Amino transferase mutant and application thereof

Abstract

The invention relates to the technical field of enzyme engineering, and discloses an aminotransferase mutant and application thereof. The invention provides a wild type amino transferase mutant which is derived from Aspergillus avenaceus (Aspergillus avenaceus), and a preparation method of the amino transferase mutant. The amino transferase mutant is obtained by carrying out single-site or multi-site combined mutation on the 20th site, the 60th site, the 92nd site and the 186th site of an amino acid sequence as shown in SEQ ID NO.2. As a biocatalyst, sitagliptin intermediate precursor ketone can be directly used as a substrate, isopropylamine is used as an amino donor, pyridoxal phosphate is used as a coenzyme, dimethyl sulfoxide is used as a substrate cosolvent, and the amino transferase mutant is obtained by carrying out single-site or multi-site combined mutation on the 20th site, the 60th site, the 92nd site and the 186th site of the amino acid sequence as shown in SEQ ID NO.2. The Sitagliptin intermediate with high optical purity is prepared through catalysis, the specific enzyme activity reaches 139.3 U / g in a reaction system with the DMSO volume final concentration being 50%, the catalysis efficiency is greatly improved, and the product has high stereoselectivity (the e.e. Value of the product reaches 99%) and has wide industrial application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering, in particular to an aminotransferase mutant and application thereof. Background Art

[0002] Sitagliptin, a dipeptidyl peptidase-4 (DPP-4) inhibitor marketed as Januvia, was approved by the FDA in October 2016 for the treatment of type 2 diabetes. Developed and manufactured by Merck and Codexis, Sitagliptin inhibits DPP-4 activity, reducing the degradation of glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic peptide (GIP), thereby enhancing the blood sugar-lowering effects of these hormones. Sitagliptin can be used alone or in combination with other antidiabetic medications, such as metformin or thiazolidinediones.

[0003] Sitagliptin and its intermediates can be synthesized using either entirely chemical methods or a combination of chemical and enzymatic methods. Chemical synthesis involves multiple steps, including key steps such as asymmetric hydrogenation and the Mitsunobu reaction. Enzymatic methods, on the other hand, utilize enzyme-catalyzed reactions, offering advantages such as mild reaction conditions, environmental friendliness, high selectivity, and a short reaction time, meeting the requirements of "green chemistry." The key to the chemical-enzymatic method is obtaining an ω-aminotransferase with enhanced activity and improved stability in organic solvent environments, capable of catalyzing the asymmetric transamination of the sitagliptin intermediate precursor ketone to obtain optically pure sitagliptin intermediates.

[0004] Regarding the research on ω-aminotransferase, the existing technologies include the following patents: (1) Chinese patent CN107384887 discloses an ω-aminotransferase derived from Burkholderia gladioli ZJB-12126 and an engineered modification thereof. However, the engineered transaminase disclosed in CN107384887 is not sufficiently active, requiring 50 g / L of wet bacteria to achieve a high conversion rate. Furthermore, the final volume concentration of DMSO as a cosolvent in the reaction system is 10-40%, which makes it impossible to achieve good enzyme activity in a high volume concentration DMSO system and thus a high conversion rate.

[0005] (2) Chinese patent CN108866021A discloses an ω-aminotransferase derived from Arthrobacter nitroguajacolicus ZJUTB06-99. The modified ω-aminotransferase solves the problems of poor stereoselectivity, expensive catalyst, and difficult solvent recovery in the process of producing sitagliptin intermediates to a certain extent. However, dimethyl sulfoxide is still used as a cosolvent, and the final volume concentration of dimethyl sulfoxide is preferably 20%. However, industrial production requires a higher substrate concentration, and enzyme proteins that are intolerant to dimethyl sulfoxide will find it difficult to play a good role in industrial production.

[0006] (3) International Patent W02007050485 discloses a method for synthesizing sitagliptin intermediates from Merck, which uses asymmetric hydrogenation of enamines with a chiral germanium catalyst to synthesize chiral amines with a yield of 84% and an ee value of 94%. However, this method requires the use of expensive germanium chiral catalysts, which are difficult to remove and recycle.

[0007] (4) International Patent WO2005003135 discloses a method for synthesizing chiral amines by inducing catalytic hydrogenation using S-phenylglycinamide (Merck). This route requires two catalytic hydrogenations. The first one uses an expensive platinum catalyst, and the second deprotection requires a large amount of PD(OH)2-C catalyst, which is also expensive. The ee value is 96%, requiring further recrystallization.

[0008] Based on the above-mentioned existing technologies, the asymmetric synthesis of sitagliptin and its intermediates has problems such as low total yield (generally less than 50%), low stereoselectivity (product ee value is generally less than 90%), low organic solvent tolerance (preferably the final volume concentration of dimethyl sulfoxide is 20%), low thermal stability, expensive metal catalysts, and the inability of biocatalysts to directly use sitagliptin precursor ketone as a substrate.

[0009] With the development of directed evolution technology, protein engineering is increasingly being used to modify the substrate specificity of enzymes, screen new transaminases with a broad substrate spectrum, and study chiral drugs and their intermediates that can be catalyzed efficiently and selectively. This not only broadens their application scope and enhances their application potential, but also lays the foundation for industrial production. Summary of the Invention

[0010] To address the problems of poor stereoselectivity and expensive catalysts in existing engineered transaminase technologies for synthesizing sitagliptin or its chiral amino intermediates, the present invention provides an ω-aminotransferase mutant, an encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and its use in the enzymatic preparation of sitagliptin intermediates. The ω-aminotransferase mutant provided by the present invention can directly use the sitagliptin intermediate precursor ketone as a substrate, and has higher catalytic activity, better thermal stability, and tolerance to organic solvents. Therefore, the ω-aminotransferase mutant has a wider application prospect in the industrial production of sitagliptin.

[0011] The specific technical solutions of the present invention are: In a first aspect, the present invention provides an ω-aminotransferase mutant obtained by performing single-point or multi-point combined mutations at positions 20, 60, 92, and 186 of the amino acid sequence shown in SEQ ID NO.2.

[0012] Preferably, the ω-aminotransferase mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO. 2 to any of the following mutations: (1) Arginine at position 20 is mutated to alanine; (2) Arginine at position 20 mutated to alanine, glycine at position 60 mutated to serine, alanine at position 92 mutated to proline, and leucine at position 186 mutated to phenylalanine. More specifically, the amino acid sequence of the ω-aminotransferase mutant (1) can be shown as SEQ ID No. 4, and the nucleotide sequence can be shown as SEQ ID No. 3. The amino acid sequence of the ω-aminotransferase mutant (2) can be shown as SEQ ID No. 6, and the nucleotide sequence can be shown as SEQ ID No. 5.

[0013] In a second aspect, the present invention provides a gene encoding the aforementioned ω-aminotransferase mutant.

[0014] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0015] In a fourth aspect, the present invention provides a genetically engineered bacterium comprising the above-mentioned encoding gene or the above-mentioned recombinant vector.

[0016] In a fifth aspect, the present invention provides use of the aforementioned ω-aminotransferase mutant in the preparation of a sitagliptin intermediate.

[0017] As a preferred application provided by the present invention, the above-mentioned ω-aminotransferase mutant can be used to catalyze the preparation of sitagliptin intermediate from the intermediate precursor ketone. Specifically, one of the application methods can be: using wet bacteria obtained by fermentation and culture of recombinant genetically engineered bacteria containing the gene encoding the ω-aminotransferase mutant as a catalyst, or using the pure enzyme liquid obtained by ultrasonic crushing and extraction of the wet bacteria as a catalyst, using the intermediate precursor ketone of sitagliptin as a substrate, using dimethyl sulfoxide (DMSO) as a cosolvent, using pyridoxal phosphate (PLP) as a coenzyme, using isopropylamine as a cosubstrate, and using pH 8-9 triethanolamine buffer as a reaction medium to form a reaction system, and carrying out a biocatalytic reaction at 40-50°C and 800-1200rpm.

[0018] Preferably, the amount of wet bacteria is 10-50 g / L; based on protein content, the amount of pure enzyme solution is 50-100 g / L; the final concentration of the substrate is 1-25 g / L; the final volume concentration of dimethyl sulfoxide (DMSO) is 10-50%, the concentration of pyridoxal phosphate (PLP) is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

[0019] As a preferred application provided by the present invention, the above-mentioned ω-aminotransferase mutant can be used to catalyze the preparation of sitagliptin intermediates from prochiral carbonyl compounds. Specifically, one of the application methods can be: using wet bacteria obtained by fermentation and culture of recombinant genetically engineered bacteria containing the gene encoding the ω-aminotransferase mutant as a catalyst, or using the pure enzyme solution obtained by ultrasonic crushing and extraction of the wet bacteria as a catalyst, using the prochiral carbonyl compound as a substrate, dimethyl sulfoxide (DMSO) as a cosolvent, pyridoxal phosphate (PLP) as a coenzyme, isopropylamine as a cosubstrate, and pH 8-9 triethanolamine buffer as a reaction medium to form a catalytic system, and carrying out a biocatalytic reaction at 40-50°C and 800-1200rpm. The chiral carbonyl compounds include, but are not limited to, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, acid isobutyl ester, 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester, 1-morpholino-4-(2,4,5-trifluorophenyl)-1,3-butanedione, (2Z)-4-oxo-4-[3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7-(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-one.

[0020] Preferably, the amount of wet bacteria is 10-50 g / L; based on protein content, the amount of pure enzyme solution is 50-100 g / L; the final concentration of the substrate is 1-25 g / L; the final volume concentration of dimethyl sulfoxide (DMSO) is 10-50%, the concentration of pyridoxal phosphate (PLP) is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

[0021] Compared with the prior art, the present invention has the following technical effects: The present invention provides a wild-type ω-aminotransferase mutant derived from Aspergillus avenaceus. The ω-aminotransferase mutant can be used as a biocatalyst to directly synthesize a sitagliptin intermediate using a sitagliptin intermediate precursor ketone (such as 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone) as a substrate. The ω-aminotransferase mutant provided by the present invention uses the sitagliptin intermediate precursor ketone as a substrate, isopropylamine as an amino donor, pyridoxal phosphate (PLP) as a coenzyme, and dimethyl sulfoxide (DMSO) as a substrate cosolvent to biocatalytically prepare a sitagliptin intermediate with high optical purity. The specific enzyme activity reaches 139.3 U / g in a reaction system with a final DMSO volume concentration of 50%, greatly improving the catalytic efficiency and the product has high stereoselectivity (the product ee value reaches 99%), thus having broad industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The effect of DMSO dosage on the production of sitagliptin intermediate precursor ketone catalyzed by transaminase and its dominant mutant; Figure 2 This is a half-life trend diagram at a methanol concentration of 10% (v / v). DETAILED DESCRIPTION

[0023] The present invention provides an ω-aminotransferase mutant, which is obtained by performing single-point or multi-point combined mutations at positions 20, 60, 92 and 186 of the amino acid sequence shown in SEQ ID NO.2.

[0024] The wild-type ω-aminotransferase of the present invention, i.e., the amino acid sequence shown in SEQ ID No. 2, is derived from Aspergillus avenaceus. It can also be isolated from a transformant expressing the recombinant protein or synthesized artificially. The identity between two amino acid sequences or two nucleotide sequences can be determined using algorithms commonly used in the art, preferably using NCBI Blastp and Blastn software using default parameters.

[0029] Due to the degeneracy of nucleotide codons, the polynucleotide sequences encoding the amino acid sequences of SEQ ID No. 4 and SEQ ID No. 6 are not limited to SEQ ID No. 3 and SEQ ID No. 5. Derivative amino acid sequences of the amino acid sequences of SEQ ID No. 4 and SEQ ID No. 6 of the present invention, which have been substituted, deleted, or added with one or more amino acid residues and have transaminase activity, and proteins with at least 95% identity, are also within the scope of protection of the present invention.

[0030] Based on the above-mentioned ω-aminotransferase mutant, a person skilled in the art can obtain the encoding gene of the above-mentioned ω-aminotransferase mutant by conventional methods in the art. Therefore, the encoding gene should fall within the scope of protection of the present invention.

[0031] Based on the above-mentioned ω-aminotransferase mutant, its encoding gene is loaded on a recombinant vector and transduced into a recipient bacterium to obtain a genetically engineered bacterium for expression of the ω-aminotransferase mutant. This is also a conventional method in the art. Therefore, the recombinant vector and the genetically engineered bacterium should fall within the scope of protection of the present invention.

[0032] The present invention also provides use of the above-mentioned ω-aminotransferase mutant in the preparation of a sitagliptin intermediate.

[0033] The wet bacteria of the present invention can be prepared as follows: the recombinant genetically engineered bacteria containing the gene encoding the ω-aminotransferase mutant are inoculated into an LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37°C and 180 rpm for 12 hours, and then inoculated into a fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a volume concentration of 2% inoculum, and cultured at 37°C and 180 rpm until the bacteria OD 600 When the pH value reaches 0.6-0.8, IPTG with a final concentration of 0.1 mM is added, and the culture is induced at 28°C for 12 hours, and then centrifuged at 4°C and 8000 rpm for 10 minutes. The supernatant is discarded and the precipitate is collected to obtain the wet bacteria.

[0034] The pure enzyme solution of the present invention can be prepared as follows: the wet bacteria are resuspended in binding buffer, ultrasonically disrupted (220W for 20 minutes), and centrifuged at 12000 rpm for 10 minutes at 4°C. The supernatant obtained is the crude enzyme solution. The crude enzyme solution is incubated with Ni affinity chromatography resin equilibrated with binding buffer, and then rinsed with washing buffer until there is basically no impurity protein. Then, the target protein is eluted with elution buffer and collected. After the purity is identified by electrophoresis, the target proteins are combined and dialyzed with dialysis buffer at 4°C for 48 hours (dialysis bag molecular cutoff capacity 33KDa). The collected intercepted liquid is the pure enzyme solution.

[0035] The binding buffer of the present invention is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl); the washing buffer is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl, 50mM imidazole); the elution buffer is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl, 500mM imidazole); and the dialysis buffer is 50mM, pH 8.0 sodium phosphate buffer.

[0036] The present invention will be further described below with reference to the following embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only a portion of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0037] Example 1 Amplification of the wild-type ω-aminotransferase gene WT According to the ω-aminotransferase gene sequence information from Aspergillus avenaceus included in Genbank, RNA from Aspergillus avenae was extracted using the SPIN Kit, and DNA was obtained by reverse transcription. This DNA was used as a template for PCR amplification using primers 1 and 2.

[0038] Primer 1: ATGGCGACCATGGATAAAGT; Primer 2: ATCGCTGCCATAATCCACCG.

[0039] PCR reaction system (total volume 50 μL): 25 μL of 10× Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 (both at a concentration of 50 μM), 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase, and 20 μL of ddH2O.

[0040] A BioRad PCR instrument was used, and the PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0041] The results showed that the nucleotide sequence amplified by primers 1 and 2 was 969 bp in length, which was the wild-type ω-aminotransferase gene, denoted as WT gene, and its nucleotide sequence was shown in SEQ ID NO.1. The amino acid sequence of the encoded protein was shown in SEQ ID NO.2, which encoded a complete open reading frame.

[0042] Example 2 Construction of wild-type recombinant expression vector pET28a-WT Primers 3 and 4 were designed according to the WT gene sequence in Example 1. The WT gene sequence was obtained using the recombinant plasmid pET28a-WT as a template under the action of the high-fidelity polymerase Phanta Max Super-FIDelity DNA Polymerase. The amplified fragment was treated with Buffer, and the WT gene (nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) was connected to the plasmid vector pET28a (Invitrogen) by one-step cloning to obtain the recombinant expression vector pET28a-WT.

[0043] Primer 3: ctttaagaaggagatatacc ATGGCGACCATGGATAAAGT; Primer 4: tggtggtggtggtgctcgag ATCGCTGCCATAATCCACCG.

[0044] Example 3 Construction of wild-type recombinant Escherichia coli BL21 / pET28a-WT The recombinant expression vector pET28a-WT constructed in Example 2 was transformed into Escherichia coli BL21 (DE3) (Invitrogen) (42°C, 90s), spread on an LB plate containing 50 μg / mL kanamycin resistance, and cultured at 37°C for 12 h. Clones were randomly picked and plasmids were extracted for sequencing and identification to obtain wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT.

[0045] Example 4 Induced Expression of Wild-Type Recombinant Escherichia coli BL21 / pET28a-WT The wild-type recombinant Escherichia coli BL21 (DE3) / pET28a-WT obtained in Example 3 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37 ° C, 200 rpm for 12 h, and then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 2% (v / v) inoculum amount, and cultured at 37 ° C, 150 rpm until the bacterial OD 600When the pH reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mM and induce the culture at 28°C for 12 hours. Centrifuge at 8000 rpm at 4°C for 10 minutes, discard the supernatant, and collect the precipitate to obtain the wild-type recombinant E. coli BL21 / pET28a-WT wet cells. This cell can be used directly as a biocatalyst or for protein purification.

[0046] Example 5 Preparation of Wild-Type ω-Aminotransferase-WT Pure Enzyme Solution After the wet thalline obtained in embodiment 4 is resuspended in binding buffer, through ultrasonication (220W crushing 20min), 12000rpm is centrifuged for 10min under 4 ℃ of conditions, the supernatant obtained is crude enzyme liquid, crude enzyme liquid is hatched with the Ni affinity chromatography resin crossed through binding buffer balance, then rinsed to substantially no foreign protein with flushing buffer, eluted and collected target protein with elution buffer subsequently, merge target protein after electrophoresis identification purity and dialyze 48h (dialysis bag molecular cut-off 33KDa) at 4 ℃, collect trapped liquid and be pure enzyme liquid.Collect trapped liquid, be wild-type ω-aminotransferase-WT pure enzyme liquid, adopting Coomassie brilliant blue method to measure protein content is 1.5mg / mL, by enzyme liquid 50mM, pH 8.0 sodium phosphate buffer is diluted to final concentration is 0.5mg / mL packing, is frozen in-80 ℃.

[0047] The binding buffer used in the above method is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl); the wash buffer is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl, 50mM imidazole); the elution buffer is 50mM, pH 8.0 sodium phosphate buffer (containing 300mM NaCl, 500mM imidazole); and the dialysis buffer is 50mM, pH 8.0 sodium phosphate buffer.

[0048] Example 6 Construction of ω-aminotransferase mutant library Based on the wild-type ω-aminotransferase gene sequence from Aspergillus avenaceus included in GenBank (amino acid sequence shown in SEQ ID NO. 2, nucleotide sequence shown in SEQ ID NO. 1), site-directed mutagenesis primers were designed. Using rapid PCR technology and the recombinant vector pET28a-WT as a template, single mutations were introduced at positions 20, 60, 92, and 186. The primers are: R20A Pf: TGCTGGAAGCCAGCGATAACCCG; R20A Pr:TTATCGCTGGCTTCCAGCAGTTTTCT.

[0049] G60S Pf: CCTATGATAGCTTTCATGTGTGG; G60S Pr:ACATGAAAGCTATCATAGGTCAGATC.

[0050] A92P Pf:TTCCGCTGcCGCTGAGCAGC; A92P Pr: CTGCTCAGCGGCAGCGGAAATT.

[0051] L186F Pf:GGGGCGATTTCATTCGCGGCAT; L186F Pr:CCGCGAATGAAATCGCCCCACTG.

[0052] PCR reaction system (total reaction system is 50 μL): 1× Phanta max Buffer 25 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1 μL, Phanta Max Super-FIDelity DNA Polymerase 1 μL, 1 μL each of upstream and downstream primers with a concentration of 50 μM, recombinant vector pET28a-WT 1 μL, ddH2O 20 μL.

[0053] PCR reaction conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 4 min, for a total of 30 cycles, and final extension at 72°C for 10 min.

[0054] 10 μL of PCR product was transferred into competent cells containing 100 μL of Escherichia coli BL21 (DE3), heat-shocked in a 42°C water bath for 90 seconds, and immediately placed on ice to cool for 3 minutes. 600 μL of LB liquid culture medium was added to the tube and cultured in a 37°C incubator at 180 rpm for 1 hour. The cultured bacterial liquid was centrifuged at 12000 rpm for 1 minute, 600 μL of supernatant was discarded, and the remaining 100 μL of bacterial liquid was thoroughly mixed and applied to an LB plate containing 50 μg / mL kanamycin resistance. After inverted culture at 37°C for 14-16 hours, a monoclonal strain was picked and sent to Hangzhou Qingke Sequencing Company for sequence detection. The sequencing results were analyzed using software.

[0055] Example 7 Catalyst for Determination of Enzyme Activity of ω-Aminotransferase Mutants: The wild-type recombinant Escherichia coli BL21 / pET28a-WT of Example 3 and the monoclonal strain verified by sequencing of Example 6 were used as catalysts by preparing wet cells according to the method of Example 4.

[0056] The final concentration of the reaction system in 10 mL was as follows: 50 g / L catalyst, pH 8.5-9.0 triethanolamine buffer, 25 g / L sitagliptin intermediate precursor ketone 1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone as substrate, 50% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 40 g / L isopropylamine.

[0057] Reaction conditions: temperature 45°C, stirring speed 800 r / min, reaction time 2 h. After the reaction, samples were taken for HPLC detection of product peak area value, and product content was calculated based on the product standard curve.

[0058] Specific enzyme activity is defined as the amount of enzyme required to catalyze the production of 1 μmol of product per hour under the above reaction conditions. This is expressed as one unit of enzyme activity, U. Specific enzyme activity is calculated using the formula: U / g = n / m*t (n: amount of product, μmol; m: mass of enzyme preparation, g; t: reaction time, h). The ee value is defined as the percentage of the total amount of one isomer a compared to the other isomer b in a mixture of enantiomers. The ee value is used to indicate the optical purity of a chiral compound. The higher the ee value, the higher the optical purity. The ee value calculation formula is: ee% = (RS) / (R + S) × 100% The HPLC detection conditions are as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: 100% acetonitrile; mobile phase A: mobile phase B = 1:1 (volume ratio); flow rate: 1 mL / min; detection wavelength: 205 nm, column oven: 40°C. Several excellent mutants were obtained from the test results, and the enzyme activities of some excellent mutants are shown in Table 1.

[0059] Table 1 Results of the reaction of sitagliptin intermediate precursor ketone catalyzed by wild-type transaminase WT and its mutants recombinant bacteria mutation site Final substrate concentration Specific enzyme activity (U / g) BL21 / pET28a-WT WT 25g / L 39.8 BL21 / pET28a-MUT1 R20A 25g / L 63.2 BL21 / pET28a-MUT2 R20G 25g / L 8.53 BL21 / pET28a-MUT3 R20A / G60S / A92P / L186F 25g / L 139.3 Recombinant E. coli BL21 / pET28a-MUT1 and recombinant E. coli BL21 / pET28a-MUT3 were used to prepare pure enzyme solutions according to the method of Example 5 for subsequent catalytic reactions. The amino acid sequence of the ω-aminotransferase mutant obtained from recombinant E. coli BL21 / pET28a-MUT1 (denoted as ω-aminotransferase mutant 1) can be shown as SEQ ID No. 4, and the nucleotide sequence is shown as SEQ ID No. 3. The amino acid sequence of the ω-aminotransferase mutant obtained from recombinant E. coli BL21 / pET28a-MUT3 (denoted as ω-aminotransferase mutant 3) can be shown as SEQ ID No. 6, and the nucleotide sequence is shown as SEQ ID No. 5.

[0060] Example 8 Effect of DMSO Dosage on the Preparation of Sitagliptin Intermediates from Transaminase WT and Its Mutants The wild-type recombinant E. coli BL21 / pET28a-WT pure enzyme solution obtained by the method of Example 5 and the recombinant E. coli BL21 / pET28a-MUT1 and recombinant E. coli BL21 / pET28a-MUT3 screened by the method of Example 7 were prepared according to the method of Example 5 as biocatalysts. The catalyst dosage was calculated based on protein content, and the sitagliptin intermediate was calculated based on sitagliptin. A biocatalytic reaction was conducted to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone using the gliptin intermediate precursor ketone [1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] as a substrate, pyridoxal phosphate as a coenzyme, isopropylamine as a cosubstrate, DMSO as a cosolvent, and triethanolamine buffer (pH 8.5-9.0) as the reaction medium. The effect of varying DMSO dosages on the reaction was investigated. A reaction solution without enzyme was used as a blank control, and pure E. coli BL21 / pET28a enzyme solution was used instead of the recombinant E. coli BL21 / pET28a-WT pure enzyme solution as a negative control.

[0061] The final concentration composition of the 10 mL reaction system is as follows: 2.5 g pure enzyme solution, pH 8.5-9.0 triethanolamine buffer, 5 g / L substrate, 0.5 g / L pyridoxal phosphate, 40 g / L isopropylamine, and different concentrations of DMSO (volume concentration 10%, 20%, 30%, 40%, 50%, 60%).

[0062] Reaction conditions: temperature 45 ° C, stirring speed 1000 r / min, reaction time 2h. After the reaction, samples were taken for HPLC detection, and the specific enzyme activity and ee value were calculated using the method of Example 7. Figure 1 As shown in Tables 2 to 4. Table 2 Effect of DMSO dosage on the synthesis of sitagliptin intermediate precursor ketone catalyzed by BL21 / pET28a-WT DMSO volume concentration% Specific enzyme activity (U / g) ee% 10 40.3 >50 20 35.3 >50 30 28.8 >50 40 21.4 >50 50 13.3 >50 60 0 0 Table 3 Effect of DMSO dosage on the catalytic production of sitagliptin intermediate precursor ketone by BL21 / pET28a-MUT1 DMSO volume concentration% Specific enzyme activity (U / g) ee% 10 90.5 >99 20 79.5 >99 30 61.0 >99 40 37.4 >99 50 17.7 >99 60 3.2 >99 Table 4 Effect of DMSO dosage on the catalytic production of sitagliptin intermediate precursor ketone by BL21 / pET28a-MUT3 DMSO volume concentration% Specific enzyme activity (U / g) ee% 10 136.4 >99 20 121.3 >99 30 98.5 >99 40 55.6 >99 50 27.0 >99 60 5.3 >99

[0063] Example 9 Effect of Different Organic Solvents on the Preparation of Sitagliptin Intermediates Using Transaminase WT and Its Mutants The pure enzyme solution of wild-type recombinant Escherichia coli BL21 / pET28a-WT obtained by the method of Example 5 and the pure enzyme solutions of recombinant Escherichia coli BL21 / pET28a-MUT1 and recombinant Escherichia coli BL21 / pET28a-MUT3 screened by the method of Example 7 and prepared according to the method of Example 5 were used as biocatalysts. The amount of catalyst used was calculated based on protein content, and the intermediate precursor ketone of sitagliptin [1-piperidine-4-(2, A biocatalytic reaction was conducted to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone using [(R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] as the substrate, pyridoxal phosphate as the coenzyme, isopropylamine as the cosubstrate, various organic solvents (including DMSO, methanol, ethyl acetate, methyl tert-butyl ether, dichlorotoluene, toluene, and isopropyl acetate) as cosolvents, and triethanolamine buffer (pH 8.5-9.0) as the reaction medium. The effects of different organic solvents on the reaction were investigated. A reaction solution without enzyme was used as a blank control, and pure E. coli BL21 / pET28a enzyme solution was used instead of the recombinant E. coli BL21 / pET28a-WT pure enzyme solution as a negative control.

[0064] The final concentration composition of the 10 mL reaction system is as follows: 2.5 g pure enzyme solution, pH 8.5-9.0 triethanolamine buffer, 5 g / L substrate, 0.5 g / L pyridoxal phosphate, 40 g / L isopropylamine, and different organic solvents (volume concentration 50%).

[0065] Reaction conditions: temperature 45°C, stirring speed 1000 rpm, reaction time 2 h. After the reaction, samples were collected for HPLC analysis, and specific enzyme activity and ee values ​​were calculated using the method in Example 7. The results are shown in Tables 5-7. Table 5 Effects of different organic solvents on the catalytic reaction of sitagliptin intermediate precursor ketone by BL21 / pET28a-WT Table 6 Effects of different organic solvents on the catalytic production of sitagliptin intermediate precursor ketone by BL21 / pET28a-MUT1 organic solvents Specific enzyme activity (U / g) ee% DMSO 77.2 >99 Methanol 97.7 >99 Ethyl acetate 20.7 >99 Methyl tert-butyl ether 20.8 >99 Dichlorotoluene 46.5 >99 Toluene 87.1 >99 Isopropyl acetate 31.1 >99 Table 7 Effects of different organic solvents on the catalytic production of sitagliptin intermediate precursor ketone by BL21 / pET28a-MUT3 organic solvents Specific enzyme activity (U / g) ee% DMSO 129.1 >99 Methanol 165.2 >99 Ethyl acetate 27.6 >99 Methyl tert-butyl ether 29.1 >99 Dichlorotoluene 64.3 >99 Toluene 111.3 >99 Isopropyl acetate 38.3 >99

[0066] Example 10 Determination of enzyme activity half-life Reaction system 10mL: wild-type recombinant Escherichia coli BL21 / pET28a-WT and recombinant Escherichia coli BL21 / pET28a-MUT3 (R20A / G60S / A92P / L186F) screened by the method of Example 6, 2.5g (in terms of protein content) of pure enzyme solution prepared according to the method of Example 5, substrate sitagliptin intermediate precursor ketone 2g / L, pH 8.5-9.0 triethanolamine buffer, 0.5g / L pyridoxal phosphate, 40g / L isopropylamine, different concentrations of methanol (10%, 30%, 50%). Before the reaction, the pure enzyme solution was incubated in a water bath at 45°C in methanol with a volume concentration of 10%, 30%, and 50% for a period of time before adding other substances. The catalytic reaction was carried out at 45°C with a stirring speed of 1000r / min for 2h. The product concentration was detected by the HPLC method described in Example 7 to measure the half-life of the enzyme activity. The results are shown in FIG. Figure 2 (Half-life trend graph at 10% (v / v) methanol concentration) and Table 8.

[0067] Under the same conditions, the reaction solution without enzyme solution was used as a blank control, and the pure enzyme solution of E. coli BL21 / pET28a was used instead of the above recombinant E. coli BL21 / pET28a-WT as a negative control.

[0068] Table 8 shows that the enzyme activity of the recombinant transaminase WT decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 10% methanol for 31.8 h; the enzyme activity decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 30% methanol for 3.87 h; and the enzyme activity decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 50% methanol for 0.7 h.

[0069] The enzyme activity of the recombinant transaminase mutant (R20A / G60S / A92P / L186F) decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 10% methanol for 98.2 hours; the enzyme activity decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 30% methanol for 13.3 hours; and the enzyme activity decreased to 50% of the initial enzyme activity after incubation at a volume concentration of 50% methanol for 3.9 hours. Table 8 Half-life under incubation at different methanol volume concentrations

[0070] Example 11 Application of a recombinant transaminase mutant to catalyze the preparation of a prochiral carbonyl compound for the preparation of a sitagliptin intermediate. The recombinant Escherichia coli BL21 / pET28a-MUT1 (R20A) screened by the method of Example 7 and the pure enzyme solution prepared by the method of Example 5 were used as a biocatalyst. The catalyst amount was calculated based on the protein content. The catalytic system was composed of a prochiral carbonyl compound substrate, pyridoxal phosphate as a coenzyme, isopropylamine as a cosubstrate, DMSO as a cosolvent, and triethanolamine buffer solution at pH 8.5-9.0 as a reaction medium. A biocatalytic reaction was carried out to synthesize a sitagliptin intermediate.

[0071] Substrate 1 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester, and the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester; Substrate 2 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester, and the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid ethyl ester; Substrate 3 is 3-carbonyl-4- (2,4,5-trifluorophenyl)-butyric acid propyl ester, the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid propyl ester; substrate 4 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester, the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester; substrate 5 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid isopropyl ester Substrate 6 is 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester, and the product is (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid benzyl ester; Substrate 7 is 1-morpholinyl-4-(2,4,5-trifluorophenyl)-1,3- Butanedione, the product is (R)-3-amino-1-morpholino-4-(2,4,5-trifluorophenyl)-1-butanone; substrate 8 is (2Z)-4-oxo-4-[3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7-(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-one, and the product is sitagliptin.

[0072] The final concentration of the catalytic system in 10 mL was as follows: 2.5 g of pure enzyme solution, triethanolamine buffer (pH 8.5-9.0), 25 g / L of substrate, 0.5 g / L of pyridoxal phosphate, 40 g / L of isopropylamine, and 50% DMSO by volume. Reaction conditions: temperature 45°C, stirring speed 1000 rpm, reaction time 2 h. Under the same conditions, a reaction solution without enzyme solution was added as a blank control, and pure enzyme solution from E. coli BL21 / pET28a-WT was used instead of the recombinant E. coli BL21 / pET28a-MUT3 as a negative control. After the reaction, samples were taken and the product peak area was measured using HPLC as described in Example 6. The substrate conversion and ee value were calculated based on the product standard curve. The results are shown in Table 9. Table 9 Results of asymmetric transamination of carbonyl compounds catalyzed by recombinant transaminase mutants (2 h)

[0073] Example 12: Use of Recombinant Transaminase Mutants in Catalyzing the Preparation of Potentially Chiral Carbonyl Compounds to Prepare Sitagliptin Intermediates The recombinant E. coli BL21 / pET28a-MUT1 in Example 11 was replaced with recombinant E. coli BL21 / pET28a-MUT3. Other operations were the same. The results are shown in Table 10.

[0074] Table 10 Results of asymmetric transamination of carbonyl compounds catalyzed by recombinant transaminase mutant 3 (2 h) Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0075] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. An aminotransferase mutant, characterized in that: The amino acid sequence is obtained by performing single-point or multi-point combined mutations at positions 20, 60, 92 and 186 of the amino acid sequence shown in SEQ ID NO.

2.

2. An aminotransferase mutant according to claim 1, characterized in that: It is obtained by subjecting the amino acid sequence shown in SEQ ID NO.2 to any of the following mutations: (1) Arginine at position 20 mutated to alanine; (2) The arginine at position 20 mutated to alanine, while the glycine at position 60 mutated to serine, the alanine at position 92 mutated to proline, and the leucine at position 186 mutated to phenylalanine.

3. A gene encoding the aminotransferase mutant according to any one of claims 1 to 2.

4. A recombinant vector, characterized in that: Comprising the coding gene according to claim 3.

5. A genetically engineered bacterium, characterized in that: Comprising the coding gene according to claim 3 or the recombinant vector according to claim 4.

6. Use of the aminotransferase mutant according to any one of claims 1 to 2 in the preparation of a sitagliptin intermediate.

7. The use according to claim 6, characterized in that: The application method comprises the following steps: using wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing aminotransferase mutant encoding genes as a catalyst, or using pure enzyme liquid obtained by ultrasonic crushing and extraction of the wet bacteria as a catalyst, using sitagliptin intermediate precursor ketone as a substrate, using dimethyl sulfoxide as a cosolvent, using pyridoxal phosphate as a coenzyme, using isopropylamine as a cosubstrate, and using pH 8-9 triethanolamine buffer as a reaction medium to form a reaction system, and performing a biocatalytic reaction at 40-50°C and 800-1200rpm.

8. The use according to claim 7, characterized in that: The wet bacterial cell dosage is 10-50 g / L; the pure enzyme solution dosage is 50-100 g / L in terms of protein content; the final substrate concentration is 1-25 g / L; the final volume concentration of dimethyl sulfoxide is 10-50%, the concentration of pyridoxal phosphate is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

9. The use according to claim 6, characterized in that: The application method comprises the following steps: using wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing aminotransferase mutant encoding genes as a catalyst, or using pure enzyme solution obtained by ultrasonic crushing and extraction of the wet bacteria as a catalyst, using a prochiral carbonyl compound as a substrate, using dimethyl sulfoxide as a cosolvent, using pyridoxal phosphate as a coenzyme, using isopropylamine as a cosubstrate, and using a pH 8-9 triethanolamine buffer as a reaction medium to form a catalytic system, and performing a biocatalytic reaction at 40-50° C. and 800-1200 rpm.

10. The use according to claim 9, characterized in that: The wet bacterial cell dosage is 10-50 g / L; the pure enzyme solution dosage is 50-100 g / L in terms of protein content; the final substrate concentration is 1-25 g / L; the final volume concentration of dimethyl sulfoxide is 10-50%, the concentration of pyridoxal phosphate is 0.25-2 g / L, and the concentration of isopropylamine is 20-50 g / L.

Images