Application of TOP1 as diagnostic and prognostic marker and therapeutic target of glioblastoma

Abstract

The invention discloses application of a reagent for detecting expression of a biomarker TOP1 in preparation of a product for diagnosis or prognosis of a glioblastoma object and application of a TOP1 expression inhibitor in preparation of a medicine for treating glioblastoma. The research proves that the TOP1 can be used as a novel diagnosis and prognosis marker and a treatment target of glioblastoma, and a novel reference is provided for a precise tumor treatment scheme. A certain reference value is provided for subsequent further research on the specific action mechanism of TOP1 for promoting the glioblastoma cell function, and a new thought is provided for research on the pathogenesis of glioblastoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of TOP1 as a diagnostic and prognostic marker and therapeutic target for glioblastoma. Background Art

[0002] The incidence of primary malignant brain tumors is about 7 per 100,000 people. Glioblastoma (GBM) is the most common primary malignant brain tumor in adults, and approximately 49% of malignant brain tumors are glioblastomas. According to a report from the National Cancer Center, the incidence and mortality rates of brain tumors are at the forefront. The median survival of patients after treatment is still no more than 14 months, and the five-year survival rate is less than 10%. A variety of treatment options have been used, but due to the high invasiveness and heterogeneity of GBM, the treatment effect is not good. Therefore, exploring the influencing mechanism of GBM and its role in the occurrence and development of GBM is very necessary for finding new therapeutic targets and comprehensively developing effective treatment options.

[0003] Conventional treatments for GBM include radiotherapy, chemotherapy, and immunotherapy. However, existing reports show that GBM is an immune-cold tumor, that is, it has a highly immunosuppressive tumor microenvironment, with a large number of immunosuppressive cells and cytokines infiltrating the tumor, which poses a huge obstacle to anti-tumor immunotherapy. Therefore, how to turn cold tumors into hot tumors and thus improve the response to tumor immunotherapy is one of the important research issues.

[0004] Topoisomerase is a class of enzymes present in the cell nucleus. They can catalyze the breakage and combination of DNA chains, thereby controlling the topological state of DNA. Among them, topoisomerase I encoded by the TOP1 gene is an extremely important nuclear enzyme in the body. It participates in key nuclear processes such as DNA replication, transcription, recombination and repair, and plays an important role in transcriptional regulation and maintaining DNA topological structure. Topoisomerase I can catalyze the breakage and reconnection of one strand of double-stranded DNA, thereby playing an important role in the relaxation of positive and negative supercoils. In this process, it changes the topological state of nucleic acids by forming a reversible cleavage complex (TOP1ccs), thereby regulating the stability of the genome. TOP1 deficiency can cause DNA damage, thereby causing neurodegenerative diseases or tumor formation, so the use of TOP1-related drugs can be used as one of the ways to treat cancer. However, the impact and specific mechanism of TOP1 in the occurrence and development of GBM are still unclear. Whether targeting TOP1 has an impact on the immune microenvironment of GBM and the specific mechanism remain to be explored. Summary of the invention

[0005] The purpose of the present invention is to address the above problems and provide an application of TOP1 as a diagnostic, prognostic marker and therapeutic target for glioblastoma.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides use of a reagent for detecting the expression of the biomarker TOP1 in the preparation of a product for diagnosing or prognosing a glioblastoma subject.

[0008] The diagnostic method comprises: obtaining a test sample from a subject suspected of having glioblastoma, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, it indicates that the subject is a glioblastoma patient.

[0009] The prognosis method comprises: obtaining a test sample from a subject suffering from glioblastoma, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, it indicates that the subject is a glioblastoma patient.

[0010] The second aspect of the present invention provides the use of TOP1 as a target in screening drugs for treating glioblastoma.

[0011] The drug inhibits the expression of TOP1, thereby inhibiting the viability and proliferation of glioblastoma cells, and further slowing down or preventing the development of glioblastoma.

[0012] The third aspect of the present invention provides use of a TOP1 expression inhibitor in the preparation of a drug for treating glioblastoma.

[0013] The expression inhibitor is selected from nucleic acid molecules, protein molecules or small molecule compounds.

[0014] The nucleic acid molecule includes shRNA, the sense strand sequence of the shRNA is CAGAGTTGGATGGTCAGGAAT, and the antisense strand sequence is ATTCCTGACCATCCAACTCTG.

[0015] The small molecule compound is selected from Camptothecin or Topotecan.

[0016] The beneficial effects of the present invention are:

[0017] The present invention shows through CCK-8 experiment and EdU experiment that knocking down TOP1 will inhibit the cell activity and proliferation of glioblastoma cells, and using TOP1 specific inhibitor to inhibit TOP1 will inhibit the proliferation of glioblastoma cells and promote apoptosis; TOP1 can be used as a new diagnostic, prognostic marker and therapeutic target for glioblastoma, providing a new reference for tumor precision treatment. It provides a certain reference value for further exploring the specific mechanism of TOP1 promoting the function of glioblastoma cells, and provides a new idea for studying the pathogenesis of glioblastoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are the analysis results of TOP1 in the GEPIA database (A) and the CGGA database (B).

[0019] Figure 2 Paraffin sections of mouse tumor tissue (A), paraffin sections of GBM patient tumor tissue (B), and RT-PCR detection results of TOP1 expression in the tumor center and adjacent areas of GBM patients (C).

[0020] Figure 3 This is the result of the correlation analysis between TOP1 and CIBERSORT immune infiltration in GBM transcriptome sequencing data.

[0021] Figure 4 The results of Western blot detection of TOP1 expression in glioblastoma cell lines (A) and TOP1 knockdown efficiency in glioblastoma cell lines (B).

[0022] Figure 5 This is the result of CCK-8 experiment detecting the effect of knocking down TOP1 on the cell viability of glioblastoma.

[0023] Figure 6 EdU staining experiments were used to detect the effect of knocking down TOP1 on the proliferation of glioblastoma cells (A) and the effect of topoisomerase I inhibitor on the proliferation of glioblastoma cells (B).

[0024] Figure 7 These are the results of flow cytometry experiments to detect the effects of TOP1 inhibitors on glioblastoma cell apoptosis.

[0025] Figure 8 This is the result of immunofluorescence staining of cell slides.

[0026] Fig. 9 It is the result of Western Blot detection of changes in TOP1 protein levels and changes in p-TBK1 and p-IRF3 protein levels in the cGAS-STING pathway.

[0027] Fig.10 It is the result of QPCR detection of changes in mRNA levels of type I interferon-related genes. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0029] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0030] Main reagents and sources:

[0031] Reagents brand PicoGreen Dye Thermo Fisher <![CDATA[BeyoClick TM EdU-488 Cell Proliferation Detection Kit]]> Blue Sky AnnexinV-FITC Cell Apoptosis Detection Kit Blue Sky Camptothecin (CPT, T1123), a topoisomerase I inhibitor Pottery Topotecan (TPT, T5784), a topoisomerase I inhibitor Pottery DAPI(#D9542) Sigma TOP1 Antibody (#A12409) ABclonal p-TBK1(#5483S) CellSignaling Technology TBK1(#3504S) CellSignaling Technology p-IRF3(#29047S) CellSignaling Technology IRF3(#ET1612-14) HUABIO γH2AX(#AP0099) ABclonal GAPDH(#10494-1-AP) Proteintech

[0032] Example 1: Data analysis of TOP1 expression and clinical relevance in glioblastoma

[0033] The GEPIA online analysis website (http: / / gepia.cancer-pku.cn / ) was used to perform pan-cancer analysis, analyzing the TOP1 gene expression profiles of 33 tumor samples and paired normal tissues, and found that TOP1 was highly expressed in various types of cancer ( Figure 1 A). The expression differences of TOP1 in 182 glioblastoma tissue samples and 286 normal brain tissue samples in GBM were analyzed. The data showed that the expression of TOP1 in glioblastoma tissue samples was higher than that in normal tissues.

[0034] Using the CGGA database (https: / / www.cgga.org.cn / ), the relationship between TOP1 expression and patient survival prognosis was analyzed in the mRNAseq_325 dataset of the database. The relationship between the high and low expression of TOP1 and patient survival prognosis was analyzed in 111 primary glioblastoma tissue samples and 29 recurrent glioblastoma tissue samples. The data showed that ( Figure 1 B), Among patients with primary or recurrent GBM, those with high TOP1 expression had a worse survival prognosis.

[0035] Example 2: Expression of TOP1 in glioblastoma

[0036] 1. Immunohistochemical staining was performed on paraffin sections of patient glioblastoma and primary mouse glioblastoma to detect the expression of TOP1 in tissue sections.

[0037] The clinical GBM patient tissue samples used in this study were provided by the Department of Neurosurgery of the First Affiliated Hospital of Chongqing Medical University. The collected fresh tissue samples were immediately placed on ice after ex vivo removal. After removing the blood clots and the charred parts of the tissue by the electric knife, they were cut into small pieces, 1 / 3 of which was embedded in paraffin, 1 / 3 was embedded in OCT, and the rest was collected in EP tubes for protein and RNA samples. The research methods used in this experiment were approved by the Ethics Committee of Chongqing Medical University.

[0038] After dewaxing and rehydration, paraffin sections of GBM tissue samples from patients and paraffin sections of brain tumor tissues from mice were repaired with sodium citrate antigen repair solution at 100°C boiling water for 15 minutes, and then rinsed with PBS buffer three times, 3 minutes each time. Then, endogenous peroxidase blocker was added dropwise and incubated at room temperature for 10 minutes, and then rinsed with PBS buffer three times. Then, 5% sheep serum containing 0.3% Triton X-100 was added dropwise for penetration blocking at room temperature for 1 hour, and then rinsed with PBS buffer three times. The primary antibody solution prepared with the blocking solution was incubated overnight (about 12 hours) in a humid environment at 4°C. After the primary antibody was recovered the next day, it was rinsed with PBS buffer three times, and then incubated with immunohistochemical HRP secondary antibody prepared with the blocking solution at room temperature in the dark for 20 minutes, and then rinsed with PBS buffer three times. The prepared DAB color development solution was used to observe the color development under an optical microscope until it was just right, and then immediately placed in water to terminate the color development. Then, the cell nucleus was stained with hematoxylin dye, and then washed with natural water to differentiate and turn blue. Then, the cells were placed in ethanol solution and xylene for gradient dehydration to make them transparent. After sealing with neutral resin, the cells were examined and photographed under an Olympus optical microscope.

[0039] Paraffin sections of primary mouse glioblastoma tumor tissue Figure 2 As shown in A, paraffin sections of GBM patient tumor tissues are Figure 2 As shown in B, the results showed that TOP1 was highly expressed in both primary glioblastoma tumor tissues of mice and tumor tissues of GBM patients, and was clearly localized in the cell nucleus.

[0040] 2. RT-PCR detection of TOP1 expression

[0041] RNA was extracted from the patient's glioblastoma tissue and reverse transcribed into cDNA.

[0042] Quantitative PCR: ACTIN was used as the internal reference, and the cDNA obtained by reverse transcription was used as the template. For each sample and each primer, three replicate wells were set up, and the volume of each replicate well was 10 μl. The reaction was as follows: 2×SYBR green 5 μl, cDNA 2 μl, upstream primer 0.4 μl, downstream primer 0.4 μl, ddH2O 2.2 μl. The PCR program was: 95°C 30 s; 95°C 10 s, 60°C 30 s, 95°C 15 s, 60°C 1 min, 40 cycles; 95°C 15 s. According to the Ct value results obtained by the final test and the results of the internal reference gene, the relative expression of the target gene mRNA was calculated according to 2-ΔΔCt.

[0043] The quantitative PCR primer sequences are as follows:

[0044] sequence name Sequence (5'-3'') SEQ ID NO ACTIN-F ACGAATCAAGGGTGAGAAGG SEQ ID NO.1 ACTIN-R CGATACTGGTTCCGGATCTT SEQ ID NO.2 TOP1-F CATGTACGTTGCTATCCAGGC SEQ ID NO.3 TOP1-R CTCCTTAATGTCACGCACGAT SEQ ID NO.4

[0045] The mRNA levels of TOP1 in paired adjacent tissues and tumor tissues of 10 GBM patients were detected, and it was found that TOP1 expression in the tumor center was higher than that in adjacent tissues ( Figure 2 C), and there was a statistically significant difference, indicating that TOP1 may have a carcinogenic effect.

[0046] Example 3: Correlation between TOP1 and tumor immune infiltration

[0047] CIBERSORT analysis of TCGA data: Download GBM transcriptome sequencing data from the TCGA database, download immune cell clustering data from the CIBERSORT website (https: / / cibersortx.stanford.edu / ), and analyze the correlation between TOP1 and CIBERSORT immune infiltration in GBM transcriptome sequencing data. It was found that TOP1 was positively correlated with Macrophage M0, T cells CD4 memoryresting, and T cells follicular helper, and negatively correlated with Monocytes, Mast cells activated, and Eosinophil ( Figure 3 ). This indicates that TOP1 expression is correlated with immune infiltration in the GBM microenvironment.

[0048] Example 4: Study on the function and related mechanisms of TOP1 in regulating glioblastoma

[0049] 1. Expression of TOP1 in glioblastoma cell lines

[0050] 1) Cell culture: Human glioma cell lines used in this experiment (U251, U87, Ts543, Ts667, LN229)

[0051] All cells were stored in the laboratory of our research team for a long time. Cell culture medium was changed, passaged and cryopreserved according to the growth conditions.

[0052] 2) Extracting proteins from cells: conventional methods.

[0053] 3) Western Blot: conventional method.

[0054] result( Figure 4 A) shows that TOP1 is highly expressed in human glioblastoma cell lines.

[0055] 2. Construction of a glioblastoma cell line with stable knockdown of TOP1

[0056] 1) Lentivirus plasmid construction: TOP1-shRNA interference lentivirus plasmid was provided by Professor Hong Shiyuan's research group at Chongqing Medical University. The Gene ID of TOP1 in NCBI is: 7150. The sequence of TOP1-shRNA is as follows:

[0057] sequence name Sequence (5'-3'') SEQ ID NO shTOP1-38-Justice Chain CAGAGTTGGATGGTCAGGAAT SEQ ID NO.5 shTOP1-38-Antisense ATTCCTGACCATCCAACTCTG SEQ ID NO.6

[0058] 2) Virus packaging: 1. Prepare HEK 293T cells and culture at 37°C; 2. When the cells grow to 70% density of a 10 cm culture dish, replace the complete culture medium with serum-free medium 1 hour before transfection. 3. The plasmid transfection system is as follows:

[0059] Plasmids Dosage pMD2.G 1.875 μg psPAX2 5.625 μg TOP1-shRNA 7.5 μg Transfection reagent PEI 45μL (1μg / μL)

[0060] Prepare 500μl serum-free DMEM medium + 45μl transfection reagent PEI, mix thoroughly, and let stand for 5min; prepare 500μl serum-free DMEM medium + 7.5μg target plasmid + 1.875μg pMD2.G + 5.625μg psPAX2, mix thoroughly, and let stand for 5min. 4. Mix the two tubes of liquid together and let stand at room temperature for 20min; 5. Add all the mixed liquid to the culture dish; 5. After 4-6h, replace the culture medium with complete culture medium with serum; 6. Collect the virus supernatant 48h and 72h after transfection, centrifuge at 3000rpm for 10min, and filter using a 0.45μm filter. Aliquot the filtered virus and store it at -80℃.

[0061] 3) Lentivirus infection step: Inoculate cells into six-well plates as needed and culture them in an incubator overnight; melt the virus solution on ice, remove the culture medium, wash once with PBS, and add 1 ml of fresh culture medium + 1 ml of virus solution; 48 hours after infection, add appropriate concentrations of puromycin for stable screening, and use wild-type cell lines plus the same concentration of puromycin for screening as a control. When all wild-type cells die during the screening process, the screening can be stopped.

[0062] 4) Collecting some of the screened cell extracts: conventional method.

[0063] 5) Western Blot detection: conventional method

[0064] result( Figure 4 B) shows that: U87 and U251 cells were infected with lentiviral empty vectors or shRNA interference lentivirus containing TOP1-shRNA, and the knockdown efficiency was verified by Western blot experiments. The experimental results showed that compared with the control group, the TOP1 protein levels of U87 and U251 were significantly reduced.

[0065] 3. CCK8 experiment:

[0066] CCK-8 experiments were used to verify whether knocking down TOP1 could affect the cell viability of glioblastoma. Figure 5 ) showed that knockdown of TOP1 could significantly inhibit the cell viability of U87 and U251 cells, and the results were statistically significant.

[0067] 4. EdU staining experiment:

[0068] EdU staining was used to verify whether knocking down TOP1 could affect the proliferation of glioblastoma cells. Figure 6 A) shows that knockdown of TOP1 can significantly inhibit the cell proliferation of U87 and U251 cells, and the results are statistically significant.

[0069] Camptothecin (CPT), an alkaloid, is a specific inhibitor of DNA topoisomerase I. Topotecan (TPT) is also an effective inhibitor of topoisomerase I. EdU staining was used to verify whether the use of TOP1 inhibitors CPT and TPT could affect the proliferation of glioblastoma cells. The results showed that ( Figure 6 B), TOP1 inhibitors CPT and TPT significantly inhibited the proliferation of U87 and U251 cells.

[0070] 5. Cell apoptosis detection experiment

[0071] Cell apoptosis detection was used to verify whether the treatment with TOP1 inhibitors CPT and TPT could affect the apoptosis of glioblastoma cells. Figure 7 ) showed that the use of TOP1 inhibitors CPT and TPT significantly promoted the apoptosis of U87 and U251 cells.

[0072] VI. Immunofluorescence staining of cell slides

[0073] 1) Place the cell slides in a 24-well cell culture plate and sterilize by ultraviolet irradiation.

[0074] 2) Cell culture: conventional methods.

[0075] 3) After resuspending the cells, evenly spread them on a well plate with a cell slide, culture the cells and treat them with a CPT 0.1 μM inhibitor for 24 hours.

[0076] 4) After treatment, take out the cell slides for immunofluorescence staining: ① Incubate with PicoGreen active dye for 10 minutes. ② Incubate the cell slides with 4% paraformaldehyde for 10 minutes. ③ Wash three times with pre-cooled PBS. ④ Permeabilize with 0.1% Triton X-100 diluted in PBS for 10 minutes and wash three times with pre-cooled PBS. ⑤ Use 5% BSA as blocking solution for 30 minutes. ⑤ Dilute the primary antibody with blocking solution and incubate overnight at 4°C. ⑥ Wash three times with PBS on the next day and protect from light. Incubate with rabbit secondary antibody. Finally, stain with DAPI (1ug / ml) for 5 minutes. ⑦ Seal the slides with anti-fluorescence quencher.

[0077] result( Figure 8 ) showed that: immunofluorescence staining was performed on GBM cells U87 after treatment with TOP1 inhibitor CPT, γH2AX was used to detect DNA damage, and PicoGreen was used to detect double-stranded DNA. It was found that DNA damage increased after inhibitor treatment and leaked out of the cell nucleus, suggesting that it may be sensed by cGAS and activate its downstream pathways.

[0078] VII. Western Blot Detection of cGAS-STING Pathway Activation

[0079] 1) Cell culture: conventional method.

[0080] 2) U87 cells were treated with TOP1 inhibitor CPT at concentrations of 0.8 μM, 1.0 μM, and 1.2 μM, respectively, and cell samples were collected after 24 hours of treatment.

[0081] 3) Extraction of cell proteins: conventional method.

[0082] 4) Western Blot detection: conventional method.

[0083] After treatment with TOP1 inhibitor CPT at different concentrations, Western Blot was used to detect changes in TOP1 protein levels and changes in p-TBK1 and p-IRF3 protein levels in the cGAS-STING pathway. Results ( Fig. 9) showed that TOP1 protein expression was significantly inhibited, and γH2AX, p-TBK1, and p-IRF3 expressions were significantly increased, indicating that after TOP1 was inhibited, DNA damage increased and the cGAS-STING pathway was activated.

[0084] 8. QPCR detection of changes in mRNA levels of type I interferon-related genes

[0085] 1) Cell culture: conventional method.

[0086] 2) U87 cells were treated with TOP1 inhibitor CPT at a concentration of 0.1 μM, and cell samples were collected after 24 hours of treatment.

[0087] 3) Extraction of cellular RNA: conventional method.

[0088] 4) QPCR detection: conventional method.

[0089] U87 and U251 cells were treated with TOP1 inhibitor CPT at a concentration of 0.1 μM for 24 h, and then QPCR was used to detect changes in the mRNA levels of type I interferon-related genes (using ACTIN as an internal reference). Fig.10 ) showed that IRF3, IRF7, ISG15, ISG20, and STAT1 increased significantly with statistical differences, indicating that type I interferon-related genes were stimulated and increased after treatment with TOP1 inhibitor CPT, and the inflammatory response was activated.

[0090] Primer name Primer sequence (5'-3') SEQ ID NO IRF3-F AGAGGCTCGTGATGGTCAAG SEQ ID NO.7 IRF3-R AGGTCCACAGTATTCTCCAGG SEQ ID NO.8 IRF7-F GCTGGACGTGACCATCATGTA SEQ ID NO.9 IRF7-R GGGCCGTATAGGAACGTGC SEQ ID NO.10 ISG15-F CGCAGATCACCCAGAAGATCG SEQ ID NO.11 ISG15-R TTCGTCGCATTTGTCCACCA SEQ ID NO.12 ISG20-F CTCGTTGCAGCCTCGTGAA SEQ ID NO.13 ISG20-R CGGGTTCTGTAATCGGTGATCTC SEQ ID NO.14 STAT1-F ATCAGGCTCAGTCGGGGAATA SEQ ID NO.15 STAT1-R TGGTCTCGTGTTCTCTGTTCT SEQ ID NO.16

[0091] In summary, in this example, we explored the biological function of topoisomerase I in glioblastoma by knocking down the TOP1 gene in glioblastoma cell lines U87 and U251. CCK-8 experiments and EdU experiments showed that knocking down TOP1 inhibited the cell activity and proliferation of glioblastoma cells, and using TOP1-specific inhibitors to inhibit TOP1 activity inhibited the proliferation of glioblastoma cells and promoted their apoptosis. At the same time, the use of TOP1-specific inhibitor CPT will lead to increased DNA damage and activate the cGAS-STING pathway, resulting in the activation of IFNI-related genes, promoting inflammatory responses, thereby turning cold tumors into hot tumors to improve the immune response to tumors.

Claims

1. Use of a reagent for detecting the expression of the biomarker TOP1 in the preparation of a product for diagnosing or prognosing a glioblastoma subject.

2. The use according to claim 1, characterized in that: The diagnostic method comprises: obtaining a test sample from a subject suspected of having glioblastoma, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, it indicates that the subject is a glioblastoma patient.

3. The use according to claim 1, characterized in that: The prognosis method comprises: obtaining a test sample from a subject suffering from glioblastoma, determining the expression level of TOP1 in the test sample, and if TOP1 is highly expressed compared with a normal control, it indicates that the subject is a glioblastoma patient.

4. Application of TOP1 as a target in screening drugs for the treatment of glioblastoma.

5. The use according to claim 4, characterized in that: The drug inhibits the expression of TOP1, thereby inhibiting the viability and proliferation of glioblastoma cells, thereby slowing down or preventing the development of glioblastoma.

6. Application of TOP1 expression inhibitors in the preparation of drugs for treating glioblastoma.

7. The use according to claim 6, characterized in that: The expression inhibitor is selected from nucleic acid molecules, protein molecules or small molecule compounds.

8. The use according to claim 7, characterized in that: The nucleic acid molecule includes shRNA, the sense strand sequence of the shRNA is CAGAGTTGGATGGTCAGGAAT, and the antisense strand sequence is ATTCCTGACCATCCAACTCTG.

9. The use according to claim 7, characterized in that: The small molecule compound is selected from Camptothecin or Topotecan.

Images