SERS probe as well as preparation method and application thereof
By developing SERS probes and combining PCR amplification methods, the problem of the detection and analysis process of pathogenic bacteria in food in the prior art is laborious, time-consuming and susceptible to contamination, and the rapid, strong specificity, high sensitivity and high accuracy of pathogenic bacteria in food is achieved.
Patent Information
- Application Number
- CN202411725133.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-28
- Publication Date
- 2025-03-04
AI Technical Summary
The prior art has problems such as laborious, time-consuming and susceptible to contamination in the analysis process when detecting pathogenic bacteria in foods. In particular, the polymerase chain reaction (PCR) method has shortcomings in the gel electrophoresis steps and results interpretation.
A SERS probe was developed to prepare an Au/Ag FL SERS probe by mixing hydroxylamine, sodium hydroxide, silver nitrate, tetrachloroauric acid and trisodium citrate, and combined with PCR amplification method to achieve rapid detection of pathogenic bacteria in food.
This method achieves rapid, strong specificity, high sensitivity and high accuracy of pathogenic bacteria in food, avoiding sample contamination and time-consuming analysis process.
Smart Images
Figure CN119549731A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of bacteria detection, and in particular relates to a SERS probe and a preparation method and application thereof. Background Art
[0002] Foodborne diseases caused by contamination with pathogenic bacteria (such as Salmonella, Escherichia coli, Staphylococcus aureus and Vibrio parahaemolyticus) are the main risk factors for food safety problems and are causing increasing public health and safety issues. Low infectious doses of such bacteria in food and water can cause many serious and even fatal diseases. Therefore, the detection of pathogenic bacteria is of great significance.
[0003] Currently, the detection methods for pathogenic bacteria and their metabolites include traditional microbiological detection methods, molecular biological detection methods, immunological detection methods, and biosensor detection methods. Among them, polymerase chain reaction (PCR) is considered to be one of the most accurate and sensitive molecular diagnostic methods. However, PCR usually involves gel electrophoresis steps or requires target-specific fluorescent probes to interpret the results, making the analysis process laborious and time-consuming, and the samples are easily contaminated.
[0004] Therefore, the development of more efficient sensing methods for pathogens and their metabolites has received increasing attention. Summary of the invention
[0005] The present invention has developed a SERS probe, based on which pathogenic bacteria in food can be rapidly detected in combination with a PCR amplification method, with high specificity, sensitivity and accuracy.
[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:
[0007] The present invention provides a method for preparing a SERS probe, comprising: mixing hydroxylamine, sodium hydroxide, silver nitrate, tetrachloroauric acid and trisodium citrate to react and obtain a SERS probe Au / Ag FL.
[0008] Preferably, the preparation method satisfies one or more of the following conditions: (a) tetrachloroauric acid is chloroauric acid trihydrate; (b) the mass ratio of hydroxylamine, sodium hydroxide and silver nitrate is: (5-7): (4-6): (38-42); (c) the mass ratio of silver nitrate to tetrachloroauric acid is: 1: (0.001-0.003); (d) the mass fraction of trisodium citrate is 0.5%-1.5%.
[0009] Preferably, the reaction in the above preparation method satisfies one or more of the following conditions: (i) the reaction temperature is 95°C-100°C; (ii) the reaction time is 5min-10min.
[0010] Preferably, the reaction in the above preparation method is carried out in a liquid environment, and after the reaction, the excess reagent is removed by centrifugation to obtain the SERS probe, and the centrifugation condition is 5000rpm-8000rpm.
[0011] Preferably, the above preparation method further comprises: mixing the SERS probe Au / AgFL with KI to obtain the SERS probe Au / Ag FL@I - .
[0012] Another aspect of the present invention further provides a SERS probe, which is prepared by the preparation method of the present invention.
[0013] In another aspect, the present invention further provides a use of the SERS probe of the present invention in the preparation of a product for detecting foodborne pathogens.
[0014] In another aspect, the present invention provides a method for detecting foodborne pathogens, comprising: (1) mixing the probe of the present invention, a PCR amplification product of a specific gene of the foodborne pathogen, and a MgSO4 solution to obtain a mixed solution; (2) collecting a SERS signal of the mixed solution; and (3) qualitatively and / or quantitatively detecting the foodborne pathogens based on the SERS signal.
[0015] Preferably, the above-mentioned foodborne pathogens are one or more of Salmonella, Escherichia coli, Staphylococcus aureus and Vibrio parahaemolyticus.
[0016] More preferably, the foodborne pathogen is Staphylococcus aureus, and the primer pair for PCR amplification is TCTAGCAAGTCCCTTTTCCACT and CGCCTGTACAACCA TTTGGC.
[0017] The beneficial effects of the present invention include at least: the SERS detection method for foodborne pathogens based on the SERS probe provided by the present invention has excellent specificity, sensitivity and accuracy, can quickly realize rapid quantitative detection of pathogens in food, and has good practical prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Characterization diagram of the prepared Au / Ag FL; A is the TEM image of Au / Ag FL (the inset is the electron diffraction image); B is the EDS elemental image of Au / Ag FL; CD are the TEM images of Au / Ag FL and the corresponding HAADF-STEM images; EH are the EDS imaging images of Au / Ag FL;
[0019] Figure 2 Au / Ag FL@I -Characterization data; A is the TEM image of Au / Ag FL@I-; B is the TEM image of Au / Ag FL@I- with the addition of amplification products and Mg 2+ TEM images after addition of I-, Mg 2+ The UV-visible absorption spectrum after ;
[0020] Figure 3 Au / Ag FL@I - -Mg 2+ Results of the tests in sterile water and milk samples; the upper line refers to Au / Ag FL@I - -Mg 2+ Test results in sterile water, the lower line refers to Au / Ag FL@I - -Mg 2+ Test results in milk samples. DETAILED DESCRIPTION
[0021] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.
[0022] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.
[0023] The embodiment of the present invention provides a method for preparing a SERS probe, comprising: mixing hydroxylamine, sodium hydroxide (NaOH), silver nitrate (AgNO3), tetrachloroauric acid and trisodium citrate (Na3CIT), and reacting to obtain a SERS probe Au / Ag FL.
[0024] It should be noted that it should be understood that the reaction in the present invention generally needs to be carried out in a solution environment (generally an aqueous solution environment), that is, the above-mentioned hydroxylamine, sodium hydroxide (NaOH), silver nitrate (AgNO3), tetrachloroauric acid and trisodium citrate (Na3CIT) are generally in the form of a solution.
[0025] In some specific examples, the above preparation method satisfies one or more of the following conditions:
[0026] (a) tetrachloroauric acid is chloroauric acid trihydrate; specifically, the tetrachloroauric acid in the present invention may refer to different hydrates or tetrachloroauric acid, preferably chloroauric acid trihydrate;
[0027] (b) the mass ratio of hydroxylamine, sodium hydroxide and silver nitrate is: (5-7): (4-6): (38-42), such as 6:5:40, 5:5:39, 7:4:40 or 6:4:42;
[0028] (c) mass ratio of silver nitrate to tetrachloroauric acid: 1:(0.001-0.003), such as 1:0.002, 1:0.0015 or 0.0025;
[0029] (d) the mass fraction of trisodium citrate is 0.5%-1.5%; specifically, as mentioned above, during the reaction, trisodium citrate is in the form of a solution (aqueous solution), and its mass fraction can be 0.5%-1.5%, such as 0.7%, 1% or 1.3%.
[0030] In some specific examples, the reaction in the above preparation method satisfies one or more of the following conditions:
[0031] (i) The reaction temperature is 95°C-100°C; for example, 97°C, 98°C or 99°C;
[0032] (ii) The reaction time is 5 min to 10 min, such as 6 min, 7 min or 8 min.
[0033] In some specific examples, the reaction in the above preparation method is carried out in a liquid environment, and after the reaction, the excess reagent is removed by centrifugation to obtain a SERS probe, and the centrifugation condition is 5000rpm-8000rpm, such as 6000rpm, 6500rpm or 7000rpm.
[0034] In some specific examples, the preparation method further includes: mixing the SERS probe Au / AgFL with KI to obtain the SERS probe Au / AgFL@I - .
[0035] It should be noted that the present invention further modifies the Au / Ag FL surface with iodide to remove the original citrate on the surface and reduce background interference, and further introduces MgSO4 into the system to neutralize the surface charge. 2+ It plays a dual role; one is that it can serve as a bridge between the amplified product to be tested and the SERS substrate, allowing the amplified DNA product to be adsorbed on the FL@I through electrostatic adsorption. -The second one can act as an aggregation agent to induce Au / Ag FL@I - Particle aggregation can generate more "hot spots" and lock the DNA molecules within the "hot spots", ultimately achieving the purpose of enhancing the SERS signal of the amplified DNA product.
[0036] In some specific examples, the mass ratio of Au / Ag FL and KI is (1-5):(1-4), such as 2:3, 4:3 or 3:2.
[0037] The embodiment of the present invention further provides a SERS probe, which is prepared by the preparation method of the present invention.
[0038] The embodiment of the present invention also provides an application of the SERS probe of the present invention in preparing a product for detecting foodborne pathogens.
[0039] It should be noted that products for detecting foodborne pathogens can be detection reagents or detection kits, and can be selected according to specific needs.
[0040] The embodiment of the present invention also provides a method for detecting foodborne pathogens, which comprises: (1) mixing the probe of the present invention, the PCR amplification product of the specific gene of the foodborne pathogen and the MgSO4 solution to obtain a mixed solution; (2) collecting the SERS signal of the mixed solution; (3) qualitatively and / or quantitatively detecting the foodborne pathogens according to the SERS signal.
[0041] It should be noted that in the present invention, genes of pathogenic bacteria in food are extracted, specific genes are amplified by PCR technology, and finally the amplification products are detected by SERS detection method based on nanogap effect, thereby achieving specific and highly sensitive detection of foodborne pathogens.
[0042] In some specific examples, the foodborne pathogens are one or more of Salmonella, Escherichia coli, Staphylococcus aureus and Vibrio parahaemolyticus.
[0043] In some specific examples, the foodborne pathogen is Staphylococcus aureus, and the primer pair for PCR amplification is TCTAGCAAGTCCCTTTTCCACT and CGCCTGTACAACCATTTGGC.
[0044] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.
[0045] 1. Preparation of SERS probe
[0046] Example 1 Preparation of SERS probe Au / Ag FL
[0047] Hydroxylamine aqueous solution (1 mL, 0.06 M) and NaOH aqueous solution (1 mL, 0.05 M) were mixed for 5 minutes under vigorous stirring, and then AgNO3 solution (18 mL, 0.4 M) was added to the above reaction mixture under dark conditions and stirred for another 5 minutes, and then heated at 100°C for 5 minutes; then HAuCl4·3H2O aqueous solution (10 mL, 0.8 mM) and Na3CIT aqueous solution (200 μL, 1%, w / v) were added; then the mixed solution was centrifuged at 6000 rpm for 20 minutes twice to remove excess reagents and redispersed in 5 mL of deionized water to obtain the SERS probe Au / Ag FL.
[0048] The SERS probe Au / Ag FL was tested by TEM and EDS respectively. The results are as follows Figure 1 As shown; the results show that Figure 1 Figure A shows that the average diameter of Au / Ag FL is less than 100nm, with a core and many small branches. The inset in A is the selected area electron diffraction (SAED) result, which proves that Au / Ag FL has a polycrystalline structure. Figure B is the EDS element analysis of Au / Ag FL, and Figure CH are related EDS mapping diagrams, confirming that Au / Ag FL is composed of gold and silver elements.
[0049] Example 2 SERS probe Au / Ag FL@I - preparation
[0050] The SERS probe Au / Ag FL prepared in Example 1 (25 mL, 2 mM) was mixed with a KI aqueous solution (5 mL, 10 mM) at room temperature (25°C) for 20 min to ensure that KI was completely modified on the surface of Au / Ag FL; then the mixture was dispersed in 5 mL of deionized water by centrifugation (6500 rpm, 5 min) to obtain the SERS probe Au / Ag FL@I - .
[0051] The SERS probe Au / Ag FL@I - TEM and UV-visible absorption tests were performed respectively, and the results are as follows Figure 2 As shown; the results show that Figure 2 A shows that when Au / Ag FL is combined with I - After that, the dispersion is still good. B shows that when the amplified product and Mg 2+ After being added, Au / Ag FL@I - Aggregation occurs between them, which also proves that FL@I - Mg 2+The analyte can be captured under synergistic effect; in addition, C shows that the UV-visible absorption spectrum also shows that Au / Ag FL binds to I - Mg 2+ Then some changes occurred.
[0052] Example 3 Construction of pathogen detection method
[0053] (1) PCR amplification of pathogen-specific genes
[0054] The reaction mixture for PCR amplification of the Staphylococcus aureus-specific gene nuc target chain (nucT) included 5 μL 10× PCR Buffer, 1.5 μL forward primer (TCTAGCAAGTCCCTTTTCCACT) (0.3 μM) and 1.5 μL reverse primer (CGCCTGTACAACCA TTTGGC) (0.3 μM), 5 μL dNTPs (2 mM), 3 μL MgSO4 (25 mM), 1 μL KOD-Plus-Neo (1 U / μL), 2 μL gDNA and 31 μL ddH2O. The amplification reaction was carried out in a T100TM thermal cycler (Bio-Rad, USA); the specific PCR amplification procedure was as follows: first, pre-denaturation at 94°C for 2 minutes, followed by denaturation at 98°C for 10 seconds, annealing at 55°C for 30 seconds, and extension at 68°C for 20 seconds. This process was cycled 30 times, and finally, extension was performed at 68°C for another 7 minutes. The obtained amplification product was stored at 4°C; the obtained amplification product was mixed with 10×gelred and 6×loading buffer and analyzed by agarose gel electrophoresis, and the agarose gel electrophoresis results were photographed using a Tanon5200 image analysis system; in addition, the amplified product was purified using a PCR product purification kit (AxyPrep PCR cleaning kit) to obtain the Staphylococcus aureus-specific gene nuc amplification product.
[0055] Escherichia coli ( 12435TM), Salmonella ( 14028TM) and Bacillus subtilis (BNCC251376) were amplified using the above amplification method to obtain Escherichia coli-specific gene amplification products, Salmonella-specific gene amplification products and Bacillus subtilis-specific gene amplification products.
[0056] (2) Construction of pathogen detection method
[0057] First, 20 μL of the SERS probe Au / Ag FL@I- prepared in Example 2 was mixed with 20 μL of the PCR amplified product DNA of Staphylococcus aureus nuc T, and then 15 μL of MgSO4 solution (0.01 M) was added and mixed evenly, which acts as an aggregation agent to promote the aggregation of Au / AgFL@I- (see Figure 2 ); at this time, the color of the colloid will change from gray-blue to gray-chocolate brown, and finally 3 μL of sample is taken for SERS test.
[0058] (3) Establishment of spectral prediction model
[0059] Referring to the literature "Self-Cleaning-Mediated SERS Chip Coupled Chemometric Algorithms for Detection and Photocatalytic Degradation of Pesticides in Food", the collected SERS spectral data were divided into a calibration set (Xcal) and a prediction set (Xtest) in a ratio of 3:2 using MATLAB software, and the concentration value corresponding to each spectral data was also divided into a calibration set (Ycal) and a prediction set (Ytest) in a ratio of 3:2. The spectral prediction model was established using three single variable screening algorithms, namely, variable combination cluster analysis partial least squares algorithm (VCPA-PLS), random frog leaping partial least squares algorithm (RF-PLS) and bootstrap flexible shrinkage variable selection partial least squares algorithm (BOSS-PLS).
[0060] Example 4 Detection of pathogenic bacteria in milk
[0061] (1) Milk samples purchased from supermarkets were filtered through sterile membranes to remove contaminating bacteria. Then, different concentrations (10 cfu / mL to 10 6 cfu / mL) target Staphylococcus aureus, and then concentrate the target bacteria by centrifugation (12000rpm, 3min), and extract its gDNA for PCR amplification to obtain the target gene fragment;
[0062] (2) The target gene fragment was subjected to SERS detection using the pathogen detection method constructed in Example 3, and 20 samples were taken at each concentration, for a total of 120 samples;
[0063] (3) According to the above-mentioned spectral prediction model (BOSS-PLS model), data analysis was performed. The BOSS-PLS model showed better prediction performance than other models. The results of BOSS-PLS were Rc (training set model correlation coefficient) = 0.9915, RMSECV (root mean square error of cross validation) = 0.224, Rp (prediction set correlation coefficient) = 0.967, RMSEP (prediction set root mean square error) = 0.437, as shown in Table 1 below (the results show that it can still be detected at a concentration of 10 cfu / mL).
[0064] Table 1 Statistics of detection results of four algorithm models
[0065]
[0066] Figure 3 The SERS spectra of the nuc T amplification products of Staphylococcus aureus in sterile water and milk samples were compared, and slight shifts and changes in intensity of some spectral bands were observed, indicating that the sample matrix has an impact on the detection effect. Therefore, in order to improve the accuracy of the predictive quantitative model, the present invention directly builds a model for the SERS data of the nuc T amplification products of Staphylococcus aureus in the milk sample matrix.
[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.
Claims
1. A method for preparing a SERS probe, characterized in that: include: Hydroxylamine, sodium hydroxide, silver nitrate, tetrachloroauric acid and trisodium citrate were mixed and reacted to obtain the SERS probe Au / Ag FL.
2. The preparation method according to claim 1, characterized in that: The preparation method meets one or more of the following conditions: (a) tetrachloroauric acid is chloroauric acid trihydrate; (b) the mass ratio of hydroxylamine, sodium hydroxide and silver nitrate is: (5-7): (4-6): (38-42); (c) mass ratio of silver nitrate to tetrachloroauric acid: 1:(0.001-0.003); (d) The mass fraction of trisodium citrate is 0.5%-1.5%.
3. The preparation method according to claim 1 or 2, characterized in that: The reaction satisfies one or more of the following conditions: (i) the reaction temperature is 95°C-100°C; (ii) The reaction time is 5 min to 10 min.
4. The preparation method according to claim 1 or 2, characterized in that: The reaction is carried out in a liquid environment. After the reaction, the excess reagents are removed by centrifugation to obtain the SERS probe. The centrifugation condition is 5000rpm-8000rpm.
5. The preparation method according to claim 1 or 2, characterized in that: Also includes: The SERS probe Au / AgFL was mixed with KI to obtain the SERS probe Au / AgFL@I. - .
6. A SERS probe, characterized in that: The compound is prepared by the preparation method according to any one of claims 1 to 6.
7. Use of the SERS probe according to claim 6 in preparing a product for detecting foodborne pathogens.
8. A method for detecting foodborne pathogens, characterized in that: include: (1) mixing the probe according to claim 6, the PCR amplification product of the specific gene of the foodborne pathogen and the MgSO4 solution to obtain a mixed solution; (2) collecting the SERS signal of the mixed solution; (3) qualitatively and / or quantitatively detecting the foodborne pathogen according to the SERS signal.
9. The method according to claim 8, characterized in that Foodborne pathogens are one or more of Salmonella, Escherichia coli, Staphylococcus aureus and Vibrio parahaemolyticus.
10. The method according to claim 9, characterized in that The foodborne pathogen was Staphylococcus aureus, and the primer pair for PCR amplification was TCTAGCAAGTCCCTTTTCCACT and CGCCTGTACAACCA TTTGGC.