Application of SlSYP51 gene and protein coded by SlSYP51 gene in regulation and control of tomato cold resistance

Abstract

The invention is suitable for the technical field of molecular biology, and provides an application of an SlSYP51 gene and a protein coded by the SlSYP51 gene in regulating and controlling the cold resistance of tomatoes. The nucleotide sequence of the SlSYP51 gene is as shown in SEQ ID No. 1, and the amino acid sequence of the protein coded by the SlSYP51 gene is as shown in SEQ ID No. 2. According to the invention, the SlSYP51 gene is transferred into a tomato plant in an agrobacterium tumefaciens-mediated manner, and the cold resistance of the SlSYP51 overexpression plant is higher than that of a wild tomato plant. After treatment at 4 DEG C for 2 days, compared with SlSYP51 overexpressed plants, leaves of wild tomato plants are obviously withered and curled up, and the damage degree is more serious. Overexpression of the SlSYP51 gene enhances the activity of antioxidant enzyme and improves the cold resistance of tomato plants. The invention discloses a new way for conducting the cold-resistant signal of the tomato, and provides a gene resource for cultivating a new variety of the cold-resistant tomato.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the application of SlSYP51 gene and protein encoded thereby in regulating the cold tolerance of tomatoes. Background Art

[0002] In the natural environment, plants often encounter adverse environments such as drought, low temperature, salinity and heavy metals, which are collectively referred to as abiotic stresses. Among them, cold stress (low temperature stress) is a particularly significant one for plants. It affects the geographical distribution, growth cycle, crop yield and fruit quality of plants. According to statistics, the economic losses caused by low temperature damage to global agriculture are huge, and crop yields have dropped by an average of about 13-15%. In China, cold waves in early spring and late autumn often lead to reactions such as freezing of plant cell membranes, hindering plant growth and even causing permanent damage. Therefore, it is of great significance to deeply study the cold resistance mechanism of plants and enhance their cold resistance.

[0003] Tomato (Solanum lycopersicum L.), an important crop originating from South America, is widely grown around the world because of its rich vitamin A and sweet and sour taste and good flavor. It plays an important role in the global economy. However, cold stress can seriously affect the growth and yield of tomatoes. Therefore, it is of great theoretical significance and application value to develop cold-tolerant genes and rapidly cultivate cold-tolerant tomato varieties using biobreeding technology.

[0004] In cell biology, SNARE refers to a protein complex that fuses the cell membrane and the vesicle membrane. It exists on the cell membrane and the vesicle membrane, and achieves the fusion of the vesicle and the cell membrane through mutual binding and fusion, thereby achieving the transport and release of intracellular substances. In addition, SNARE is also involved in cellular processes such as neurotransmitter release, endocytosis, and the regulation of certain signal transduction pathways. Therefore, SNARE plays an important role in the normal function and physiological process of cells.

[0005] With the development of molecular biology theory and technology, current research shows that the molecular regulatory mechanism of plant cold resistance is complex, involving multiple genes and transcription factors, such as CBF, COR, MYB, WRKY, bHLH, etc. These genes and transcription factors improve the cold resistance of plants by regulating the expression of downstream genes. However, the response mechanism of SNARE protein family member SlSYP51 under plant abiotic stress, especially its function in cold tolerance, has not been studied yet. For this reason, the present invention proposes the application of SlSYP51 gene and its encoded protein in regulating tomato cold tolerance. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the SlSYP51 gene and the protein encoded by it in regulating the cold tolerance of tomatoes, aiming to solve the problems raised in the above background technology.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The invention relates to the application of the SlSYP51 gene and the protein encoded by it in regulating the cold tolerance of tomatoes. The nucleotide sequence of the SlSYP51 gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlSYP51 gene is shown in SEQ ID No.2.

[0009] Furthermore, the overexpression of the SlSYP51 gene improves the cold tolerance of the plant by enhancing the activity of antioxidant enzymes in the plant.

[0010] Furthermore, the antioxidant enzymes include superoxide dismutase and peroxidase.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] The present invention uses Agrobacterium-mediated gene transfer technology to successfully introduce the SlSYP51 gene into tomato plants. The experimental results show that compared with wild-type tomato plants, SlSYP51 overexpressing plants show higher cold tolerance. Specifically, after being treated at 4°C for 2 days, the leaves of wild-type tomato plants showed obvious wilting and curling compared with SlSYP51 overexpressing plants, and the degree of damage was more serious. Further research revealed that overexpression of the SlSYP51 gene can cause the enhancement of antioxidant enzyme activity in the plant. This change helps to reduce the content of reactive oxygen, thereby reducing the damage caused by low temperature stress, and thus improving the cold tolerance of tomato plants. The present invention not only reveals a new pathway for the transduction of cold-tolerant signals in tomatoes, but also provides valuable genetic resources for the cultivation of new cold-tolerant tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Amplification of the tomato SlSYP51 fragment.

[0014] Figure 2 The results are verified by PCR of E. coli colonies.

[0015] Figure 3 The results were verified by Agrobacterium colony PCR.

[0016] Figure 4 Genetic transformation of SYP51 in tomato.

[0017] Figure 5 PCR identification of T0 generation transgenic plants.

[0018] Figure 6 PCR identification of T1 transgenic plants.

[0019] Figure 7 Expression level analysis of SlSYP51 overexpressing plants in different strains.

[0020] Figure 8 Phenotypic comparison between wild-type tomato plants (MT) and SlSYP51 gene overexpressing plants before and after low temperature stress.

[0021] Fig. 9 Comparison of DAB staining between wild-type tomato plants (MT) and SlSYP51 gene overexpressing plants.

[0022] Fig.10 The enzyme activity determination of wild-type tomato plants (MT) and SlSYP51 gene overexpression plants; (a) is the change of SOD content, and (b) is the change of POD content. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] The present invention transfers the SlSYP51 gene into tomato plants in an Agrobacterium-mediated manner, observes and compares the phenotypic differences between transgenic tomato plants and wild-type tomato plants, and simultaneously measures physiological indicators for comparison. Through these comparative studies, we have deeply explored the effect of the SlSYP51 gene on plant cold tolerance, providing new ideas and approaches for the research and application of plant cold tolerance.

[0025] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0026] Example 1: Construction of SlSYP51 overexpression vector;

[0027] 1. Cloning of the full-length SlSYP51 gene: Total RNA was extracted from the leaves of wild-type tomato Micro Tom (MT), and cDNA was obtained by reverse transcription. The obtained cDNA was used as a template to amplify the CDS region of the SlSYP51 gene. Primers for SlSYP51 were designed using NCBI (SlSYP51-F and SlSYP51-R, see Table 1 for specific sequences), and protective bases were added at both ends of the restriction site, and sent to Kumei Biotechnology for primer sequence synthesis.

[0028] The primers for gene cloning and amplification are as follows:

[0029] Table 1 Primers for gene cloning and amplification

[0030]

[0031] The amplification reaction system is as follows:

[0032] Table 2 Amplification reaction system

[0033]

[0034] The reaction procedure is as follows:

[0035] Table 3 Reaction procedure

[0036]

[0037] After obtaining the target fragment, gel recovery was performed to obtain Inserts, which were stored at -20°C for future use. Figure 1 The 702 bp CDS sequence fragment of the SlSYP51 gene obtained by gel recovery is shown.

[0038] 2. Enzyme digestion: Use restriction endonucleases BsaI / Eco31I to digest the expression vector plasmid empty vector pBWA(V)HS, and recover the product after digestion.

[0039] The enzyme digestion system is as follows:

[0040] Table 4 Enzyme digestion system

[0041]

[0042] Incubate at 37°C for 2 hours. After the digestion is completed, take 5 μL of the digestion product and load it on a 1.0% agarose gel to verify the digestion effect by electrophoresis. After verification, purify the remaining digestion product with a DNA purification kit to obtain a Linearized vector.

[0043] 3. Connection: Connect the purified restriction vector and the target fragment Inserts through seamless cloning. The connection system is as follows:

[0044] Table 5 Connection system

[0045]

[0046] Mix gently, react at 50℃ for 15min, and place the centrifuge tube on ice for a few seconds. The recombinant product can be stored at -20℃ or used directly for transformation.

[0047] 4. Transformation of recombinant products into E. coli:

[0048] (1) Take 50 μL of Trans-T1 competent cells and thaw them on ice.

[0049] (2) Add 2 μL of the recombinant product to the competent cells, flick to mix, and place on ice for 30 min.

[0050] (3) Heat shock in a 42°C water bath for 40 seconds, then quickly move to an ice bath and cool for 2-3 minutes (without shaking).

[0051] (4) Add 900 μL of antibiotic-free LB liquid culture medium to each centrifuge tube, mix well, and shake at 37°C for 1 h (180-200 rpm).

[0052] (5) Centrifuge at 6000 rpm for 1 min to collect the bacteria, discard part of the supernatant, and keep about 100 μL of the transformed competent cells in a flask containing Kan + LB plate. Spread evenly with a sterile glass rod, place upright to dry, and place upside down in a 37°C incubator for 12-16 hours (overnight) to observe the colonies.

[0053] 5. Colony PCR verification: Pick a single colony of E. coli in the clean bench for colony PCR (see Figure 2 ) and mark the serial number. At the same time, add the corresponding colony to 10mL LB liquid culture medium (Kan + ). Place in a 37℃ shaker, 200rpm, for 12h. Take 6μL of PCR product and load it on agarose gel electrophoresis. The positive colonies detected are sent to Kumei Biotech for sequencing. Take the positive bacterial solution and mix it with 50% glycerol in a ratio of 1:1 and store it in a -80℃ refrigerator for later use.

[0054] The colony PCR system is as follows:

[0055] Table 6 Colony PCR system

[0056]

[0057]

[0058] The reaction system is as follows:

[0059] Table 7 Reaction system

[0060]

[0061] The plasmid was extracted from the correctly sequenced E. coli to obtain the successfully connected plasmid pBWA(V)HS-SISYP51, which was stored at -20°C.

[0062] 6. Transformation of Agrobacterium;

[0063] (1) Thaw Agrobacterium GV3101 at room temperature or in the palm of your hand for a while, and place it on ice for a while.

[0064] (2) Prepare in advance an ice box, liquid nitrogen, a water bath at 37°C, ultra-clean, sterile centrifuge tubes, and LB liquid culture medium (without resistance).

[0065] (3) In a clean bench: add 1-2 μL of successfully connected plasmid to 50 μL of Agrobacterium and flick gently to mix.

[0066] (4) Place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.

[0067] (5) Ultra-clean: Add 700 μL of antibiotic-free LB liquid culture medium, pipette to mix, and shake in a shaker at 28°C for 2-3 h.

[0068] (6) Centrifuge at 10,000 rpm for 1 min to collect bacteria and clean: take about 100 μL of the supernatant and apply it on Kan + 、Rif + Seal the plate, place it upright to dry, and then place it upside down in a 28°C incubator for 2 days. Observe the colonies.

[0069] (7) Pick a single Agrobacterium colony in the clean bench for colony PCR verification (see Figure 3 ), screen the positive clones, and place them in a shaking incubator at 28°C for future use.

[0070] Example 2: Agrobacterium-mediated genetic transformation of tomato;

[0071] 1. Seed disinfection: Soak the seeds in clean water for 2-3 hours in advance. In a sterile environment, wash with 75% alcohol for 30 seconds, shake with NaClO for 13 minutes, and rinse with sterile water 5-6 times.

[0072] 2. Sowing: sterilize the tomato seeds and sow them in 1 / 2 medium. Incubate in dark at 24℃ for 3-4 days. When the tomato seeds turn white, move the medium to 24℃, 16h light / 8h dark. 7-8 days after sowing, the two cotyledons of the seedlings are fully expanded and can be used for the experiment.

[0073] 3. Preparation and pre-culture of explants: After the cotyledons of the germinated tomato seedlings are fully expanded, the petioles and tips of the cotyledons are removed with a scalpel, and the middle part is cut into 2-3 sections and inoculated into the pre-culture medium, and pre-cultured at 24°C for 2-3 days.

[0074] 4. Agrobacterium infection and co-cultivation: Pick Agrobacterium and place it in the infection solution. Culture it with shaking at 28℃ until OD600≈0.8. Dilute the Agrobacterium resuspension to OD600=0.3-0.4, infect the leaves for 10-15min, inoculate the dried explants in the co-culture medium, and culture them in the dark at 24℃ for 2d.

[0075] 5. Screening and differentiation rooting: Inoculate the recovered callus into the screening medium and culture it at 24℃, 16h / 8h light / dark for 15-30d; inoculate the selected callus into the differentiation medium and culture it at 24℃, 16h / 8h light / dark for 30-40d. When the seedlings to be differentiated grow to about 2-3cm, cut them off from the callus and inoculate them into 1 / 2MS rooting medium and culture them at 24℃, 16h / 8h light / dark for 10-15d.

[0076] 6. Transplantation: After 1-2 weeks of rooting culture, open the cover of the rooted tissue culture seedlings and harden them for 1 day, then transplant them to vermiculite for growth.

[0077] Example 3: Cold resistance identification;

[0078] 1. Plant material cultivation: In order to further study the function of the SlSYP51 gene, the wild-type tomato MT was genetically transformed with Agrobacterium tumefaciens that had been transformed with pBWA(V)HS-SISYP51 using the Agrobacterium-mediated leaf disc method. After the root system of the plant was fully developed, the transgenic strain obtained was hardened and cultured to obtain the T0 generation transgenic tomato plants overexpressing SISYP51 (see Figure 4 ). The positive seedlings of T0 generation tissue culture seedlings were identified, and the positive plants of T0 generation were transferred from vermiculite to the substrate, and the seeds were harvested to obtain T1 generation. After further screening of positive seedlings, T2 generation seeds were sown, and T2 generation seeds were used as research objects for experiments. Wild-type tomato MT seeds and T2 generation seeds of the same period were germinated in a dark environment for 3 days. After the seeds turned white, they were sown in plug trays and cultured at 24℃ and 16 / 8h. After 4 weeks, the seedlings were cold treated at 4℃.

[0079] 2. Identification of transgenic positive seedlings: After obtaining T0 generation plants, the whole genome DNA of the plants was extracted and used as a template for PCR reaction using the vector universal upstream primer (35SF) and the gene downstream primer (SlSYP51-R0).

[0080] The primers are as follows:

[0081] 35SF:GACGCACAATCCCACTATCC (as shown in SEQ ID No. 5)

[0082] SlSYP51-R0: CAGATACTTAATCAACATATATATTGCC (as shown in SEQ ID No. 6)

[0083] The PCR reaction system (10 μL) is as follows:

[0084] Table 8 PCR reaction system

[0085]

[0086] The reaction conditions are as follows:

[0087] Table 9 Reaction conditions

[0088]

[0089] Use agarose and TAE buffer (at a ratio of 1g:100mL) to prepare electrophoresis solution, add EB to replace dye, and then perform electrophoresis detection on PCR products, using plasmid as positive control and wild-type tomato MT as negative control. The positive plants are those with corresponding bands to the positive control, and the positive plants are selected and retained. Figure 5 As shown, M represents Marker, lanes 1 to 11 are different overexpression plants, lanes 12 and 13 are positive plasmid controls, and lane 14 is a wild-type tomato MT negative control. According to the PCR identification results, it was found that the PCR electrophoresis results of 10 overexpression lines showed bands, which were positive, while the electrophoresis results of wild-type tomato MT did not show bands, which was negative, indicating that all 10 overexpression lines were successfully transformed. Subsequently, the T0 generation plants were raised and propagated, and the positive rate of the T1 generation plants was detected to be 83% (see Figure 6 ) and select positive plants for subsequent experiments.

[0090] 3. Expression of wild-type tomato plants and plants with different SlSYP51 overexpression;

[0091] The expression of SlSYP51 in overexpressing plants of different strains (OE-2, OE-3, OE-4, and OE-5) was detected by real-time fluorescence quantitative PCR. Figure 7 As shown, it can be seen that the SlSYP51 expression levels of overexpressing plants of different strains are significantly higher than those of wild-type tomato plants.

[0092] 4. Comparison of phenotypic observations between wild-type tomato plants and SlSYP51 overexpressing plants;

[0093] The wild-type tomato plants and SlSYP51 overexpressing plants were placed in a 4°C incubator with 16 h of light and 8 h of darkness for 2 days. After treatment, the leaves of the wild-type tomato plants showed severe wilting and curling, while the leaves of the SlSYP51 overexpressing plants showed no obvious changes (see Figure 8 ).

[0094] 5. DAB staining of leaves of wild-type tomato plants and SlSYP51 overexpressing plants after cold treatment;

[0095] After 2 days of cold treatment at 4°C, the leaves were stained with DAB. It was found that the damage degree of the leaves of wild-type tomato plants that had not been cold treated was similar to that of the leaves of SlSYP51 overexpressing plants, while the damage degree of the leaves of wild-type tomato plants that had been cold treated was significantly more serious than that of the leaves of SlSYP51 overexpressing plants (see Fig. 9 ).

[0096] 6. Determination of physiological indicators after 2 days of cold treatment;

[0097] After 2 days of cold treatment at 4℃, the contents of superoxide dismutase (SOD) and peroxidase (POD) in the leaves of wild-type tomato plants and SlSYP51 overexpressing plants increased significantly, and the increase in the SlSYP51 overexpressing plants was greater than that in the wild-type tomato plants (see Fig.10 ). This indicates that overexpression of the SlSYP51 gene will increase the activity of antioxidant enzymes in the plant, thereby reducing the content of reactive oxygen, further reducing the damage caused by stress, and thus improving the cold tolerance of the plant.

[0098] In summary, the cold tolerance of SlSYP51 overexpressing plants is higher than that of wild-type tomato plants.

[0099] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. Application of the SlSYP51 gene and the protein encoded by it in regulating the cold tolerance of tomatoes, characterized in that: The nucleotide sequence of the SlSYP51 gene is shown as SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlSYP51 gene is shown as SEQ ID No.

2.

2. The use according to claim 1, wherein the overexpression of the SlSYP51 gene improves the cold tolerance of the plant by enhancing the activity of antioxidant enzymes in the plant.

3. The use according to claim 2, wherein the antioxidant enzyme comprises superoxide dismutase and peroxidase.

Images