SYBR Green I fluorescent dye quantitative PCR method for identifying clostridium butyricum

Abstract

The invention discloses an SYBR Green I fluorescent dye quantitative PCR (polymerase chain reaction) method for identifying clostridium butyricum, and belongs to the technical field of molecular detection. The invention provides a primer pair for qPCR (quantitative polymerase chain reaction) identification of clostridium butyricum. The primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 1; 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 2. The identification sensitivity is high, the detection limit is 7.2 * 10 < 2 > CFU / mL, the specificity is strong, and the repeatability is good. Meanwhile, the bacterial genome is obtained by cracking the bacterial liquid with the crude extraction cracking liquid, so that the genome obtaining process is simplified. According to the method, the concentration of the clostridium butyricum liquid in the sample is directly obtained through standard curve conversion, the problems that a clostridium butyricum identification method is complex, long in consumed time, low in efficiency and the like are effectively solved, and a more convenient identification method is provided for related research of clostridium butyricum.

Description

Technical Field

[0001] The invention relates to the technical field of molecular detection, and in particular to a SYBR Green I fluorescent dye quantitative PCR method for identifying Clostridium butyricum. Background Art

[0002] Clostridium butyricum, also known as butyric acid bacteria, is an obligate anaerobic Gram-positive bacillus that is widely distributed in nature. Clostridium butyricum is a probiotic isolated from the intestines of healthy humans and animals. It can produce short-chain fatty acids such as butyric acid and lactic acid. It has biological characteristics such as heat resistance and acid resistance, and can be used as a microecological preparation in animal husbandry. At the same time, Clostridium butyricum can regulate intestinal flora by inhibiting the growth of pathogens and promoting the colonization and proliferation of beneficial bacteria. Not only that, Clostridium butyricum also regulates animal intestinal health by promoting intestinal development, enhancing the body's immunity, and other aspects. It is expected to become an alternative to antibiotics and is widely used in animal husbandry. Therefore, how to efficiently screen and identify to obtain Clostridium butyricum is crucial.

[0003] At present, the screening of Clostridium butyricum mainly relies on the traditional screening method of trypsin sulfite neomycin (TSN) selective medium, that is, after the bacteria are inoculated in the selective medium, the suspected strains of Clostridium butyricum are screened and obtained by observing the colony morphology. Then the conventional PCR method, i.e. 16sDNAPCR, is used to sequence and compare the products to confirm whether they are Clostridium butyricum. However, the above technology has the following defects: although Clostridium butyricum can be screened and identified by selecting the culture medium and 16s DNA sequencing, it is time-consuming, has low accuracy, and has a cumbersome process, and cannot efficiently identify Clostridium butyricum.

[0004] Therefore, establishing a method for identifying Clostridium butyricum is particularly important for improving the screening efficiency and accuracy of Clostridium butyricum and optimizing the identification method of Clostridium butyricum. Summary of the invention

[0005] The purpose of the present invention is to provide a SYBR Green I fluorescent dye quantitative PCR method for identifying Clostridium butyricum to solve the problems existing in the above-mentioned prior art. The fluorescent dye quantitative PCR method provided by the present invention can improve the identification efficiency of Clostridium butyricum, optimize the screening method of Clostridium butyricum, and provide a faster identification method for Clostridium butyricum related research.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: A primer pair for qPCR identification of Clostridium butyricum, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0008] The primer pair is used in preparing a product for detecting Clostridium butyricum, and the product includes a reagent, a test kit, a chip, a test paper, a membrane strip or a detection platform.

[0009] Technical solution 2: A kit for qPCR detection of Clostridium butyricum, comprising the primer pair.

[0010] Furthermore, the kit also includes a positive control substance and a negative control substance.

[0011] Furthermore, the positive control includes genomic DNA of Clostridium butyricum.

[0012] Technical solution three: An application of the kit in identifying Clostridium butyricum.

[0013] Technical solution 4: A method for detecting the concentration of Clostridium butyricum liquid, the method comprising the following steps: using the genome of Clostridium butyricum of the sample to be tested as a template, using the kit to perform qPCR amplification reaction, and collecting fluorescence data; directly obtaining the concentration of Clostridium butyricum liquid in the sample by standard curve conversion. The standard curve equation is: y = -3.152·lgx + 39.745, R 2 =0.999.

[0014] Furthermore, the qPCR amplification reaction system includes: 2 μL of genomic DNA of the sample to be tested, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 10 μL of 2×Fons Super SYBR Grenn qPCR Mix, and 7.2 μL of RNase-Free ddH2O.

[0015] Furthermore, the program of the qPCR amplification reaction is: 95°C for 30s; 95°C for 10s, 60°C for 60s for 40 cycles; the melting curve uses the instrument default program, and the reaction ends.

[0016] The method for obtaining the genome of Clostridium butyricum comprises mixing the crude lysate and the bacterial solution at a ratio of 9:1, treating at 95° C. for 15 minutes, and centrifuging at 12,000 rpm for 2 minutes to obtain the genome of Clostridium butyricum.

[0017] The present invention discloses the following technical effects:

[0018] The present invention provides a SYBR Green I fluorescent dye quantitative method for identifying Clostridium butyricum, wherein a qPCR primer pair is designed based on a Clostridium butyricum specific sequence (Genbank: ENZ35297.1), wherein the primer sequence is: upstream primer: TGGTGCTGCTTATGGATAC (SEQ ID NO.1); downstream primer: CCAACAGGAAGTAATGATAGTC (SEQ ID NO.2). The method uses a crude lysate to treat a bacterial solution of known concentration, and then obtains a series of templates of different concentrations by multiple dilution to construct a Clostridium butyricum standard curve, thereby establishing a direct relationship between the colony count (CFU) of Clostridium butyricum and the CT value.

[0019] The qPCR primer pair designed for the specific sequence of Clostridium butyricum in the present invention has high identification sensitivity and a detection limit of 7.2×10 2 CFU / mL, and has strong specificity and good repeatability. At the same time, the present invention uses crude lysate to process bacterial solution of known concentration to directly obtain DNA template, simplifies the step of obtaining DNA template through the kit, omits the process of constructing plasmid to obtain standard products, and directly establishes the relationship between CFU and CT value of Clostridium butyricum, that is, the concentration of Clostridium butyricum bacterial solution in the sample can be directly obtained by standard curve conversion, rather than the indirect relationship between copy number and CT value. The present invention effectively solves the problems of complex, time-consuming and low efficiency of Clostridium butyricum identification method, and provides a more convenient identification method for Clostridium butyricum related research. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 It is the morphology of Clostridium butyricum;

[0022] Figure 2 is the amplification curve of SYBR Green I fluorescent dye qPCR method;

[0023] Figure 3 It is the melting curve of SYBR Green I fluorescent dye qPCR method;

[0024] Figure 4 This is the standard curve of the SYBR Green I fluorescent dye qPCR method;

[0025] Figure 5The results of the sensitivity test; M: 2000bp marker; 1-8: bacterial solution concentrations are 2.25×10 6 4.50×10 5 9.00×10 4 , 1.80×10 4 3.60×10 3 ,7.20×10 2 , 1.44×10 2 , 2.88×10 1 CFU / mL; 9: negative control. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1

[0032] (I) Establishment of SYBR Green I fluorescent dye qPCR method for Clostridium butyricum

[0033] 1. Strain: Clostridium butyricum (CICC 10390).

[0034] 2. Methods

[0035] 2.1 Primer design

[0036] According to the Clostridium butyricum specific sequence (Genbank: ENZ35297.1), the Clostridium butyricum qPCR specific primer sequence was designed using Primer Premier 6. The primers were synthesized by Wuhan Tianyi Huayu Company, and the sequences are shown in Table 1.

[0037] Table 1 Primer sequences for fluorescence quantitative PCR

[0038]

[0039] 2.2 Determination of bacterial liquid concentration

[0040] (1) Recovery: Take 50 μL of the standard Clostridium butyricum bacterial solution and add it to 5 mL of reinforced Clostridium medium (RCM broth) and culture it anaerobically at 37°C for 24 h;

[0041] (2) Dip the inoculation loop into the bacterial solution and streak it onto Columbia blood agar plate. Incubate anaerobically at 37°C for 36 to 48 hours.

[0042] (3) Pick a single colony and place it in 5 mL RCM broth. After anaerobic culture at 37°C for about 10 h, take 100 μL of the bacterial solution and dilute it by gradient 10 4 ~10 6 times, spread on Columbia blood agar plates, incubate anaerobically at 37°C for 36-48h, and count the colonies on the plates.

[0043] 2.3 Bacterial DNA extraction method

[0044] The DNA template was obtained using the crude lysate. The specific method is as follows: 90 μL of the crude lysate was added to 10 μL of the bacterial solution used for plate counting, treated at 95°C for 15 min, centrifuged at 12,000 rpm for 2 min, and the supernatant was vortexed as a DNA template (the template has been diluted 10 times at this time). The prepared template should be used immediately after preparation.

[0045] 2.4 Establishment of SYBR Green I fluorescent dye qPCR standard curve

[0046] The template was diluted 5 times with RNase-Free ddH2O to prepare standard templates of different concentrations. The upstream primer (Primer F) SEQ ID NO.1 and the downstream primer (Primer R) SEQ ID NO.2 were used for amplification, and the SYBR Green I fluorescent dye qPCR amplification was performed according to the recommended reaction conditions (Table 2) and reaction system (Table 3) of 2×FonsSuper SYBR Grenn qPCRMix (With ROX), and the amplification curve, melting curve and standard curve were analyzed and drawn using GraphPad Prism 9.0.

[0047] Table 2SYBR Green I fluorescent dye qPCR amplification reaction system

[0048]

[0049] Table 3SYBR Green I fluorescent dye qPCR amplification reaction conditions

[0050]

[0051] 2.5SYBR Green I fluorescent dye qPCR sensitivity test

[0052] SYBRGreen I fluorescent dye qPCR amplification was performed using the above standard templates of different concentrations as templates and RNase-Free ddH2O as negative control. At the same time, conventional PCR amplification was performed using the same fluorescent quantitative primer pair to determine and compare the sensitivity of the two methods. The conventional PCR system and procedure are shown in Tables 4 and 5.

[0053] Table 4 Conventional PCR amplification system

[0054]

[0055] Table 5 Conventional PCR amplification procedures

[0056]

[0057] 2.6SYBR Green I fluorescent dye qPCR specificity test

[0058] The specificity of the SYBR Green I fluorescent dye qPCR method established in the present invention was evaluated using the various bacterial strains in Table 6. DNA of each strain was obtained using the method in 2.3 and used as a template for specificity verification of the SYBR Green I fluorescent dye qPCR method for Clostridium butyricum.

[0059] Table 6 Strain information related to specificity test

[0060]

[0061] 2.7SYBR Green I fluorescent dye qPCR repeatability test

[0062] The SYBR Green I fluorescent dye qPCR standard curve for Clostridium butyricum was established, and after completing the sensitivity and specificity tests, the repeatability test was performed. 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL bacterial liquid genome template was used for detection, RNase-Free water was used as negative control, and three batches of repeated tests were performed, each batch of repeated tests was repeated three times, that is, 3 inter-group tests and 3 intra-group tests, and the coefficient of variation (CV) was calculated by the formula. Coefficient of variation (CV%) = standard deviation (SD) / mean value (MN) × 100%.

[0063] 3 Experimental results

[0064] 3.1 Determination of bacterial liquid concentration

[0065] In order to establish a direct relationship between the CFU and CT value of Clostridium butyricum, the concentration of Clostridium butyricum solution must be determined first, that is, the bacterial solution in the logarithmic growth period is diluted at a certain ratio and then plated for counting. At the same time, a small amount of bacterial solution is retained and stored at -20°C for extracting DNA templates and establishing a standard curve. The results showed that when Clostridium butyricum was cultured for about 10 hours, that is, when it just started to produce gas vigorously, the concentration of Clostridium butyricum solution was about 2.25×10 7 CFU / mL.

[0066] 3.2 Establishment of SYBR Green I fluorescent dye qPCR standard curve

[0067] The DNA template was extracted from the bacterial solution of known concentration, and then diluted 5 times with RNase-Free ddH2O to prepare a gradient standard template. SYBR Green I fluorescent dye quantitative PCR amplification was performed, and the amplification curve was drawn by GraphPad Prism 9.0 software analysis ( Figure 2 )、Melting curve( Figure 3 ) and standard curve ( Figure 4 ). The results showed that the concentration of bacterial solution was 2.25×10 7 ~7.20×10 2 In the gradient range of CFU / mL, the qPCR amplification results showed a good linear relationship. The linear relationship equation between the obtained colony count CFU (x) and the CT value (y), that is, the standard curve equation, is: y = -3.152·lgx + 39.745, R2 =0.999.

[0068] 3.3SYBR Green I fluorescent dye qPCR sensitivity test

[0069] The serial dilutions of the standard template were subjected to SYBR Green I fluorescent dye quantitative PCR amplification and conventional PCR amplification, and their sensitivity was compared and analyzed. The results showed that the detection limit of the qPCR method was 7.20×10 2 CFU / mL. Conventional PCR method ( Figure 5 ) The detection limit was 3.60×10 3 CFU / mL, but when the bacterial concentration is lower than 1.80×10 4 CFU / mL, the band becomes dark and blurred. The above results show that the sensitivity of the SYBR Green I fluorescent dye qPCR detection method provided by the present invention is better than that of conventional PCR.

[0070] 3.4SYBR Green I fluorescent dye qPCR specificity test

[0071] The bacterial DNA templates in Table 6 were obtained by reference to method 2.3, and amplified by the SYBR Green I fluorescent dye qPCR method established by the present invention. The results showed that Clostridium butyricum (Clinical Clostridium butyricum 1 and Clinical Clostridium butyricum 2) showed good amplification curves and melting curves, while other bacteria such as Clostridium perfringens, Clostridium difficile, Akkermansia muciniphila, Lactobacillus johnsonii, Lactobacillus murinus, Enterococcus, Staphylococcus aureus, Salmonella, Escherichia coli, etc. No fluorescence values ​​were detected. The above results show that the SYBR Green I fluorescent dye qPCR method established by the present invention has good specificity.

[0072] 3.5SYBR Green I fluorescent dye qPCR repeatability test

[0073] The concentration of Clostridium butyricum was 1.0×10 6 CFU / mL, 1.0×10 5 CFU / mL, 1.0×10 4 CFU / mL DNA template was used for 3 intra-group tests and 3 inter-group tests (Table 7). The results showed that the CT values ​​of the intra-group and inter-group repeats were relatively consistent, and the intra-group and inter-group coefficients of variation were both lower than 2%. Therefore, the method established by the present invention has good repeatability.

[0074] Table 7 SYBR Green I fluorescent dye qPCR repeatability test

[0075]

[0076] In summary, the method for preparing the standard sample template from the crude lysate used in the present invention can effectively establish a direct relationship between the colony count CFU and the CT value, which is convenient for directly obtaining the bacterial solution concentration. The SYBR Green I fluorescent dye qPCR method established in the present invention has high sensitivity and a detection limit of 7.20×10 2 CFU / mL; strong specificity, can effectively distinguish Clostridium butyricum from other bacteria; excellent repeatability performance and other advantages.

[0077] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer pair for qPCR identification of Clostridium butyricum, characterized in that: The primer pair includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. A kit for qPCR detection of Clostridium butyricum, characterized in that: Comprising the primer pair described in claim 1.

3. The kit according to claim 2, characterized in that The kit also includes a positive control substance and a negative control substance.

4. The kit according to claim 3, characterized in that The positive control includes genomic DNA of Clostridium butyricum.

5. Use of the primer pair according to claim 1 or the kit according to any one of claims 2 to 4 in identifying Clostridium butyricum.

6. A method for detecting the concentration of Clostridium butyricum liquid, characterized in that: The method comprises the following steps: using the genome of the sample Clostridium butyricum to be tested as a template, performing a qPCR amplification reaction using the kit described in any one of claims 2 to 4, and collecting fluorescence data; and directly obtaining the concentration of the Clostridium butyricum liquid in the sample by converting the standard curve.

7. The method according to claim 6, characterized in that The qPCR amplification reaction system includes: 2 μL of genomic DNA of the sample to be tested, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 10 μL of 2×Fons Super SYBR Grenn qPCR Mix, and 7.2 μL of RNase-Free ddH2O.

8. The method according to claim 6, characterized in that The program of the qPCR amplification reaction is: 95°C for 30s; 95°C for 10s, 60°C for 60s, 40 cycles; the reaction ends.

9. The method according to claim 6, characterized in that The method for obtaining the genome of Clostridium butyricum comprises mixing the crude lysate and the bacterial solution at a ratio of 9:1, treating at 95° C. for 15 minutes, and centrifuging at 12,000 rpm for 2 minutes to obtain the genome of Clostridium butyricum.

Images