1, TKL and TAL genes were constructed into donor DNA expression cassettes (Table 5) using different promoters and terminators and integrated into different sites of the genome. The main genes and sites (not limited to) are shown in Table 5;

[0122] Table 5. Gene-related information related to enhancing acetyl-CoA supply in this application example

[0123]

[0124] After fermentation, extraction and testing, it was found that the integrated expression of IDP2, ZWF1, GND1 and FBP1 genes was most conducive to the synthesis of sclareol; the engineered strain MY55 was obtained, which strengthened the MVA pathway, weakened the competitive pathway, and enhanced the supply of substrate acetyl-CoA and reducing power NADPH, with a yield of 352.8 mg / L ( Figure 4 ).

[0125] Specifically, based on the strain MY38 with enhanced MVA pathway and weakened competitive pathway, the supply of precursor acetyl-CoA in the strain was enhanced. The phosphoketolase gene PK and the phosphotransacetylase gene PTA were introduced into the PNSIII-5 locus of the host strain (donor DNA was PNSIII-5UP-T FDH1 -PK-P HTX1 -PTA-T FBP1 -PNSIII-5DN) (the nucleotide sequence of the PK gene is shown in SEQ ID NO: 6) (the nucleotide sequence of the PTA gene is shown in SEQ ID NO: 7); the ATP-dependent citrate lyase gene ACL is introduced into the host strain at the PNSI-11 site (the donor DNA is PNSI-11UP-P GCW14 -ACL-T FAA1 --PNSI-11DN) (the nucleotide sequence of the ACL gene is shown in SEQ ID NO: 8); the citrate and α-ketoglutarate transporter gene YHM2 (donor DNA is PNSI-1UP-P) was introduced into the host strain at the PNSI-1 site. TPI1 -YHM2-T AOX1- PNSI-1DN), and the engineered strain MY50 integrated with the phosphoketolase gene PK and the phosphotransacetylase gene PTA was found to be superior in sclareol synthesis after fermentation testing. The specific steps for constructing the relevant gene expression cassette and genome integration were the same as above. The above endogenous elements were amplified by PCR from the PC111 strain genome. The engineered strain MY50, which strengthens the MVA pathway, weakens the competitive pathway, and enhances the supply of substrate acetyl-CoA, achieved a yield of 255.2 mg / L ( Figure 4 ).

[0126] Based on the engineered bacteria MY50 that strengthens the MVA pathway, weakens the competitive pathway, and increases the supply of precursor acetyl-CoA, the IDP2 gene from Saccharomyces cerevisiae was integrated at the PNS1-4 site (the donor DNA is PNS1-4UP-P GAP -IDP2-T DAS2-PNSI-4DN) (the nucleotide sequence of the IDP2 gene is shown in SEQ ID NO: 9); overexpression of the endogenous ZWF1 gene and GND1 gene at the PNSIV-8 locus (donor DNA is PNSIV-8UP-P TEF1 -ZWF1-T AOX1 -T PMP20 -GND1-P PGI1 -PNSIV-8DN); overexpression of the endogenous FBP1 gene at the PNSI-13 locus (donor DNA is PNSI-13UP-P TEF1 -FBP1-T FBP1 -PNSI-13DN); overexpression of the endogenous TAL gene and transaldolase gene TKL at the PNSI-10 locus (donor DNA is PNSI-10UP-T ADH2 -TKL-P TPI -P ADH2 -TAL-T DAS1 -PNSI-10DN), and the engineered strain MY55 obtained by fermentation testing, which integrates the NADP-specific isocitrate dehydrogenase 2 gene IDP2, the 6-phosphate glucose dehydrogenase gene ZWF1, the phosphate glucose dehydrogenase isomer 1 gene GND1, and the fructose 1,6-bisphosphatase FBP1, is better in the synthesis of sclareol. The specific steps of the relevant gene expression cassette construction and genome integration are the same as above. The above endogenous elements are all obtained by PCR amplification from the PC111 strain genome. The engineered strain MY55, which strengthens the MVA pathway, weakens the competitive pathway, and enhances the supply of substrate acetyl-CoA and reducing power NADPH, has a yield of 352.8 mg / L ( Figure 4 ).

[0127] Table 6: Amplification primers involved in the construction of donor DNA in the examples of this application

[0128]

[0129]

[0130] Example 2 Regulating Potential Metabolic Regulators Related to Sclareol Synthesis

[0131] The study knocked out the genes of metabolic regulators that regulate endogenous sclareol synthesis in Pichia pastoris, providing new targets for metabolic engineering modification for the construction of diterpene biosynthesis chassis;

[0132] The metabolic regulatory factor screening method includes knocking out YPR065W, DOS2, VBA5, YNR063W, SER33, ARP6, ERG24, RPB1, ECM25, YNL010W, PDR5, PDR15, YIA6, UTP30, ECM33, YNL096C, NDT80, URE2, SSP1, LAC1, PGM1, KEX1, NSG2, YPK9, MPD1, GEA2, YNR034W, YKR001C, MOD5, LAM5, LAM4, CAB1, SUT2, VPS4, and STE20 genes, and overexpressing YNL010W, ECM33, and UPC2-1 genes;

[0133] The specific construction method is to use the CRISPR / Cas9 system on the basis of the MY38 strain and the genome of the PC111 strain as a template to amplify the upstream and downstream homology arms of the above-mentioned genes from the genome (the upstream 750 to 1000 bp of the gene CDS region is the upstream homology arm, and the downstream 750 to 1000 bp is the downstream homology arm), and use fusion PCR to connect the upstream and downstream homology arms into a complete gene knockout donor DNA fragment; then construct a gRNA expression vector targeting each gene; transform it into Pichia pastoris by electroporation, spread it on a screening plate containing resistance and culture it at 30°C for 3 to 4 days, verify its correctness by colony PCR, transfer it to YPD liquid culture medium for plasmid loss, and preserve the strain after plasmid loss for future use.

[0134] Specifically:

[0135] First, the genome of PC111 strain was used as a template to amplify YPR065W, DOS2, VBA5, YNR063W, SER33, ARP6, ERG24, RPB1, ECM25, YNL010W, PDR5, PDR15, YIA6, UTP30, ECM33, YNL096C, NDT80, URE2, SSP1, LAC1, PGM1, KEX1, NSG2, YPK9, MPD1, GEA2, and YNR034 from the genome. The upstream and downstream homology arms of W, YKR001C, MOD5, LAM5, LAM4, CAB1, SUT2, VPS4, and STE20 genes (the upstream 750-1000 bp of the gene CDS region is the upstream homology arm, and the downstream 750-1000 bp is the downstream homology arm) were connected to form a complete gene knockout donor DNA fragment by fusion PCR; then, gRNA expression vectors targeting each gene were constructed (the amplification plasmid backbone primers of each gene are shown in Table 7, and the gRNA sequence is underlined) (see Figure 5 A).

[0136] Table 7 gRNA expression vector amplification primers involved in knocking out metabolic regulatory factors in the present application examples

[0137]

[0138] In addition, the YNL010W gene was overexpressed at the PNSI-12 locus of the MY38 strain genome (DNA donor was PNSI-12UP-P GCW14 -YNL010W-T FBP1 -PNSI-12DN); overexpression of ECM33 gene at PNS1-1 locus (DNA donor is PNSI-1UP-P GCW14 -ECM33-T FBP1 -PNSI-1DN); UPC2-1 gene was integrated into the PNSIV-2 locus (DNA donor was PNSIV-2UP-P GCW14 -UPC2-1-T FBP1 -PNSIV-2DN) (the UPC2-1 gene is a mutation of glycine at position 397 of the endogenous UPC2 gene to aspartic acid; the mutant construction method is to replace the nucleotide sequence from positions 1189 to 1191 with gat;) (see Figure 5 A).

[0139] As can be seen from the above, after fermentation extraction and testing, the knockout of DOS2, VBA5, PRB1, PDR15, PGM1, KEX1, YPK9, LAM5 and YNL096C genes is conducive to the accumulation of sclareol products in the chassis strain; overexpression of the ECM33 gene is conducive to the accumulation of sclareol products in the chassis strain. The weakening of the YNL096C gene in the strain is specifically as follows: using the CRISPR / Cas9 system to integrate the expression of the cell cycle regulator CLN2 at the carboxyl terminus of the YNL096C gene PEST , achieving the weakening of the YNL096C gene (the CLN2 PEST The nucleotide sequence of the gene is shown in SEQ ID NO: 5. The strain was transformed into Pichia pastoris by electroporation, plated onto a resistance-containing screening plate, and statically cultured at 30°C for 3-4 days. The strain was verified as correct by colony PCR and then transferred to YPD liquid medium for plasmid loss. The strain after plasmid loss was stored for future use.

[0140] Specifically: Integrate and express the cell cycle regulator CLN2 at the carboxyl terminus of the YNL096C gene PEST To achieve the weakening of YNL096C gene expression (DNA donor is YNL096CUP-CLN2 PEST -T ADH2-RPS7BDN). Subsequently, gRNA targeting the genomic YNL096C terminator was constructed (plasmid backbone primers were amplified, and the gRNA sequence was underlined, gF: AATATTCGGTCGATT TGTAGG TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGT;gR: CTACAAATCGACCGAATATT The specific steps of genomic integration are the same as above.

[0141] Then, based on the engineered strain MY55 obtained above, the metabolic regulatory factor gene related to sclareol synthesis obtained in the Pichia pastoris obtained above was regulated and modified according to the above-described method.

[0142] After fermentation extraction and testing, the engineered strain MY70, which knocked out the VBA5 gene (NCBI entry number: 8199816) based on the MY55 engineered strain, overexpressed the ECM33 gene (NCBI entry number: 8198725) at the PNS1-1 locus, and weakened the expression of the YNL096C gene (NCBI entry number: 8200959), achieved higher sclareol production. In minimal nutrient MM medium, 20 g / L glucose, fermentation culture for 4 days, the sclareol production reached 461.1 mg / L ( Figure 5 B).

[0143] Table 8 Donor DNA construction involving amplification primers in the examples of this application

[0144]

[0145]

[0146]

[0147] Example 3 Peroxisome compartmentalization and optimization to enhance sclareol synthesis capacity

[0148] Compartmentalized copies of the mevalonate pathway and sclareol biosynthesis pathway were constructed in the peroxisome and the precursor acetyl-CoA supply, cofactor balance, ATP supply, peroxisome biogenesis, and functional transport in the peroxisome were optimized.

[0149] The method for constructing compartmentalized copies of the mevalonate pathway and the sclareol synthesis pathway in the peroxisome includes integrating and constructing copies of the mevalonate pathway and the sclareol synthesis pathway in the peroxisome based on the strain MY70; first, using the PC111 strain as a template, using the CRISPR / Cas9 system to copy ERG10, ERG13, truncated tHMG1, ERG12, ERG8, ERG19, IDI1, GGPPS, ERG20 F98C , BTS1, LPPS and TPS genes were constructed using different promoters and terminators to construct donor DNA expression cassettes and integrated into different genomic sites. The main genes and sites (not limited to) are shown in Table 9;

[0150] The optimization of the peroxisomal sclareol biosynthesis pathway involved knocking out the endogenous PEX11 gene (NCBI accession number: 8198426), overexpressing the PEX10 and PEX5 genes to regulate peroxisomal biogenesis and functional transport, overexpressing the endogenous POT1 gene to enhance the supply of the precursor acetyl-CoA, overexpressing the endogenous ANT1 gene to enhance ATP transport from the cytoplasm to the peroxisome, and integrating the NADH-dependent HMGR gene from Silicibacter pomeroyi to balance the supply of cofactors. The genes integrated into the chromosome were constructed using donor DNA expression cassettes using different promoters and terminators. The engineered strain MY83 produced 631.6 mg / L of sclareol. The main genes and loci (including but not limited to) are shown in Table 9.

[0151] Table 9. Gene-related information related to peroxisome compartmentalization and optimization in the examples of this application

[0152]

[0153] Specifically:

[0154] Based on the engineered strain MY70 that strengthens the MVA pathway, weakens the competitive pathway, enhances the supply of substrate acetyl-CoA and reducing power NADPH, and regulates metabolic regulatory factors, a compartmentalized copy of the mevalonate pathway and the sclareol biosynthesis pathway was constructed in the peroxisome. The TPS-LPPS fusion gene (donor DNA is PNSIII-8UP-P GCW14 -SsTPS~SsLPPS-T FBP1 -PNSIII-8DN); overexpression of the BTS1-GGPPS fusion gene at the PNSIII-5 site (donor DNA is PNSIII-5UP-P TEF1 --PaGGPPS~BTS1-T ADH2-PNSIII-5DN); overexpression of ERG20 at the PNSIII-4 locus F98C and tHMG1 gene (donor DNA is PNSIII-4UP-P TEF1 -ERG20 F98C -T DAS2 -T DAS1 -tHMG1-P TEF1 -PNSIII-4DN); overexpression of ERG19, ERG10, and ERG13 genes at the PNSIII-6 locus (donor DNA is PNSIII-6UP-T TAL2 -ERG19-P HTX1 -ERG10~ERG13-T AOX1 -PNSIII-6DN); overexpression of ERG12 and ERG8 genes at the PNSIII-7 locus (donor DNA is PNSIII-7UP-T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T DAS1 -PNSIII-7DN); overexpression of IDI1 gene at PNSIII-10 locus (donor DNA is PNSIII-10UP-P ADH2 -IDI1-T FBP1 -PNSIII-10DN); all the genes targeting peroxisomes are linked to the peroxisomal signal peptide SKL at the carboxyl terminus. The specific steps of genomic integration are the same as above.

[0155] After fermentation extraction and testing, the strain MY76, which strengthens the MVA pathway, weakens the competitive pathway, enhances the supply of substrate acetyl-CoA and reducing power NADPH, regulates metabolic regulatory factors, and constructs the sclareol synthesis pathway in the peroxisomes, has a yield of 536.9 mg / L ( Figure 6 ).

[0156] Based on the engineered strain MY76, the supply of precursor acetyl-CoA, cofactor balance, and ATP supply in peroxisomes were enhanced, and peroxisome biogenesis and functional transport were regulated. First, using the PC111 strain as a template, the upstream and downstream homology arms of the PEX11 gene were amplified from the genome (the upstream 750bp of the CDS region of the PEX11 gene was the upstream homology arm, and the downstream 7500bp was the downstream homology arm). Subsequently, a donor DNA fragment (PEX11UP-PEX11DN) was constructed using fusion PCR. Then, a gRNA targeting the PEX11 gene was constructed (plasmid backbone primers were amplified, the gRNA sequence is underlined, gF: GTTGTCACTTCAG ACAAGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGgR: TCCTTGTCTGAAGTGACAAC GACGAGCTTACTCGTTTCGTCC); overexpression of the NADH-dependent HMGR gene at the PNSIII-11 site of the host strain (the nucleotide sequence of the NADH-dependent HMGR gene capable of targeting peroxisomes is shown in SEQ ID NO: 10) (donor DNA is PNSIII-11UP-P GCW14 -HMGR-T DAS1 -PNS111-11DN); overexpression of ANT1 and POT1 genes at the PNSIII-12 locus (donor DNA is PNSIII-12UP-T DAS2 -ANT1-PG CW14 -P TEF1 -POT1-T GAP -PNSIII-12DN); overexpression of PEX10 gene at PNSI-12 locus (donor DNA is PNSI-12UP-P TEF1 -PEX10-T GAP -PNS1-12DN); overexpression of PEX5 gene at PNSI-6 locus (donor DNA is PNSI-6UP-P PGI1 -PEX5-T FBP1 -PNS1-6DN), the specific steps of related gene expression cassette construction and genome integration are the same as above. Strengthening the MVA pathway, weakening the competitive pathway, and enhancing the supply of substrate acetyl-CoA and reducing power NADPH, regulating metabolic regulatory factors, and constructing and optimizing the sclareol synthesis pathway in the peroxisomes of the engineered strain MY83, the yield reached 631.6 mg / L ( Figure 6 ).

[0157] Table 10 Amplification primers involved in the construction of donor DNA in the examples of this application

[0158]

[0159]

[0160] Example 4 Batch fed-batch fermentation of engineered strains

[0161] In order to test the high-density fermentation ability of the engineered strain, a shake flask batch feeding experiment was carried out to back-fill the selection marker HIS4 gene in MY83; the Pichia pastoris genome was used as a template to amplify the HIS4 gene expression cassette (the gene and 1000bp upstream and downstream were the upstream and downstream homology arms), which was transformed into Pichia pastoris by electroporation, spread onto SD screening plates and cultured at 30°C for 3-4 days. After verification, the transformants were preserved for future use and named engineered strain MY83H.

[0162] The engineered strain MY83H was fermented under 250 mL shake flask feeding conditions for 10 days, and the maximum sclareol production reached 5.5 g / L. After 10 days of parallel bioreactor batch feeding, the maximum sclareol production reached 10.5 g / L ( Figure 8 ). For the culture medium formula, refer to Table 11.

[0163] Table 11. Composition of Delft medium used in the examples of this application

[0164]

[0165] specific:

[0166] After the genetic engineering modification is completed, the selection marker is no longer needed. In order to save fermentation costs and promote the normal growth of the strain, the selection marker gene HIS4 is complemented in situ, and HIS4 is restored in situ based on the MY83 strain. The commercial Pichia pastoris expression vector pPIC9K genome is used as a template (the plasmid was donated by Professor Zhao Zongbao of Dalian University of Technology). The HIS4 gene expression cassette (the gene and its upstream and downstream 1000bp are homology arms; the amplification primers are HIS4-HRUP-F: GATGTCTGGAGTCAACGTAAGATATTTGACT, HIS4-HRDN-R: TAATTTGCTTTCAAATCATCGATTTCACGC) is transformed into Pichia pastoris by electroporation, spread on SD plates and cultured at 30°C for 3 to 4 days. After verification, the transformants are preserved for future use and named as the engineered bacteria MY83H.

[0167] (1) Shake flask fed-batch fermentation of engineered strains

[0168] The engineered strain MY83H was fermented in a shake flask fed-batch format using minimal MM medium, pH 5.6, 50 mL / 250 mL volume, and an initial inoculation OD of 600=0.2. 5×Delft (containing 12.5 g / L (NH4)2SO4, 72 g / L KH2PO4, 2.5 g / L MgSO4·7H2O, and 500 g / L glucose) medium was used for feeding. 1 to 2 mL of 5×Delft medium was added when glucose was almost consumed, and the pH was adjusted to 5 to 6 with 7 M potassium hydroxide every 24 hours. Fermentation was carried out at 30°C and 220 rpm for 9 to 11 days, and the maximum sclareol yield was 5.5 g / L ( Figure 7 ).

[0169] (2) Parallel bioreactor batch fermentation of engineered strains

[0170] The batch fermentation used a 1 L DasGip parallel bioreactor system with a volume of 0.4 L. The batch fermentation used a basic component medium (Delft-D with glucose added at a concentration of 20 g / L) with a volume of 0.4 L and an inoculation OD of 600 =0.4, pH is 5.6. The feed medium is 5xD medium (glucose concentration added to Delft-D is 500g / L). The feeding method is exponential feeding, μ=0.05. When glucose is consumed in batch fed-batch fermentation, exponential feeding begins. During the fermentation process, there is a phenomenon that sclareol particles and bacteria adhere to the wall of the fermentation tank, electrodes, etc. The final sclareol production needs to be quantified by suspending all the adhered particles in the fermentation liquid. Figure 8 As shown, the highest yield of the engineered strain MY83H was 10.5 g / L ( Figure 8 ).

[0171] The above descriptions are merely a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application discloses the preferred embodiments as above, they are not intended to limit the present application. Any technical personnel familiar with the present profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

[0172] Sequence Listing

[0173] SEQ ID NO: 1

[0174]

[0175] SEQ ID NO:2

[0176]

[0177] SEQ ID NO:3

[0178] Atgttatctactggtttgtctttgtctcctgttcattctaatgaaggtaaagatttgcaaagagttgatactgatcatattttttttgaaaagctgttttggaagctccatatgattatattgcttctatgccatctaaaggtgttagagatcaatttattgatgctttgaatgattggttgagagttcctgatgttaaagttggtaaaattaaagatgctgttagagttttgcataattct tctttgttgttagatgattttcaagataattctccattgagaagaggtaaaccatctactcataatatttttggttctgctcaaactgttaatactgctacttattctattattaaagctattggtcaaattatggaattttctgctggtgaatctgttcaagaagttatgaattctattatgattttgtttcaaggtcaagctatggacttattttggacttataatggtcacgttccatca gaagaggagtattatagaatgattgatcaaaaaactggtcaattgttttctattgctacatctttgttattgaatgctgctgataatgaaattccaagaactaaaattcaatcttgtttgcatagattgacaagattgttgggtagatgttttcaaattagggatgactaccaaaatttggtttctgctgactatactaaacaaaaaggtttttgtgaagatttggatgaaggtaaatggtct ttggctttgattcatatgattcataaacaaagatctcatatggctttgttgaatgttttgtcaactggtagaaaacatggtggtatgactttggaacaaaagcagtttgttttagatattatcgaagaggaaaaatctttggattatactagatctgttatgatggatttgcatgttcaattgagagctgaaattggtagaattgaaattttgttggattctccaaatcctgctatgagataa

[0179] SEQ ID NO:4

[0180] ggtggaggttct

[0181] SEQ ID NO:5

[0182] caaagcaaacaatcaaccctatatacaacaactccatctcatcaaatagcatctctaaacccaaacctaccattgttgtctcctcctcatacatcttcacatcccaaactggaagagccagccatcaataagaacactactatcacagttttacaatgcatagtcgatgctactgatactctagtatccacttactgtgcacactctccagtcaaagagtttcaaaagatggcccagatgcaattggtgtcattgaaatccagacaatttagtgcacactctccattctctttaacaggacaagaagaagacatattctccgaagacacctactgggagtctggagacgagtcattcgattctatttttgaacctcccaccatgaaattcaagaaccattcactcagctctgtgagctcatcacccacagaacaccattcaccaacaatttcgattacaaagccttggatatcacaatctcctcgcaagagccctaccttatcacaagtagcttctcgttaccgcaaggtttcataa

[0183] SEQ ID NO:6

[0184]

[0185] SEQ ID NO:7

[0186]

[0187] SEQ ID NO:8

[0188]

[0189] SEQ ID NO:9

[0190]

[0191] SEQ ID NO:10

[0192]

Claims

1. A method for constructing a Pichia pastoris engineered strain with high sclareol production, characterized in that: Step 1: constructing a biosynthetic pathway for sclareol in the host strain and optimizing the intracellular mevalonate metabolic pathway and the central metabolic pathway, thereby obtaining an engineered bacterial strain A; The host strain is Pichia pastoris PC111, and its genotype is Mut+, his4-, AOX1, AOX2, HIS4::PGAP-PpRAD52-TAOX1, PNSI-2::PGAP-hCas9-TDAS; The biosynthesis pathway of sclareol is constructed by connecting the amino terminus of the sclareol synthase gene SsTPS and the carboxyl terminus of the lysinedioyl pyrophosphate synthase gene SsLPPS in the host strain using the flexible linker peptide GGGGS to obtain the fusion gene SsTPS-SsLPPS; and integrating the fusion gene into the PNSII-5 site of the host strain via the promoter. The nucleotide sequence of the fusion gene SsTPS-SsLPPS is shown in SEQ ID NO: 1; The optimization of the intracellular mevalonate metabolic pathway and the central metabolic pathway includes: 1) DNA fragment T GAP -SsTPS~SsLPPS-P GCW14 -P TEF1 -tHMG1-T DAS1 integrated into the PNSII-1 site of the host strain; the nucleotide sequence of the tHMG1 gene is shown in SEQ ID NO: 2; 2) DNA fragment P TEF1 -ERG20 F98C -T DAS2 Integrate into the PNSII-7 site of the host strain; the ERG20 F98C The phenylalanine at position 98 of the endogenous ERG20 gene is replaced with cysteine. The NCBI accession number of the ERG20 gene is 8197764; 3) DNA fragment P TEF1 -PaGGPPS~BTS1-T ADH2 integrated into the PNSII-4 site of the host strain; the PaGGPPS-BTS1 fusion expression construct is constructed by connecting the carboxyl terminus of the PaGGPPS gene and the amino terminus of the BTS1 gene using a flexible connecting peptide GGGGS; the nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO: 3, the nucleotide sequence of the flexible connecting peptide GGGGS is shown in SEQ ID NO: 4, and the NCBI accession number of the BTS1 gene is 8199751; 4) DNA fragment P HXT1 -ERG10~ERG13-T AOX1 Integrate into the PNSII-6 site of the host strain; the ERG10-ERG13 fusion expression construction method is to connect the amino terminus of the ERG13 gene and the carboxyl terminus of the ERG10 gene with a flexible connecting peptide GGGGS, the NCBI entry number of the ERG13 gene is 8198573, and the NCBI entry number of the ERG10 gene is 8197878; 5) DNA fragment T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T ERG8 Integrated into the PNSII-8 site of the host strain, the NCBI entry number of the ERG12 gene is 8197654, and the NCBI entry number of the ERG8 gene is 8198218; 6) DNA fragment P MSR1c3 -ERG19-T ERG19 Integrated into the PNSII-9 site of the host strain, the NCBI entry number of the ERG19 gene is 8196843; 7) DNA fragment T GAP -SsTPS~SsLPPS-P GCW14 -P TEF1 -tHMG1-T DAS1 integrated into the PNSI-14 site of the host strain; 8) Adding a protein degradation tag to the carboxyl terminus of the ERG9 gene in the host strain, wherein the degradation tag is the endogenous cell cycle regulator CLN2 of Pichia pastoris PEST , the CLN2 PEST The nucleotide sequence of the gene is shown in SEQ ID NO:

5. The NCBI accession number of the ERG9 gene is 8200142; 9) DNA fragment P GCW14 -SsTPS~SsLPPS-T GAP Integration into the PNSIV-5 site of the host strain, and / or DNA fragment P GCW14 -SsTPS~SsLPPS-T FBP1 integrated into the PNSIV-9 locus of the host strain; 10) DNA fragment T FDH1 -PK-P HTX1 -PTA-T FBP1 Integration into the PNSIII-5 site of the host strain; 11) DNA fragment P GAP -IDP2-T DAS2 Integration into the PNSI-4 site of the host strain; 12) DNA fragment P TEF1 -ZWF1-T AOX1 -T PMP20 -GND1-P PGI1 Integration into the PNSIV-8 locus of the host strain; 13) DNA fragment P TEF1 -FBP1-T FBP1 integrated into the PNSI-13 site of the host strain; The nucleotide sequence of the PK gene is shown in SEQ ID NO: 6; The nucleotide sequence of the PTA gene is shown in SEQ ID NO: 7; The nucleotide sequence of the IDP2 gene is shown in SEQ ID NO: 9; The NCBI accession number of the ZWF1 gene is 8198996; The NCBI accession number of the GND1 gene is 8200105; The NCBI accession number of the FBP1 gene is 8199670; Step 2: regulating potential metabolic regulatory factors related to sclareol synthesis in the engineered bacterial strain A, i.e., obtaining an engineered bacterial strain B; the regulation method is any one of the following: 1) knocking out the DOS2 gene, 2) knocking out the VBA5 gene, 3) knocking out the PRB1 gene, 4) knocking out the PDR15 gene, 5) knocking out the PGM1 gene, 6) knocking out the KEX1 gene, 7) knocking out the YPK9 gene, 8) knocking out the LAM5 gene, 9) knocking out the YNL096C gene, 10) overexpressing the ECM33 gene, 11) weakening the YNL096C gene, 12) knocking out the VBA5 gene, overexpressing the ECM33 gene, and weakening the YNL096C gene; The NCBI accession number of the ECM33 gene is 8198725; The weakened YNL096C gene integrates and expresses the cell cycle regulatory factor CLN2 at the carboxyl end of the YNL096C gene PEST ; The overexpression of ECM33 gene is to GCW14 -ECM33-T FBP1 Integration into the PNSI-1 site of the host strain; Step 3: targeting the sclareol synthesis pathway and the mevalonate pathway in the peroxisome in the engineered bacterial strain B for compartmentalization and optimization, thereby obtaining an engineered bacterial strain C; The method for targeting compartmentalization in peroxisomes comprises: 1) DNA fragment P GCW14 -SsTPS~SsLPPS-T FBP1 Integration into the PNSIII-8 site of the host strain; 2) DNA fragment P TEF1 -PaGGPPS~BTS1-T ADH2 Integration into the PNSIII-5 site of the host strain; 3) DNA fragment P TEF1 -ERG20 F98C -T DAS2 -T DAS1 -tHMG1-P TEF1 Integration into the PNSIII-4 site of the host strain; 4) DNA fragment T TAL2 -ERG19-P HTX1 -ERG10~ERG13-T AOX1 Integration into the PNSIII-6 site of the host strain; 5) DNA fragment T GAP -ERG12-P TEF1 -P PGI1 -ERG8-T DAS1 Integration into the PNSIII-7 site of the host strain; 6) DNA fragment P ADH2 -IDI1-T FBP1 Integration into the PNSIII-10 site of the host strain; The optimization method includes: 1) Knockout of the peroxisome proliferator-activated protein kinase (PEX11) gene, 2) DNA fragment P GCW14 -HMGR-T DAS1 Integration into the PNSIII-11 site of the host strain; 3) DNA fragment T DAS2 -ANT1-P GCW14 -P TEF1 -POT1-T GAP Integration into the PNSIII-12 site of the host strain; 4) DNA fragment P TEF1 -PEX10-T GAP integrated into the PNSI-12 site of the host strain; 5) DNA fragment P PGI1 -PEX5-T FBP1 integrated into the PNSI-6 site of the host strain; The nucleotide sequence of the HMGR gene is shown in SEQ ID NO: 10; the NCBI accession number of the IDI1 gene is 8197017, the NCBI accession number of the PEX11 gene is 8198426, the NCBI accession number of the POT1 gene is 8198672, the NCBI accession number of the PEX10 gene is AOA66248.1, the NCBI accession number of the ANT1 gene is 8200788, and the NCBI accession number of the PEX5 gene is 8198761; The peroxisome targeting method is achieved by utilizing the peroxisome signal peptide SKL at the carboxyl end of the target gene.

2. The method for constructing a Pichia pastoris engineered strain capable of producing high sclareol yield according to claim 1, wherein: The construction method further comprises complementing the HIS4 gene.

3. A Pichia pastoris engineered strain with high sclareol production, characterized in that: The Pichia pastoris engineered strain with high sclareol production is obtained by constructing the strain according to claim 1.

4. Use of the Pichia pastoris engineered strain capable of producing high sclareol yield according to claim 3 in large-scale cell culture for the synthesis of the diterpenoid compound sclareol.

Images