Beauveria bassiana Bbzy2407 strain and application thereof

Abstract

The invention discloses a Beauveria bassiana Bbzy2407 strain and application thereof, the strain is Beauveria bassiana, and the strain is classified and named as Beauveria bassiana; the strain is preserved in China General Microbiological Culture Collection Center (CGMCC), and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the preservation date is December 02, 2024; the preservation number is CGMCC (China General Microbiological Culture Collection Center) The beauveria bassiana Bbzy2407 provided by the invention is a biocontrol fungus capable of being used for preventing and controlling major pest Holotrichia crassipes larvae of agriculture and forestry plants, has the characteristics of strong pathogenicity to the Holotrichia crassipes larvae, safety to the environment and difficulty in causing drug resistance of pests, and can be used for biologically preventing and controlling the Holotrichia crassipes larvae.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Beauveria bassiana Bbzy2407 strain and application thereof. Background Art

[0002] Holotrichia crassa Holotrichia scrobiculata Brenske belongs to the family of Phyllotreta in the order Coleoptera. It is an important pest in agricultural and forestry production. The life cycle of the thick narrow-ribbed gill beetle is an insect stage with wings, can mate and reproduce, and can fly, while its larvae live in the soil for a long time and cannot fly freely. Its adults feed on crops and plant leaves, and its larvae feed on the underground roots of agricultural and forestry plants, causing the plant roots to wilt due to the inability to absorb water and nutrients from the soil, and eventually causing the whole plant to dry up and die. The larvae of the thick narrow-ribbed gill beetle live in the underground soil for a long time, and their occurrence and harm are relatively hidden. When controlling them, it is necessary to apply pesticides underground to achieve the control effect; at the same time, the pesticides that have a control effect on adults may not be effective on larvae, and the pesticides that have a control effect on larvae may not be effective on adults. Therefore, the harm of the larvae of the thick narrow-ribbed gill beetle to crops and plants is far greater than that of the adults, and the pesticides used to control adults are not suitable for controlling their larvae. In recent years, the occurrence of the scarab beetle in blueberry gardens in Yunnan and Guizhou provinces has become an important factor affecting the development of the blueberry industry. The total number of occurrences and damages have been increasing year by year. The prevention and control of the scarab beetle larvae is currently mostly based on the application of chemical pesticides. However, the disadvantages of chemical control, such as increased pest resistance, pesticide residues, and re-emergence of pests, have become increasingly prominent, and have attracted much attention at home and abroad and concerns about food safety.

[0003] Insect pathogenic fungi are a type of insect pathogenic microorganisms that can cause pests to become infected and die under natural conditions, and can spread naturally in pest populations and cause pest epidemics. They are an important source for the development of biological pest control products. Insect pathogenic fungi such as Beauveria bassiana are the earliest native insect disease control fungi discovered at home and abroad. At present, they have gradually become a type of biological control fungi with wide development and application, mature large-scale production technology and good ecological and environmental benefits in the world. They have good application value and development prospects. Therefore, studying the biological control fungi of the larvae of the thick-costed gill beetle provides a basis for the biological control of the larvae of the thick-costed gill beetle, and also provides a guarantee for reducing the drug resistance and environmental pollution caused by chemical control.

[0004] Beauveria bassiana Beauveria bassiana) belongs to the genus Beauveria in the family Cordyceps, order Nahypodium, order Ascomycota, phylum Ascomycota, subphylum Pezizomycotinae, and family Cordyceps. Beauveria bassiana is widely used in the prevention and control of pests in agricultural and forestry production of Lepidoptera, Coleoptera, and Homoptera at home and abroad because of its strong pathogenicity to pests, wide host range, low production cost, and no environmental pollution. However, Beauveria bassiana, which has strong infection and pathogenic effects on adult scarab beetles, has no infection and pathogenic effects on scarab beetle larvae. Therefore, Beauveria bassiana, which is used to control adult scarab beetles, cannot be simply and mechanically used to control scarab beetle larvae. Our team previously discovered Beauveria bassiana Bbzy230628, which can naturally infect adults of scarab beetles. The original host (first host) of the Bbzy230628 strain is the adult scarab beetle, not the larvae of scarab beetles. However, there are no reports of natural infection of the larvae of the scarab beetle, nor are there any original strains of Beauveria bassiana isolated from naturally infected scarab beetle larvae. In addition, since Beauveria bassiana has rich genetic diversity and certain host specificity, screening strains with high toxicity and high efficiency against the control target is the material guarantee for the development and production of biocontrol agents for scarab beetle larvae based on Beauveria bassiana. Summary of the invention

[0005] The purpose of the present invention is to provide a Beauveria bassiana Bbzy2407 strain and its application, aiming to overcome the problem that the existing Beauveria bassiana has not been found to be able to infect and kill Holothuria stenocostata under natural conditions. Holotrichia scrobiculata To eliminate the shortage of larvae, biotechnology is used to control armyworms and avoid or reduce the problem of pesticide resistance caused by the irrational use of chemical pesticides.

[0006] In order to solve the problems of the prior art, the present invention provides the following technical solution: a Beauveria bassiana Bbzy2407 strain of the present invention, the strain is classified and named Beauveria bassiana Beauveria bassiana ; Deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the address of the deposit unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; Deposit date: December 02, 2024; Deposit number: CGMCC No.41648.

[0007] Furthermore, the ITS gene sequence of the Beauveria bassiana Bbzy2407 strain is the nucleotide sequence shown in SEQ ID No.1.

[0008] Furthermore, the present invention provides a Beauveria bassiana Bbzy2407 bacterial agent prepared by the Beauveria bassiana Bbzy2407 strain.

[0009] Furthermore, the active ingredient of the bacterial agent is the conidia suspension of the Beauveria bassiana Bbzy2407 strain.

[0010] Furthermore, the present invention provides a method for preparing the bacterial agent, comprising the following steps: (1) Cultivate the Beauveria bassiana strain Bbzy2407 on SDAY medium; (2) Take conidia of Beauveria bassiana Bbzy2407 and place them in sterile water containing 0.05% Tween-80 to a concentration of 1.0×10 8 The Beauveria bassiana Bbzy2407 inoculum was prepared by preparing a spore suspension of Beauveria bassiana Bbzy2407 with a spore / mL.

[0011] Furthermore, the present invention provides an insecticide, which contains any one of the Beauveria bassiana Bbzy2407 agents.

[0012] Furthermore, the present invention provides the use of the Beauveria bassiana Bbzy2407 strain or any of the Beauveria bassiana Bbzy2407 bacterial agents, or the insecticide in preventing and controlling the larvae of Holothuria serrata.

[0013] Furthermore, the present invention provides the use of the Beauveria bassiana Bbzy2407 strain or any of the Beauveria bassiana Bbzy2407 bacterial agents in the preparation of a control agent for the larval stage of Holotrichia crassicola.

[0014] Furthermore, the present invention provides a method for controlling the rough-costed branch beetle in the larval stage, wherein any one of the Beauveria bassiana Bbzy2407 fungicide or the insecticide is applied in the rough-costed branch beetle larval stage.

[0015] Beneficial effect: The Beauveria bassiana Bbzy2407 provided by the present invention is a kind of insect that can be used to prevent and control the major crop pests such as the broad-ribbed beetle Holotrichia scrobiculata The biological control fungus for the larvae has the characteristics of strong pathogenicity to the larvae of the rough-ribbed gill beetle, being safe to the environment, and not easily causing pests to develop resistance. It can be used for biological control of the larvae of the rough-ribbed gill beetle.

[0016] Compared with the prior art, the present invention has the following advantages: (1) The present invention is the first strain isolated from the diseased larvae of Holothuria stenochloa, which is relatively simple to culture, has a relatively fast growth rate, and produces a large amount of spores.

[0017] (2) The Beauveria bassiana Bbzy2407 strain isolated from the diseased larvae of the scarab beetle in the present invention has a fast killing speed and strong killing ability to the scarab beetle larvae. When 1×10 8After inoculation at a concentration of 1×10 / mL, the larvae of the thick narrow-ribbed branch beetle began to die on the second day after inoculation. The cumulative mortality rates of the larvae of the thick narrow-ribbed branch beetle were 0%, 3.33%, 35.00%, 71.67%, 88.33%, 98.33%, 100% and 100% on the 1st, 3rd, 5th, 7th, 9th, 11th, 13th and 15th days, respectively. 8 LT of the third instar larvae of Holotrichia crassicola under the treatment of spores / mL 50 It is 5.75 days.

[0018] (3) The present invention is based on the discovery by the inventor in July 2024 that Beauveria bassiana was prevalent in the population of Scarabaeidae larvae during a survey in the ginkgo forest of Zhanyi County, Qujing City, Yunnan Province, causing a large number of Scarabaeidae larvae to be infected and die. Therefore, this strain is the first parasitic fungus on Scarabaeidae larvae found in China, which is highly prevalent and has great development and application prospects in the prevention and control of Scarabaeidae larvae. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The conidia and sporangiophore morphology of Beauveria bassiana Bbzy2407 of the present invention are shown in FIG.

[0020] Figure 2 This is a colony morphology diagram of Beauveria bassiana Bbzy2407 of the present invention.

[0021] Figure 3 The dorsal and ventral views of the larvae of the Holotrichia crassicerosa that were naturally infected and killed by the Beauveria bassiana Bbzy2407 of the present invention. Figure 3 A is a picture of the infected insect body of the larvae of the Beauveria bassiana Bbzy2407 of the present invention when the larvae are naturally infected and killed for 3 days, Figure 3 B is a picture of the infected insect body of the larvae of Holotrichia crassicerosa at 7 days after natural infection with Beauveria bassiana Bbzy2407 of the present invention. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Example 1

[0023] The present invention discloses a Beauveria bassiana Bbzy2407 strain, which is Beauveria bassiana and is classified as Beauveria bassiana. Beauveria bassiana; Deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; Deposit date: December 2, 2024; Deposit number: CGMCC No.41648. The viability of the biological material was tested by the depository on December 2, 2024, and the result was viable. Example 2

[0024] Isolation and identification of pathogens 1.1 Materials and methods 1.1.1 Materials On July 12, 2024, a dead beetle infected with a fungus was collected in Zhanyi County, Qujing City, Yunnan Province. Holotrichia scrobiculata )larva.

[0025] Sabouraud medium (SDAY): 1% peptone + 1% yeast powder + 4% glucose + 1.5-2% agar powder + 1000 ml water.

[0026] Aseptic operating conditions: All utensils and equipment were sterilized in a high-temperature sterilizer (121°C, 30 min), and inoculation and other operations were performed in an ultra-clean workbench.

[0027] Culture conditions: Culture in a constant temperature incubator at 25℃ light (12L:12D). After colonies are formed, transfer to the SDAY slant of the test tube, culture for 2-3 days, and store in a 4℃ refrigerator.

[0028] 1.1.2 Isolation and purification of pathogens Isolation: From the dead bodies of diseased larvae of Scarabaeidae ( Figure 3 ) to isolate pathogens. Bring the diseased larvae of the scarab beetle back to the laboratory, soak the diseased larvae in 70% alcohol for 20 seconds, then soak them in 0.1% mercuric chloride solution for 3 minutes (to be thoroughly disinfected), and finally rinse them three times with sterile water. Then use an inoculation needle to take the conidia or hyphae grown on the scarab beetle larvae, place them on SDAY medium, and culture them at 25°C. After a large amount of hyphae grows, single spores are isolated and cultured according to conventional methods to obtain a pure strain with strong spore-producing ability, Beauveria bassiana. Beauveria bassiana Bbzy2407 was transferred to SDAY slant and grown for 3-5 days. After growth, it was stored in a 4℃ refrigerator.

[0029] Rejuvenation: After the isolated strain is cultured on SDAY medium for 2-3 days, a large number of conidia are produced. Then the conidia are picked into sterile water containing 1% Tween-80 and stirred evenly with a glass rod to obtain an appropriate concentration (10 8Use a small sprayer to evenly spray the spore suspension of 100 spores / mL on the body surface of the larvae of the broad-ribbed gill beetle (the surface of the insect body is moist), and maintain a relative humidity of more than 80%. Collect the dead larvae of the broad-ribbed gill beetle and keep them moist. Then, use the above method to separate the dead larvae of the broad-ribbed gill beetle to obtain a strain with stronger pathogenicity.

[0030] Purification: Pick the conidia powder on the culture medium and inoculate it again on a new culture medium. After culturing for 2 to 3 generations, the strain is purified.

[0031] 1.1.3 Identification of pathogens Morphological identification: Identification is carried out based on the culture characteristics, hyphae and conidia morphology of the pathogen. Use a 40×10 optical microscope to examine the morphology of hyphae, conidia and conidiophores of the colony, take photos and record them, and classify and identify the strains based on their morphology.

[0032] Strain rDNA-ITS sequence analysis. The strain DNA was obtained using a fungal genomic DNA extraction kit (provided by Guangzhou Dingguo Biotechnology Co., Ltd.). The fungal universal primers ITS1 (5′-TCCGTAGGTCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) were used to amplify the strain rDNA-ITS sequence by PCR. The PCR reaction system was 50 μl: I-5TM 2× High-Fieldlity Master Mix 25 μL, DNA template 1 μL, upstream and downstream primers 2 μL each (10 μmol / L), ddH 2 O 20μL. Amplification program: 94℃ pre-denaturation 5min; 94℃ 30s, 56℃ 30s, 72℃ 90s, 35 cycles; 72℃ extension 10min. PCR products were detected by 1% agarose gel electrophoresis and sent to Guangzhou Ruijie Biotechnology Co., Ltd. for sequencing. The obtained DNA fragment sequence was compared in the NCBI database to determine the species relationship of the strain.

[0033] 1.2 Results 1.2.1 Morphological identification results A wild strain was isolated from the larvae of Holothuria bassiana naturally infected by entomogenous fungi, cultured on SDAY (Saborteau agar medium), and inoculated back into the larvae of armyworm to obtain a strain for rejuvenation. Single hyphae of the strain were separated to obtain a purified strain, namely Beauveria bassiana Bbzy2407.

[0034] like Figure 1 and Figure 2As shown in the figure, on SDAY medium, the front of the colony of Beauveria bassiana Bbzy2407 strain was milky white in the early growth stage, with a slightly convex center, and the color of the back of the colony changed from light to dark from the edge to the center, from yellowish brown to black brown at the center 1 / 2; the hyphae of the fungus were smooth, with septa, and the diameter of the hyphae was 2~3 μm; the conidiophores were upright and grape-like; the conidia were oval, with a smooth surface, one end was pointed, and the other end was blunt, with a size of 4.55 μm×2.10 μm.

[0035] 1.2.2 Molecular identification results The PCR amplification product fragment sequence of the Bbzy2407 strain rDNA-ITS sequence analysis was determined. The ITS gene sequence of the Beauveria bassiana Bbzy2407 strain was the nucleotide sequence shown in SEQ ID No. 1. The results are as follows: GATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTTCCGGTGCGAGCTGTATTACTACGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGGTGC TGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCA ATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTG AGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTTCACAGAAGGGTTAGGGGAGTTGAAAACTCGGTAATGATCCCTCCGCAGGTTCACCTA The sequence was submitted to the GenBank database for Blast comparison, and related sequences were selected to construct a phylogenetic tree using the Neighbor-joining method. The comparison results showed that strain Bbzy2407 was Beauveria bassiana.

[0036] Based on the infection symptoms in the field, the collection of diseased insects for indoor isolation and observation, and the infection symptoms of Beauveria bassiana in "Insect Mycology", the morphological characteristics of conidia and hyphae, and the results of rDNA-ITS sequence analysis, the strain was identified as Beauveria bassiana Beauveria bassiana, The gene was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number: CGMCC No.41648. Example 3

[0037] Biological characteristics of purified strain of Beauveria bassiana Bbzy2407 2.1 Materials and methods 2.1.1 Test strains A dish with vigorous and uniform growth after purification was selected as the test strain. The mycelium was inoculated on SDAY again and cultured in a constant temperature and light (12L:12D) incubator at 25℃.

[0038] 2.1.2 Determination of colony growth rate and spore production The inoculation was carried out by the bacterial cake method. A sterilized puncher was used to evenly punch holes from the dense conidia of the colony. The puncher should be burned with an alcohol lamp before each punch to prevent contamination. The culture blocks with conidia attached were inoculated on the SDAY medium with sterilized tweezers, ensuring that the side carrying hyphae and conidia was inoculated on different culture media facing down. The inoculated culture dishes were placed in a constant temperature incubator with alternating light and darkness for 12 h, a temperature of 25 ° C, and a relative humidity of 70%. During the culture period, the growth and spore production of the strain were observed regularly every day, and the spore production time, colony morphology, and colony size of the strain were recorded. Starting from the third day after observation, the horizontal and vertical diameters of the colony were measured with a vernier caliper every 3 days, and the measurement and recording were continued until the strain no longer produced spores. After the strain has finished spore production, a sterilized cork puncher was used to randomly punch holes on the colonies grown under different conditions to obtain 5 bacterial blocks, which were placed in a conical flask containing 10 ml of 0.05% Tween-80 sterile water. After sufficient shaking for a period of time, a spore suspension was obtained and placed on a hemocytometer. The spore morphology was observed and counted under a microscope, and the spore production per unit area of ​​each treatment group was calculated. Each treatment was repeated 3 times.

[0039] 2.2 Results From the perspective of colony growth, strain Bbzy2407 can grow on SDAY medium. The mycelium of the strain inoculated on SDAY medium grows rapidly. Starting from the 3rd day of culture, the colony grows faster. From the 3rd to the 6th day of culture, the average colony diameter grows at a rate of 2.69 mm / d; from the 6th to the 9th day of culture, the average colony diameter grows at a rate of 3.11 mm / d. On the 3rd, 6th, 9th, and 11th days of culture, the colony diameters were 13.43, 21.50, 30.84, and 37.12 mm, respectively; on the 15th day of culture, the colony diameter reached 45.22 mm. The results of colony diameter determination are shown in Table 1: Table 1 Colony diameter (cm)

[0040] In terms of spore production, the strain Bbzy2407 of Beauveria bassiana began to produce spores on the 5th day after being cultured on SDAY medium, and the spore production on the 5th day was 1.68×10 7 Spores / mm 2 With the increase of culture time, the spore production speed is fast and the spore production amount increases. On the 15th day of culture, the spore production amount is 6.18×10 8 Pieces / mm 2 Colonies. This shows that the strain has good biological characteristics and good growth. The results of spore production are shown in Table 2: Table 2 Spore production (spores / mm 2 Fungus

[0041] Example 3 Toxicity test of Beauveria bassiana Bbzy2407 against Holotrichia crassicola larvae in laboratory 3.1 Materials and methods 3.1.1 Insect sources for testing Larvae of Holotrichia stenoptera were raised in a light incubator at a temperature of (25±1)℃, humidity of (70±5)%, and a photoperiod of 12L﹕12D in our laboratory using ginkgo leaves. Healthy, uniform-sized third-instar larvae were obtained as test insects.

[0042] 3.1.2 Preparation of spore suspension Take the purified Beauveria bassiana Bbzy2407 with good growth, wash the conidia with sterile water, filter and prepare 10 8 spores / ml conidia suspension, take a drop of the filtrate with a sterile capillary pipette and place it on a hemocytometer, count the spores under a microscope and record the data, use sterile water containing 0.5% Tween 80 as a blank control for virulence determination.

[0043] 3.1.3 Impregnation method The third instar larvae of Holotrichia crassicola were treated by immersion method at a concentration of 1×10 8 The larvae were immersed in the bacterial suspension of 1000 g / mL for 10 seconds and then picked out. After the excess water of the insect body was dried with sterile filter paper, 0.05% Tween-80 sterile water was used as the control group. The treated larvae were placed in an artificial climate box with a temperature of (25±1)℃, a relative humidity of (80±5)%, and a photoperiod of L / / D=12 h / / 12 h. After inoculation, the larvae were observed regularly every day, and the number of dead insects was recorded. The dead insects were observed by single head moisturizing culture. When white hyphae or conidia grew on the surface of the dead insect body, it was determined that they were infected and killed by Beauveria bassiana. Each treatment was repeated 3 times with 20 heads. The number of deaths of the tested larvae of the rough narrow-ribbed gill beetle and the number of dead insects with white Beauveria bassiana spores on the surface of the insect body were recorded every day, and the average mortality rate and dead insect rate were calculated. The data were analyzed by linear regression statistics using DPS 14.0 software.

[0044] 3.2 Results The results of toxicity assay showed that the strain Bbzy2407 of Beauveria bassiana was 8 The spore concentration of Bbzy2407 was 1×10 / mL, which had a high pathogenicity to the larvae of the thick narrow-ribbed branch beetle, and the mortality rate increased with the increase of spore concentration and treatment days. 8 After inoculation at a concentration of 100 / mL, the larvae of the thick narrow-ribbed branch beetle began to die on the second day after inoculation. On the 1st, 3rd, 5th, 7th, 9th, 11th, 13th and 15th days, the cumulative mortality of the larvae of the thick narrow-ribbed branch beetle was 0%, 3.33%, 35.00%, 71.67%, 88.33%, 98.33%, 100% and 100% respectively. The main results are shown in Table 3. Table 3

[0045] From the perspective of lethal time effect, in 1×10 8 LT of the third instar larvae of Holotrichia crassicola under the treatment of spores / mL 50 The strain has high toxicity to the larvae of the broad-ribbed beetle, with a fast infection rate and a lethal time of LT 50 The main results are shown in Table 4.

[0046] Table 4 Time effect of infection and pathogenicity

[0047] This strain is a wild strain isolated and purified by our team from the larvae of the rough narrow-ribbed gill beetle that died from natural infection in the ginkgo field. It is Beauveria bassiana Bbzy2407, CGMCC No. 41648. The strain grows rapidly on SDAY medium at a temperature of (25±1)℃, relative humidity of (75±5)%, L / / D=12 h / / 12 h, with a large spore production and a high spore germination rate. Its spore suspension has strong pathogenicity to the larvae of the rough narrow-ribbed gill beetle and can be used for the prevention and control of the larvae of the rough narrow-ribbed gill beetle. At the same time, the raw materials for the cultivation of this strain are widely available, the price is cheap, the cultivation method is simple, and it is easy to produce in large quantities. It has great development and application potential. The use of the Beauveria bassiana Bbzy2407 strain to control the larvae of the rough narrow-ribbed gill beetle is a typical biological control, which can avoid the problems of drug resistance and environmental pollution caused by chemical pesticides, and will provide a basis for the green prevention and control of the larvae of the rough narrow-ribbed gill beetle.

[0048] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A Beauveria bassiana Bbzy2407 strain, characterized in that: Beauveria bassiana Beauveria bassiana ; Deposit number: CGMCC No.41648.

2. The Beauveria bassiana Bbzy2407 strain according to claim 1, characterized in that: The ITS gene sequence of the Beauveria bassiana Bbzy2407 strain is the nucleotide sequence shown in SEQ ID No.

1.

3. The Beauveria bassiana Bbzy2407 bacterial agent prepared from the Beauveria bassiana Bbzy2407 strain according to claim 1.

4. The bacterial agent according to claim 3, characterized in that The active ingredient is the conidia suspension of the Beauveria bassiana Bbzy2407 strain described in claim 1.

5. The method for preparing the bacterial agent according to claim 3, characterized in that: The following steps are involved: (1) Cultivate the Beauveria bassiana Bbzy2407 strain on SDAY medium; (2) Take conidia of Beauveria bassiana Bbzy2407 and place them in sterile water containing 0.05% Tween-80 to a concentration of 1.0×10 8 The Beauveria bassiana Bbzy2407 inoculum was prepared by preparing a spore suspension of Beauveria bassiana Bbzy2407 with a spore / mL.

6. An insecticide, characterized in that: The insecticide contains the Beauveria bassiana Bbzy2407 fungal agent described in any one of claims 3-4.

7. Use of the Beauveria bassiana Bbzy2407 strain according to claim 1 or the Beauveria bassiana Bbzy2407 agent according to any one of claims 3-4, or the insecticide according to claim 6 in controlling the larvae of Holothuria crassicola.

8. Use of the Beauveria bassiana Bbzy2407 strain according to claim 1 or the Beauveria bassiana Bbzy2407 bacterial agent according to any one of claims 3 to 4 in the preparation of a control agent for the larval stage of Holotrichia crassicola.

9. A method for controlling Holotrichia paniculata in the larval stage, characterized in that: The Beauveria bassiana Bbzy2407 fungicide according to any one of claims 3-4 or the insecticide according to claim 6 is applied to the larvae of the scarab beetle.

Images