Two polypogon fugax herbicide-resistant genes and application thereof

Abstract

The invention discloses two polypogon fugax herbicide-resistant genes and application thereof, and belongs to the technical field of herbicide-resistant genes. The invention discloses CDS sequences of PfGSTup and PfGSTl1 genes of polypogon fugax for the first time, the CDS sequence of the PfGSTup gene is as shown in SEQ ID NO. 1, and the CDS sequence of the PfGSTl1 gene is as shown in SEQ ID NO. 4; it is found for the first time that transgenic escherichia coli can obtain mesosulfuron-methyl resistance by expressing PfGSTup and PfGSTl1 genes in escherichia coli, and two new mesosulfuron-methyl resistance GST family candidate genes derived from polypogon fugax are provided; the provided PfGSTup and PfGSTl1 genes can be used for culturing ALS inhibitor herbicide-resistant wheat varieties, and two candidate genes are provided for researching the ALS inhibitor herbicide-resistant mechanism of the polypogon fugax, detecting the resistance of the polypogon fugax and determining the medication period and the dosage.

Description

Technical Field

[0001] The invention relates to the technical field of herbicide resistance genes, in particular to two herbicide resistance genes of Corydalis truncatula and applications thereof. Background Art

[0002] Weed resistance refers to the situation where a certain dose of herbicide could be used to effectively control weeds in the past, but now the same or higher doses of the same herbicide are used and the weeds can still survive and reproduce. The continuous evolution of weed resistance to herbicides is affected by many factors, such as herbicide type, weed type, pollination method, etc. According to statistics from the Global Resistant Weed Network (www.weedscience.org), as of November 2024, 273 weed species have been found worldwide to be resistant to 168 herbicides with 21 different mechanisms of action. Among them, the most serious problem is the resistance of weeds to acetolactate synthase (ALS, EC 4.1.3.18) inhibitor herbicides, and 175 weed species have developed resistance to ALS inhibitor herbicides.

[0003] Acetolactate synthase, also known as ALS (Acetolactate synthase) or AHAS (Acetohydroxyacid synthase), is a crucial enzyme in the biosynthetic pathway of branched-chain amino acids. ALS is a key enzyme in the first-stage biochemical reaction of the synthesis of branched-chain amino acids isoleucine, leucine and valine, which are essential for plant life activities. ALS inhibitor herbicides bind to the channel where the substrate enters the catalytic reaction center, and inhibit the synthesis of branched-chain amino acids by blocking the substrate from reaching the enzyme reaction center, resulting in the obstruction of the synthesis of related proteins, and ultimately interfering with the normal mitosis of plant cells, and then the plant stops growing and eventually dies. ALS inhibitor herbicides have a wide spectrum of weed control, strong crop selectivity, low toxicity to mammals, and are environmentally friendly, so they are widely used worldwide. Mesosulfuron is a widely used ALS inhibitor herbicide. This herbicide is more effective in controlling grass weeds.

[0004] Polypogon fugax is an annual overwintering weed in the genus Polypogon in the Poaceae family. It has a wide range of adaptability and is easy to form dominant species in the growing environment. Its growth cycle coincides with summer crops such as wheat and rapeseed. It is one of the main harmful weeds in the fields of summer crops such as wheat and rapeseed. In order to pursue better control effects, farmers blindly increase the amount of herbicides (repeatedly use the same type of herbicides). Polypogon fugax has evolved different degrees of resistance to many different types of herbicides. In recent years, its harm has become more serious year by year. Mining the functional genes of polypogon fugax resistance can clarify the resistance mechanism of polypogon fugax to mesosulfuron, provide a theoretical basis for scientific and rational guidance of chemical control of resistant polypogon fugax, and provide potential gene resources for genetic breeding of transgenic crops. In addition, the molecular interaction analysis between the detoxification protein encoded by the resistance gene and the herbicide has reference value for the structural optimization of herbicides and the design of new herbicides. Summary of the invention

[0005] The purpose of the present invention is to provide two herbicide-resistant genes for Coptis chinensis and their applications, so as to provide two herbicide-resistant genes, provide candidate genes for studying the mechanism of Coptis chinensis' resistance to methyl disulfiram and breeding of herbicide-resistant wheat varieties, and contribute to the effective prevention and control of Coptis chinensis, the sustainable development of agriculture and food security.

[0006] To achieve the above object, the present invention provides two G. foetida herbicide-resistant genes. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4.

[0007] As mentioned above, the two herbicide-resistant genes of G. chinensis play a role in the resistance to mesosulfuron-methyl. The expression of PfGSTup and PfGSTl1 genes improves the resistance to mesosulfuron-methyl.

[0008] The two herbicide-resistant genes of E. corytatum as mentioned above are used to detect the resistance of E. corytatum to mesosulfuron-methyl.

[0009] The above-mentioned two genes for herbicide resistance of sedge are used in the selection and dosage investigation of sedge herbicides. The application is to detect whether sedge is suitable for control by mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl for control.

[0010] The above-mentioned two genes for tolerance to herbicides of Echinops chinensis are used in the breeding of wheat herbicide-resistant varieties, wherein the herbicide is an ALS inhibitor herbicide.

[0011] Preferably, the herbicide is mesosulfuron-methyl.

[0012] Therefore, the two Herbicide-tolerant genes of Codonopsis pilosula and their applications provided by the present invention have the following specific technical effects:

[0013] (1) The present invention discloses for the first time the CDS sequences of PfGSTup and PfGSTl1 genes of Echinops chinensis. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1 and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4. Both PfGSTup and PfGSTl1 genes belong to the GST family.

[0014] (2) The present invention first discovered that expressing PfGSTup and PfGSTl1 genes in Escherichia coli can make transgenic Escherichia coli acquire resistance to mesosulfuron, and provided two new mesosulfuron-resistant GST family candidate genes from Codonopsis pilosula;

[0015] (3) Molecular docking analysis of PfGSTup and PfGSTl1 genes with mesosulfuron showed that both PfGSTup and PfGSTl1 genes have high binding capacity with mesosulfuron and can conjugate reduced glutathione with oxidized herbicide molecules, thus promoting detoxification metabolism to a certain extent.

[0016] (4) The PfGSTup and PfGSTl1 genes provided by the present invention can be used for breeding wheat varieties resistant to ALS inhibitor herbicides, and provide two candidate genes for studying the mechanism of resistance of Rhizoma Coptidis to ALS inhibitor herbicides, detecting resistance of Rhizoma Coptidis, and determining the application period and dosage. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0018] Figure 1 It is the electrophoresis gel image of the PCR products of cloning the PfGSTup gene in Example 1 and cloning the PfGSTl1 gene in Example 2 of the present invention;

[0019] Figure 2 is the NCBI online BLAST comparison analysis result of the amplified sequence in Example 3 of the present invention;

[0020] Figure 3It is the result of comparing the PfGSTup gene clone sequence with the Unigene obtained from the transcriptome sequencing data of Herba Corydalis using UGENE 50.0 in Example 3 of the present invention; wherein TRINITY_DN32199_c0_g1_i3_2_PfGSTup\revcompl is the reverse complementary sequence of the Unigene obtained from the transcriptome sequencing of Herba Corydalis, and PfGSTup_Clone and PfGSTup_Expression are the constructed cloning vector sequence and expression vector sequence, respectively;

[0021] Figure 4 It is the result of comparing the protein coding sequence of the PfGSTup gene with the Unigene protein coding sequence obtained from the transcriptome sequencing data of the Herba Codonopsis pilosa L. using UGENE 50.0 in Example 3 of the present invention; wherein TRINITY_DN32199_c0_g1_i3_2_PfGSTup is the Unigene protein coding sequence obtained from the transcriptome sequencing of the Herba Codonopsis pilosa L., and PfGSTup_Clone and PfGSTup_Expression are the protein sequences encoded by the target gene inserted into the constructed cloning vector and expression vector, respectively;

[0022] Figure 5 is the NCBI online BLAST comparison analysis result of the amplified sequence in Example 4 of the present invention;

[0023] Figure 6 It is the result of comparing the PfGSTl1 gene clone sequence with the Unigene obtained from the transcriptome sequencing data of the Herba Cynoglossi in Example 4 of the present invention using UGENE 50.0; wherein TRINITY_DN42636_c0_g1_i1_3_PfGSTl1\revcompl is the reverse complementary sequence of the Unigene obtained from the transcriptome sequencing of the Herba Cynoglossi, and PfGSTl1_Clone and PfGSTl1_Expression are the constructed cloning vector sequence and expression vector sequence, respectively;

[0024] Figure 7 It is the result of comparing the protein coding sequence of the PfGSTl1 gene with the Unigene protein coding sequence obtained by the transcriptome sequencing data of the Herba Codonopsis pilosa L. using UGENE 50.0 in Example 4 of the present invention; wherein TRINITY_DN42636_c0_g1_i1_3_PfGSTl1 is the Unigene protein coding sequence obtained by the transcriptome sequencing of the Herba Codonopsis pilosa L., and PfGSTl1_Clone and PfGSTl1_Expression are the protein sequences encoded by the target gene inserted into the constructed cloning vector and the expression vector, respectively;

[0025] Figure 8This is a bacterial colony photo in Example 7 of the present invention;

[0026] Fig. 9 is the colony count result in Example 7 of the present invention;

[0027] Fig.10 It is the molecular docking result of methyl disulfone and PfGSTup in Example 9 of the present invention; wherein A is the combination of PfGSTup protein structure with methyl disulfone and reduced glutathione (GSH), the yellow compound is methyl disulfone, and the green is reduced glutathione; B is the binding site, amino acid and hydrogen bond length of methyl disulfone and PfGSTup; C is the binding site, amino acid and hydrogen bond length of reduced glutathione and PfGSTup;

[0028] Fig.11 It is the result of molecular docking of methyl disulfone and PfGSTl1 in Example 9 of the present invention; wherein A is the combination of PfGSTl1 protein structure with methyl disulfone and reduced glutathione, the red compound is methyl disulfone, and the yellow is reduced glutathione; B is the binding site, amino acid and hydrogen bond length of methyl disulfone and PfGSTl1; C is the binding site, amino acid and hydrogen bond length of reduced glutathione and PfGSTl1. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0030] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0031] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources; the experimental steps not described in detail are conventional methods in the art.

[0032] Embodiment 1

[0033] The specific steps for cloning the PfGSTup gene of Echinops chinensis are as follows:

[0034] S11. The full-length CDS of the PfGSTup gene sequence was obtained by transcriptome sequencing. The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1. Specific primers for amplifying the full-length PfGSTup gene were designed. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3. The primer sequence information was sent to Shanghai Bioengineering Co., Ltd. to synthesize primers.

[0035] SEQ ID NO.1:

[0036] ATGGCCGGAGGAGAAAACAAGGAAGTGAAGGTGCTGGGCATGTGGGCGAGCCCGTTCGTCCTGCGAGTGCGGCTTGCGCTCAGCCTCAAGGGCATCAGCTACGAGTACGTCGAGGAGGACCTCAAGAGCAAGAGCGAGCTGCTCCTGACATCCAACCCCGTGCACAAGGCGGTGCC TGTGCTGCTCCACGACGGCAAGTCCGTCTGCGAGTCGTCGGTCATCCTGCAATACATAGACGAGGCCTTCACCGGCGTGGGGCCCCTCTCTCCTCCCGGAGGATCCCCATGACCGCGCCAATGCTCGTTTCTGGGCCGCTTACATTGACGACAAGCTGGTGAAAGCGTCGAACCAGG CGTCGAGGGGCAAGACGGAGGAGGAGAAGGAGGAGGGAAAGAAGCAGGCAGCCGCCGCGGTGGAAACCCTGGAGGGAGCCCTGAAGGAGTGCTCCAAGGGGAAACATTCTTCGGTGGCGACAGTGCCGGCTACGTGGACGTCGTTCTCGGCGGCTCCTCGCATGGGTTCACGCG GGCGACGCGATGAAGGGCGTCAAGACCTTCGACCCCGCCACGACTCCGCTCTTGGCCGCGTGGGCGGACAGCTTCGACGCGTTGGACGCGGTCGAGGCTGTCATGCCGGACGTCGGTAAGCTAGTTGAGTTTGCCATGGCGATGCATGCTCGCGCCGCCGCCACCGCAACGAACTAG

[0037] SEQ ID NO.2:ATGGCCGGAGGAGAAAACA

[0038] SEQ ID NO.3:CTAGTTCGTTGCGGTGGCG

[0039] S12. Select uniform and full seeds of the resistant population of JS-13 of the grass, soak them in warm water at 30-40℃ for 12 hours, then transfer them to a 9cm culture dish with a double-layer filter paper as the bottom, add appropriate deionized water to the culture dish to keep the filter paper moist, and transfer the culture dish to a light incubator for germination. The culture conditions of the light incubator are set as follows: 25 / 20℃ (day / night), with light and dark alternating for 12 hours. When the seeds germinate to about 0.5cm, select the germinated seeds with consistent growth and place them in a plastic culture pot with a diameter of 12cm. The soil used for plant culture is soil with no history of herbicide application in the farm of the teaching experimental base of Shandong Agricultural University. The sowing amount is 10 plants / pot. When the seedlings grow to the 2-leaf stage, retain 5 plants with uniform growth in each pot.

[0040] use The total RNA of the leaves of the Herba Cynoglossi was extracted using the Plant Total RNA Isolation Mini Kit. 1 μL of the Herba Cynoglossi total RNA extraction sample was placed in an ultra-micro spectrophotometer to measure its OD 260 and OD 280 ratio; take 2 μL of total RNA extraction sample of Codonopsis pilosula and mix it with 2 μL 10x DNA loading buffer, add ddH2O to make up to 20 μL, and detect the integrity of RNA extracted from Codonopsis pilosula by agarose gel electrophoresis.

[0041] According to the instructions of the All-in-One First-Strand Synthesis MasterMix Kit, the obtained RNA of good quality was reverse transcribed into cDNA: 1 μg of total RNA was used as template, Oligo(dT) 20 VN was used as primer to prepare the reaction system, incubate at 37℃ for 2min, then at 55℃ for 5min. After the reaction, the obtained cDNA was quickly placed on ice and stored at -20℃ for later use.

[0042] S13, using the obtained cDNA as a template and the primers synthesized in step S11 as primers, Max Super-Fidelity DNA Polymerase was used to amplify the full length of the gene. The total volume of the amplification reaction system was 50 μL, including: 25 μL 2× Phanta Max Master Mix (Dye Plus), 2 μL upstream primer (10 μmol·L -1 ), 2 μL downstream primer (10 μmol·L -1), 4 μL template DNA, 17 μL ddH2O. The PCR reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 65°C annealing for 15 s, 72°C extension for 30 s, a total of 34 cycles; 72°C final extension for 5 min.

[0043] S14. After the PCR reaction is completed, the amplified product is detected by 1% agarose gel electrophoresis and observed in a UV gel imaging system. The results are as follows: Figure 1 As shown, the 705 bp band was cut out and purified using a gel recovery kit. The purified target fragment was quantified using an ultra-micro spectrophotometer (NanoDrop One) for the construction of a cloning vector.

[0044] Embodiment 2

[0045] The specific steps for cloning the PfGSTl1 gene of Codonopsis pilosa are exactly the same as those in Example 1, except that the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.4, the upstream sequence of the specific primer for amplifying the full length of the PfGSTl1 gene is shown in SEQ ID NO.5, and the downstream sequence is shown in SEQ ID NO.6. The electrophoresis results of the PCR products are shown in Figure 1 As shown, the fragment size is 744 bp.

[0046] SEQ ID NO.4:

[0047] ATGGCCGCCGCCGCCACAGCAGCAGCTCCAGCCAGGAGCTTCACGAAAGA

[0048] AGTGCTCCCGCCTGCACTGTGCGCCGTCTCCGAGCCCCCTCCCCTTCGA

[0049] TGGCACCACCAGGCTGTATATTTGCTACTTCTGCCCCTTTGCTCAGCGCGCT

[0050] TGGGTTACCCGGAACTGCAAGGGTTTGCAGGACGAGATCAAGCTAGTCGC

[0051] CATTAATCTGGAGGACAAACCAGCTTGGTACAAGGAGAAGGTTTACCCAC

[0052] GGGGCACGGTGCCTTCCCTGGAGCACGACGGCAAGGTCGTCGGAGAGAG

[0053] CCTGGATTTGATCAAATACATCGACACCAATTTCCAGGGCCCGGCGCTGCTT

[0054] CCTCAAGACCCTGCTAAGAGGCAGTTTGCTGACGAGCTGATTGCGTACGCT

[0055] GACGCCTTTAAAAAAGCACTCTACGCGCCCTTGATCTCCAAAGTAGTCATG

[0056] TCAGATGAGGCTGTTGCTGCTTTAGACAAGATCGAAGCTGCCCTGTCCAAG

[0057] TTCAGTGACGGCCCCTTCTTCCTTGGCCAGCTTAGTTTGGCTGATATTGCGT

[0058] ACGTCACCATCGTGGAGAGGGTTCAGATATACTATTCCCACGTGAGGAGCT

[0059] ACGAGATCACCAAAGGCAGGCCCAACCTTGAGAAATTCATCGAGGAGATG

[0060] AACAAGATTGAAGCATACAAGCAAACCAAAAACCAACCGCTCATCTTGCT

[0061] TGATGTTGCGAAGAGGCATCTCAAGATTGCTTGA

[0062] SEQ ID NO.5:ATGGCCGCCGCCGCCACAGCA

[0063] SEQ ID NO.6:TCAAGCAATCTTGAGATGCCCTTCTCGC

[0064] Embodiment 3

[0065] The recombinant cloning vector containing the PfGSTup gene of Echinops chinensis was constructed, and the specific steps were as follows:

[0066] S31. Connect the purified product recovered in Example 1 to the cloning vector TA / Blunt-Zero using the TA / Blunt-Zero Cloning Kit. The connection reaction system is: 1 μL 5×TA / Blunt-Zero Cloning Mix, 2 μL target gene purification product, 2 μL ddH2O. Connection reaction conditions: 25°C for 5 min. After the reaction is completed, place the centrifuge tube on ice for later use.

[0067] S32, take DH5α competent cells and place them on ice to melt, when the bacteria are in the state of ice-water mixture, add 10 μL of the ligation product obtained in step S31, and stir the bottom of the centrifuge tube by hand to mix it, and let it stand on ice for 25 minutes; heat shock in a 42°C water bath for 45 seconds, quickly place it on ice and let it stand for 2 minutes; add 700 μL of LB sterile culture medium without antibiotics, mix it, and shake the bacteria at 37°C and 200 rpm for 60 minutes; centrifuge the bacterial solution at 5000 rpm for 1 minute after the incubation, discard 900 μL of the supernatant, gently blow the remaining bacterial solution to resuspend it, and apply it to a 50 mg·L -1 Place the plate on a sterile LB solid medium plate containing ampicillin, invert it and place it in a 37°C incubator for overnight culture.

[0068] After plaques grow on the plate, single colonies are picked for PCR verification. The PCR primers, reaction system, and amplification conditions are the same as those in step S13 of Example 1. The positive clones that pass the verification are inoculated into a plate containing 50 mg·L -1 The cells were cultured in LB sterile liquid medium containing ampicillin; 1 mL of overnight culture solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequencing results were compared and analyzed using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blast home). The results are shown in the figure. Figure 2 As shown in the figure, the sequence alignment analysis with the NCBI database showed that the cloned gene had a similarity of 85.04% with GSTU6 of wheat. The Unigene alignment analysis of the cloned sequence with the transcriptome sequencing data of Corydalis chinensis using UGENE 50.0 revealed that there was a single base mutation in the cloned sequence, resulting in the mutation of leucine at position 11 to valine ( Figure 3 , Figure 4 ). This indicates that the GST gene of P. sphaerocephala was successfully cloned and annotated as PfGSTup. The positive bacterial solution confirmed by sequencing was saved for the construction of expression vector.

[0069] Embodiment 4

[0070] The recombinant cloning vector of the PfGSTl1 gene of the Herba Eupatorii was constructed in the same manner as in Example 3, except that the CDS sequence of the PfGSTl1 gene was shown in SEQ ID NO.4, the upstream sequence of the specific primer for amplifying the full length of the PfGSTl1 gene was shown in SEQ ID NO.5, and the downstream sequence was shown in SEQ ID NO.6. The sequence alignment analysis results with the NCBI database showed that the cloned gene had a similarity of 85.04% with GSTU6 of wheat ( Figure 5 ), and sequence alignment analysis using UGENE 50.0 revealed that the cloned sequence was completely consistent with the CDS region of the Unigene sequence obtained from the transcriptome sequencing data of C. Figure 6 , Figure 7 ). This indicated that the GST gene of P. sphaerocephala was successfully cloned and annotated as PfGSTl1. The positive bacterial solution confirmed by sequencing was saved for the construction of expression vector.

[0071] Embodiment 5

[0072] Recombinant expression vectors containing the PfGSTup and PfGSTl1 genes of the Herba Codonopsis pilosa L. were constructed respectively, and the specific steps are as follows:

[0073] S51, using the bacterial solutions sequenced correctly in Example 3 and Example 4 as templates, respectively, MaxSuper-Fidelity DNA Polymerase was used to amplify the full length of PfGSTup and PfGSTl1 genes, and the reaction system and amplification conditions were the same as those in step S13 of Example 1. The PCR product was subjected to agarose gel electrophoresis, and then the target fragment was recovered using a gel recovery kit and quantified using an ultra-micro spectrophotometer (NanoDrop One).

[0074] S52. Use the recovered product of the target gene to construct the expression vector according to the instructions of the pEASY-Blunt E1 ExpressionKit kit. The reaction system is: 1μL PCR product, 1μL pEASY-Blunt E1 ExpressionVector, 3μL ddH2O. The blank control group is the EControl Template included in the kit. Mix gently and react at 25℃ for 10 minutes. After the reaction is completed, place the centrifuge tube on ice.

[0075] Embodiment 6

[0076] The ligation products obtained in Example 5 were transformed into Escherichia coli BL21 (DE3) respectively, and the specific steps were as follows:

[0077] Take 2 tubes of Escherichia coli BL21 (DE3) competent cells and place them on ice to melt. When the bacteria are in an ice-water mixture state, add 5 μL of the recombinant expression vectors of the PfGSTup and PfGSTl1 genes successfully constructed in Example 5, and stir the bottom of the centrifuge tube by hand to mix it, and let it stand on ice for 25 minutes; bathe in a 42°C water bath for 90 seconds, quickly put it back on ice and let it stand for 2 minutes; add 700 μL of LB sterile culture medium without antibiotics to the centrifuge tube, mix it, and resuscitate it at 37°C, 200rpm for 60 minutes; centrifuge the bacterial solution at 5000rpm for 1 minute after the incubation, discard 900 μL of the supernatant, gently blow the remaining bacterial solution to resuspend it, and apply it to a 50 mg·L -1 Place the plate on a sterile LB solid medium containing ampicillin and invert it in a 37°C incubator for overnight culture. After plaques grow on the plate, pick a single colony for PCR verification. Inoculate the positive clones that have passed the verification into a plate containing 50 mg·L -1 The cells were cultured in LB sterile liquid medium containing ampicillin; 1 mL of overnight cultured bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing verification, and the sequencing results were analyzed by UGENE 50.0 software. The results showed that the transformation was successful.

[0078] Embodiment 7

[0079] The sensitivity of Escherichia coli BL21 transferred with PfGSTup gene and PfGSTl1 gene in Example 6 to mesosulfuron was investigated, and the specific steps were as follows:

[0080] S71. Accurately weigh 106 mg of methyl disulfone, dissolve it in 10 mL of acetone, and add it to chromatographic grade acetonitrile to make a 1000 mg / L -1 The mother liquor was diluted with acetonitrile to the required concentration.

[0081] S72. Inoculate the BL21 single colonies transformed with the PfGSTup gene and PfGSTl1 gene into 20 mL of LB medium containing ampicillin (final concentration of 50 mg / mL) and culture at 37°C with shaking overnight. 600 =0.6, centrifuge at 5000g for 1min, discard the supernatant, and resuspend the bacterial blocks in 1mL LB medium without antibiotics. Take 1μL of bacterial droplets and drop them in LB solid medium containing 50mg / mL ampicillin antibiotics, 1mM IPTG and 0, 0.05, 0.5, 5, 50, 500μM methyl disulfone at final concentrations. After culturing at 37℃ for 24h, analyze the growth of E. coli BL21 and take pictures. E. coli BL21 with empty vector was used as control. The results are as follows Figure 8 shown.

[0082] S73, take 50 μL of bacterial solution and spread it on LB solid medium containing 50 mg / mL ampicillin antibiotic, 1 mM IPTG and methyl disulfone standard solution, shake culture at 37℃ for 24 hours, and count the number of colonies. Fig. 9 shown.

[0083] Depend on Figure 8 It can be seen that under the condition of metsulfuron stress, the blank vector E. coli BL21 grew slowly, and the BL21 transformed with PfGSTl1 and PfGSTup was inhibited under high concentration of metsulfuron but still grew normally, indicating that the expression of the target genes PfGSTl1 and PfGSTup enhanced the resistance of E. coli BL21 to metsulfuron. The above results show that overexpression of PfGSTl1 and PfGSTup can confer metsulfuron resistance to E. coli.

[0084] Depend on Fig. 9 It can be seen that in the group without methyldisulfuron treatment, there was no significant difference in the growth of the empty vector and PfGSTup, PfGSTl1 recombinant E. coli. However, in the methyldisulfuron treatment group, the colony number of BL21 transformed with the empty vector was significantly inhibited compared with PfGSTup and PfGSTl1, and decreased with the increase of methyldisulfuron concentration: when the concentration of methyldisulfuron was 0.5μM, the colony number of BL21 transformed with the empty vector decreased by 79.8%; when the concentration of methyldisulfuron was 50μM, the BL21 transformed with the empty vector could no longer grow normally on the culture medium. For PfGSTup and PfGSTl1, the colony number of BL21 transformed with BL21 also decreased with the increase of methyldisulfuron concentration. When the concentration of methyldisulfuron was 500μM, the colony number of PfGSTup and PfGSTl1 decreased by 94.59% and 87.60% respectively compared with 0.05μM methyldisulfuron.

[0085] Embodiment 8

[0086] The physical and chemical properties of PfGSTup and PfGSTl1 genes were analyzed as follows:

[0087] Expasy ProtParam was used to calculate the physicochemical parameters of PfGSTup and PfGSTl1, and the results are shown in Table 1.

[0088] Table 1

[0089]

[0090] The results showed that the predicted molecular weight of PfGSTup was 24.99 kDa; the theoretical isoelectric point was 5.11, indicating that it might be an acidic protein; the extinction coefficient at 280 nm was 59025 M -1 cm-1 , indicating that it can be analyzed by ultraviolet spectroscopy; the instability index is 33.97, indicating that it is a stable protein; the fat-soluble index is 88.89, indicating that it has high thermal stability; the overall average hydrophilicity is -0.064, indicating that it is a hydrophobic protein.

[0091] The predicted molecular weight of PfGSTl1 is 27.59 kDa; the theoretical isoelectric point is 7.60, indicating that it may be a basic protein; the extinction coefficient at 280 nm is 58010 M -1 cm -1 , indicating that it can be analyzed by ultraviolet spectroscopy; the instability index is 42.49, indicating that it is weakly stable; the fat-soluble index is 96.48, indicating that it has high thermal stability; the overall average hydrophilicity is -0.080, indicating that it is a hydrophobic protein.

[0092] Prosite conserved domain analysis showed that the PfGSTup sequence belongs to the Tau subfamily in the GST family, with conserved N-terminal and C-terminal domains. The N-terminal domain sequence is 9-82, and the C-terminal domain is located at sequence 94-220. The PfGSTl1 sequence belongs to the Lambda subfamily in the GST family, with a thiooxidase at its N-terminus, an N-terminal domain sequence of 20-109, and a C-terminal domain of 121-241.

[0093] Embodiment 9

[0094] The PfGSTup and PfGSTl1 gene-encoded proteins were subjected to molecular docking analysis with mesosulfuron-methyl. The specific steps are as follows:

[0095] SWISS-Model was used to perform homology modeling of PfGSTup, and 1gwc.1 was selected as the template protein, which was highly similar to the target protein with a GMQE value of 0.87.

[0096] The molecular docking results of herbicide mesosulfuron and PfGSTup are as follows Fig.10As shown in the figure, the docking results show that PfGSTup predicted by SWISS-MODEL forms a suitable spatial complementarity with mesosulfuron. The minimum binding energy between PfGSTup and mesosulfuron is -7.43kcal / mol, and the binding energy is less than -5kcal / mol, indicating that PfGSTup can stably bind to mesosulfuron. PfGSTup forms three hydrogen bonds with mesosulfuron, namely SER119, ARG120, and LYS181. After molecular docking, the reduced glutathione (GSH) selected the lowest binding energy conformation with a binding energy of -1.61kcal / mol, which can form two hydrogen bonds with PfGSTup at ASP40 and LEU41, and the spatial distance between reduced glutathione and mesosulfuron is small. The molecular docking results show to a certain extent that PfGSTup can conjugate reduced glutathione and oxidized herbicide molecules.

[0097] The structure of PfGSTl1 uses 4pqh.1 as a template, with a GMQE value of 0.83. The template protein is highly similar to the PfGSTl1 protein, both of which belong to the lambda subfamily of the GST family.

[0098] The results of molecular docking between mesosulfuron and PfGSTl1 are as follows Fig.11 As shown in the figure, the docking results show that PfGSTl1 predicted by SWISS-MODEL forms a suitable spatial complementarity with mesosulfuron. The minimum binding energy between PfGSTl1 and mesosulfuron is -7.15kcal / mol, which has a high binding energy. PfGSTl1 can form four hydrogen bonds with mesosulfuron, namely LEU102, VAL88, SER101 and GLU100. After molecular docking, the lowest binding energy conformation of reduced glutathione (GSH) was selected, and the binding energy was -1.52kcal / mol. It can form three hydrogen bonds with PfGSTl1 at LYS139, ASP136 and LYS140, and the spatial distance between reduced glutathione and mesosulfuron is small. The molecular docking results show that PfGSTl1 can conjugate reduced glutathione and oxidized herbicide molecules to a certain extent, which has a certain promoting effect on detoxification metabolism.

[0099] Therefore, the present invention discloses for the first time the CDS sequences of PfGSTup and PfGSTl1 genes of Codonopsis pilosa, the CDS sequence of PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of PfGSTl1 gene is shown in SEQ ID NO.4; it is found for the first time that expressing PfGSTup and PfGSTl1 genes in Escherichia coli can make transgenic Escherichia coli acquire resistance to mesosulfuron-methyl, and provides two new mesosulfuron-resistant GST family candidate genes derived from Codonopsis pilosa; the provided PfGSTup and PfGSTl1 genes can be used for the cultivation of wheat varieties resistant to ALS inhibitor herbicides, and provide two candidate genes for studying the mechanism of Codonopsis pilosa resistance to ALS inhibitor herbicides, detecting Codonopsis pilosa resistance, and determining the application period and dosage.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Two herbicide-resistant genes of Echinops chinensis, characterized in that: The CDS sequence of the PfGSTup gene is shown in SEQ ID NO.1, and the CDS sequence of the PfGSTl1 gene is shown in SEQ ID NO.

4.

2. The effect of the two herbicide-resistant genes of Echinops chinensis on mesosulfuron resistance as claimed in claim 1, characterized in that: Expression of PfGSTup and PfGSTl1 genes improves resistance to mesosulfuron-methyl.

3. Use of the two herbicide-resistant genes of Rhizoma Coptidis as claimed in claim 1 in detecting the resistance of Rhizoma Coptidis to mesosulfuron-methyl.

4. The use of the two Herbicide-tolerant genes of Rhizoma Ceratitise as claimed in claim 1 in the selection and dosage investigation of Herbicide of Rhizoma Ceratitise, characterized in that: The application is to detect whether the grasshopper is suitable for the control by using mesotrione and the effective dosage of mesotrione for the control.

5. The use of two Herbicide-tolerant genes of Rhizopus chinensis in the breeding of wheat herbicide-tolerant varieties as claimed in claim 1, characterized in that: The herbicide is an ALS inhibitor herbicide.

6. The use of two Herbicide-tolerant genes of Codonopsis pilosula in breeding of wheat herbicide-tolerant varieties according to claim 5, characterized in that: The herbicide is mesosulfuron-methyl.

Images