Application of Circ2977 as a diagnostic biomarker and therapeutic target for colorectal cancer

By detecting the expression level of Circ2977 and inhibiting Circ2977 with siRNA, the regulation of miR-874-3p and VEGFA/SOX2 was achieved, solving the sensitivity and toxicity issues in CRC diagnosis and treatment. This provides a highly efficient diagnostic biomarker and therapeutic target, inhibiting CRC cell proliferation and angiogenesis.

CN119592693BActive Publication Date: 2026-04-03重庆医科大学国际体外诊断研究院
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411868207.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-18
Publication Date
2026-04-03
Estimated Expiration
2044-12-18

AI Technical Summary

Technical Problem

Current diagnostic and treatment strategies for metastatic CRC mainly rely on chemotherapy as an adjunct to anti-angiogenesis detection, which has low sensitivity. Traditional tumor markers have poor diagnostic sensitivity and specificity. Chemotherapy has significant toxic side effects and is prone to drug resistance. Furthermore, there is a lack of biomarkers for monitoring tumor vascular status, resulting in poor treatment outcomes.

Method used

Using Circ2977 as a diagnostic biomarker, the expression level of Circ2977 in patient samples was detected. Circ2977 expression was inhibited using siRNA, which regulated the expression of miR-874-3p and VEGFA/SOX2, thereby inhibiting the proliferation, migration, and invasion of CRC cells.

Benefits of technology

Circ2977 is highly expressed in CRC tissues and has high diagnostic sensitivity and specificity. By regulating miR-874-3p and VEGFA/SOX2 expression, it inhibits CRC cell proliferation, migration and angiogenesis, providing a new diagnostic and therapeutic target.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005195044380000061
    Figure BDA0005195044380000061
  • Figure BDA0005195044380000071
    Figure BDA0005195044380000071
  • Figure HDA0005195044390000011
    Figure HDA0005195044390000011
Patent Text Reader

Abstract

This invention discloses the application of Circ2977 as a diagnostic biomarker and therapeutic target for colorectal cancer. Our research confirms that the level of Circ2977 in CRC tissue is higher than in adjacent normal tissue, and that Circ2977 is present in tumor-derived extracellular vesicles, enhancing endothelial cell migration and tubule formation. Our research also found that Circ2977 regulates VEGFA / SOX2 expression by adsorbing miR-874-3p, promoting CRC cell proliferation, migration, invasion, and angiogenesis. This research reveals the role of Circ2977 in CRC progression and angiogenesis, providing a novel diagnostic biomarker and therapeutic target for colorectal cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of Circ2977 as a diagnostic biomarker and therapeutic target for colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is a malignant tumor that seriously endangers human health, ranking third in incidence among all malignant tumors. Clinical studies show that despite the implementation of CRC screening programs, the development of diagnostic technologies, and improvements in treatment levels, the early diagnosis rate of CRC can reach 80%. However, epidemiological surveys show that, in both developing and developed countries, the 5-year survival rate of metastatic CRC patients is only 12%, and the mortality rate of CRC ranks second among cancer deaths worldwide. The diagnosis and treatment of metastatic colorectal cancer remains one of the most challenging and hot topics in related research fields. 1. Diagnosis: Currently, the clinical diagnosis of metastatic CRC mainly relies on imaging examinations, but the sensitivity of imaging tests is low, resulting in a low detection rate of early metastatic CRC. On the other hand, existing traditional tumor markers have poor sensitivity and specificity for CRC diagnosis. These factors contribute to patients missing the optimal treatment window. 2. Treatment: Current treatment strategies for metastatic CRC mainly involve chemotherapy combined with anti-angiogenic and other targeted therapies. Chemotherapy has significant toxic side effects and is prone to drug resistance, while the widely used anti-angiogenic targeted therapy has unsatisfactory clinical efficacy due to the lack of biomarkers for monitoring tumor vascular status. Studies show that tumor angiogenesis is a crucial step in the formation of the tumor microecology before early metastasis, playing a significant role in tumor growth, invasion, and metastasis. This suggests that exploring the mechanisms of tumor angiogenesis in early metastatic CRC may help identify targets for CRC diagnosis and / or treatment.

[0003] Recently, the function of extracellular vesicles (EVs) in cancer has attracted increasing attention. EVs are lipid bilayer-separated vesicles secreted by various cells and have been reported as carriers for intercellular signal transduction, delivering DNA, non-coding RNA, and proteins. Among them, circular RNAs (circRNAs) are a class of structurally stable circular non-coding RNAs. Most circRNAs originate from exons of protein-coding genes and are generated through backsplicing, possessing binding sites for microRNAs (miRNAs). CircRNAs participate in multiple processes, including tumorigenesis, development, and metastasis, and numerous studies have confirmed their close association with angiogenesis in cancer comorbidities (CRC). The covalently closed circular structure of circRNAs gives them the advantages of conservation and stability, allowing for easy detection in patient serum samples and collected EVs. This suggests that circRNAs may be a promising non-invasive diagnostic biomarker for human cancer diagnosis. However, how tumor-derived EV circRNAs regulate the formation of the pre-metastatic microenvironment by inducing cancer progression and angiogenesis requires further investigation. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned problems by providing an application of Circ2977 as a diagnostic biomarker and therapeutic target for colorectal cancer.

[0005] To achieve its objective, the present invention employs the following technical solution:

[0006] A first aspect of the present invention provides the use of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing colorectal cancer, wherein the biomarker is Circ2977.

[0007] Compared with normal controls, the expression level of Circ2977 was upregulated in patients.

[0008] The content of Circ2977 in the patient's test sample was obtained by total RNA extraction, reverse transcription, and quantitative PCR; the test sample is preferably a colorectal cancer tissue, cell, extravesicle, or serum sample.

[0009] A second aspect of the present invention provides the use of a Circ2977 expression inhibitor in the preparation of a medicament for the prevention and treatment of colorectal cancer.

[0010] The Circ2977 expression inhibitors include siRNA.

[0011] Preferably, the sequence of the siRNA is:

[0012] Justice chain sequence: 5'-GUUCUGCACUUACACAGGU-3',

[0013] Antisense sequence: 5'-ACCUGUGUAAGUGCAGAAC-3'.

[0014] A third aspect of the invention provides the use of Circ2977 as a target in screening drugs for the treatment of colorectal cancer.

[0015] The drug inhibits the expression of Circ2977.

[0016] For any of the applications described above, the transcribed nucleotide sequence of Circ2977 is shown in SEQ ID NO.1.

[0017] In any of the above applications, Circ2977 regulates the expression of VEGFA / SOX2 by adsorbing miR-874-3p, thereby promoting CRC cell proliferation, migration, invasion, and angiogenesis.

[0018] The beneficial effects of this invention are:

[0019] This invention confirms that the level of Circ2977 in CRC tissue is higher than that in adjacent normal tissue, and that Circ2977 is present in tumor-derived external vesicles, enhancing endothelial cell migration and tubule formation. This invention also reveals that Circ2977 regulates VEGFA / SOX2 expression by adsorbing miR-874-3p, promoting CRC cell proliferation, migration, invasion, and angiogenesis. This research elucidates the role of Circ2977 in CRC progression and angiogenesis, providing a novel diagnostic biomarker and therapeutic target for colorectal cancer. Attached Figure Description

[0020] Figure 1The study revealed significantly high expression of Circ2977 in CRC cells and external vesicles: A. A heatmap showed hierarchical clustering of the two differentially expressed CircRNAs (CT: tumor, CN: normal); B. A volcano plot showed the expression profile between tumor tissue and adjacent normal tissue, with differential expression selected based on the following criteria: |Fold Change|>2; P<0.05. Red dots represent upregulated CircRNAs, and blue dots represent downregulated CircRNAs; C. GO functional analysis of differentially expressed CircRNAs; D. A Venn diagram showed the intersection of the top twenty upregulated differentially expressed CircRNAs obtained from whole transcriptome sequencing with highly expressed CircRNAs from the exoRBase database of CRC serum external vesicles; E. TEM images of external vesicles, scale bar = 100 nm; F. Isolated SW480-EVs, Caco Western blot analysis of proteins (CD63, Alix, CANX) in 2-EVs and SW480, Caco2 cells; G. Nano flow cytometry detection of extravesicular markers (CD9, CD63, CD81); H. Nano flow cytometry detection of extravesicular particle size distribution and number in SW480-EVs; I. Expression of Circ2977 mRNA in SW480-EVs and Caco2-EVs; J. Laser confocal imaging showing dense extravesicular particles in HUVECs cells.

[0021] Figure 2The study aimed to verify the circular nature of Circ2977 and the expression of circRNA in serum, tissues, and cells of CRC patients: A. The formation process of Circ2977 located on the CDC42 gene on chromosome 1 and the verification of the reverse splicing site of Circ2977 using Sanger sequencing; B. Agarose gel electrophoresis to confirm the PCR product of Circ2977 and electrophoretic analysis of the PCR product using divergent and convergent primers of Circ2977; C. qRT-PCR to detect the expression abundance of Circ2977 after treatment with RNase R and actinomycin D at specific time points to verify its circular nature; E. qRT-PCR was used to detect the expression of circ2977 in 45 CRC patients and 13 patients with polyps. The expression levels of Circ2977 in the serum of 20 healthy individuals were compared, with GAPDH as an internal control. ROC curves were plotted based on the expression of Circ2977 in serum. F. The relationship between Circ2977 expression and lymph node metastasis and distant metastasis in CRC patients; GH. Analysis of Circ2977 expression in CRC patients based on intestinal wall invasion depth and TNM stage; I. Scatter plot of the correlation between Circ2977 and VEGFA expression in CRC patients; J. ROC curves of CEA and its combination with Circ2977; K. Expression of Circ2977 in colorectal cancer tissue and adjacent normal tissue; L. Detection of Circ2977 expression in CRC cell lines by qRT-PCR.

[0022] Figure 3 The study demonstrated that knockdown of Circ2977 inhibited CRC cell proliferation, migration, and invasion in vitro, and promoted CRC cell apoptosis: A. qRT-PCR detection of the knockdown effect of Circ2977; BC. Effect of Circ2977 knockdown on cell proliferation in CCK8 and colony formation assays; D. Annexin V-FITC / PI flow cytometry detection of apoptosis; EF. Effect of Circ2977 knockdown on the migration and invasion abilities of SW480 and Caco2 cells by the presence and absence of Matrigel Transwell assay and scratch healing assay.

[0023] Figure 4 This study demonstrates the effects of knockdown of Circ2977 and inhibition of miR-874-3p expression on the growth and angiogenesis of colorectal cancer in vivo: A. Conceptual mapping of subcutaneous xenografts in nude mice; B. Images of xenografts in nude mice; C. Quantitative analysis of tumor volume; D. Quantitative analysis of tumor size in each group; E. Immunohistochemical detection of cell proliferation markers (Ki67), vascular markers (CD31), and vascular mimicry markers (PAS) in each group. + / CD31 -F. Immunohistochemical analysis of the expression of VEGFA, VEGFR1, and SOX2 after Si-Circ and / or Antagomir treatment. Detailed Implementation

[0024] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0025] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0026] The experimental methods of this invention include: high-throughput sequencing to analyze the expression of differentially expressed circRNAs in CRC tumors and adjacent normal tissues; ultracentrifugation to isolate CRC cell-derived extracellular vesicles; quantitative real-time PCR (qRT-PCR) to identify and validate the extracellular vesicle Circ2977 and to detect its levels in CRC cells and serum samples; Sanger sequencing, RNase R, and actinomycin D assays to verify the circular structure of Circ2977; and loss-of-function experiments to investigate the effects of extracellular vesicle Circ2977 on CRC growth, invasion, and angiogenesis in vitro and in vivo.

[0027] The experimental results of this invention show that Circ2977 is significantly highly expressed in CRC tissues and external vesicles. Receiver operating characteristic (ROC) curves indicate that serum Circ2977 expression has high sensitivity and specificity for CRC detection. High expression of Circ2977 in the serum of CRC patients is significantly correlated with tumor differentiation status, intestinal wall invasion depth, lymph node metastasis, and distant metastasis, and is strongly correlated with serum VEGFA levels, suggesting that Circ2977 has the potential to serve as a diagnostic biomarker. In vitro and in vivo functional experiments show that Circ2977 promotes CRC cell proliferation, stemness, invasion, and angiogenesis.

[0028] The specific research process is as follows:

[0029] Example 1

[0030] 1. Materials and Methods

[0031] 1.1 Experimental Materials

[0032] 1. Cell Culture

[0033] Human CRC cell lines SW480, Caco2, HCT116, and Lovo, human colon cell line NCM460, and human umbilical vein endothelial cells (HUVECs) were all obtained from the Key Laboratory of Clinical Laboratory Diagnostics, Ministry of Education, Chongqing Medical University. All cells were cultured in DMEM / high glucose medium (gbico, Thermo Fisher, USA) containing 10% fetal bovine serum (LONSA SCIENCE SRL, Uruguay) at 37°C in a 5% CO2, saturated humidity incubator.

[0034] 2. Laboratory animals

[0035] All animal-related experiments in this study were approved by the Medical Ethics Committee of Chongqing Medical University. BALB / c nude mice (female, 4-5 weeks old) were purchased from Beijing Huafukang Biotechnology Co., Ltd., and housed under specific pathogen-free (SPF) conditions at the Animal Center of Chongqing Medical University. The nude mice were randomly divided into 4 groups of 5 mice each. All mice were housed under the same conditions, with no dietary or other restrictions. One week after the nude mice acclimatized to the experimental conditions, 4×10⁶ SW480 cells, individually transfected with Si-NC+miR-874-3p-NC, Si-circ, miR-874-3p-Antagomir, and Si-circ+miR-874-3p-Antagomir, were suspended in 100 μL of serum-free DMEM and subcutaneously injected into the left forelimb axilla of each nude mouse. The changes in the condition of each group of nude mice at different times were observed, and the size of the tumors was recorded. After 25 days, the nude mice were euthanized by cervical dislocation. All the removed tumor samples were photographed, weighed, fixed with 4% paraformaldehyde, embedded in paraffin blocks, and the tissue sections were used for immunohistochemical staining of various indicators.

[0036] 3. Research subject: Circ2977

[0037] Analysis using the UCSC (http: / / genome.ucsc.edu / ) online database software revealed that the CDC42 gene is located on human chromosome 1. According to the CDC42 circular RNA information included in the authoritative circular RNA database CircBase (http: / / circrna.org / ), the chr1:22404921-22413359 of the CDC42 gene form a closed circular RNA molecule by joining the head and tail. RNA-seq named it circRNA2977 (exoRbase ID:exo_circ_33146).

[0038] The human Circ2977 sequence is as follows (SEQ ID NO.1):

[0039] GTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAG。

[0040] The sequence of mouse Circ2977 is as follows (SEQ ID NO.2):

[0041] .

[0042] 1.2 RNA extraction, reverse transcription (RT-PCR), and quantitative real-time PCR (qRT-PCR) detection.

[0043] According to the reagent manufacturer's instructions, total RNA was extracted from cells using the SteadyPure Quick Extraction Kit, and serum RNA was extracted using SteadyPure Blood, Serum, and Plasma Small RNA Extraction. For exovesicle RNA extraction, 140 μL of chloroform was added to the exovesicles, and the mixture was vortexed for 15 seconds. The mixture was incubated at room temperature for 3 minutes, then centrifuged at 12000g for 15 minutes at 4°C. The supernatant was collected, and anhydrous ethanol was added and mixed before transferring to an RNeasy adsorption column. The column was centrifuged at 8000g for 15 seconds. Buffer RWT was then added, followed by centrifugation at 8000g for 15 seconds, and then Buffer RPE was added again before centrifugation at 8000g for 15 seconds. The filtrate was discarded. Finally, the column was centrifuged at 12000g for 1 minute, dried, and an appropriate amount of RNase-free water was added to the middle of the adsorption membrane. The column was then centrifuged at 8000g for 1 minute to obtain RNA.

[0044] The concentration and purity of extracted total RNA were determined using a NanoDrop One (Thermo Fisher Scientific, USA) ultraviolet spectrophotometer. mRNA was reverse transcribed into cDNA using an Evo M-MLVRTPremix (Accurate Biotechnology, China) at 37℃ for 15 min and 85℃ for 5 s. qRT-PCR was performed on a Bio-Rad CFX96TM (Bio Rad, USA) using a SYBR Green Premix Pro Taq HS qPCR Kit (AccurateBiotechnology, China). The qRT-PCR reaction was performed in 40 cycles: 95℃ for 30 s, followed by 95℃ for 5 s and primer-specific annealing at 60℃ for 30 s. The qRT-PCR primer sequences are shown in the table. The relative quantification of RNA was calculated using the 2-ΔΔCt method with GAPDH / U6 as an internal control.

[0045] The PCR primer sequences are shown in Table 1:

[0046] Table 1

[0047]

[0048] 1.3 Isolation and Identification of External Vesicles

[0049] Extravesicles were separated by differential ultracentrifugation. Serum-free cultured CRC cell supernatant was centrifuged at 300g for 10 min, 2000g for 10 min, and 10,000g for 30 min at 4°C. Finally, it was centrifuged at 100,000g for 70 min using an ultracentrifuge to obtain an extravesicle precipitate free of cell debris, large particles, and microvesicles. The precipitate was then resuspended in 1xPBS. EV morphology was observed using TEM, EV concentration and particle size distribution were determined using a Flow NanoAnalyzer (NanoFCM, China), and EV protein markers were detected using Western blotting and the Flow NanoAnalyzer.

[0050] 1.4 Exovesicle uptake experiment

[0051] The extracted vesicles were mixed with 1 μmol / ml CM-Dil and incubated in the dark for 10 min. The labeled vesicles were then added to HUVEC cell slides and incubated in the dark for 4 h. After fixation with 4% paraformaldehyde, the cells were permeabilized with PBS containing 0.4% Triton X-100 at room temperature for 10 min, followed by washing with PBS 3 times. 2-5 μL of fluorescently labeled phalloidin stock solution was diluted with 200 μL PBS and incubated at room temperature for 20 min for staining. The cells were then washed with PBS 2-3 times. The cell nuclei were stained with DAPI for 5 min, and confocal imaging was performed.

[0052] 1.5 Vector Construction and Cell Transfection

[0053] 4×10 5 CRC cells were seeded in six-well plates and allowed to adhere for 12 hours. Cells were then transfected using GP-transfect-Mate (purchased from Gene Pharma, China) according to the manufacturer's instructions. siRNA and siNC targeting the Circ2977 backsplicing site were synthesized (Tsing Ke, China), and knockdown efficiency was detected by qRT-PCR. The miR-874-3p inhibitor (miR-874-3p-Antagomir) was purchased from Tsing Ke, China. The sequences of the siRNA and inhibitor are shown in Table 2.

[0054] Table 2. Sequence information of siRNA and miR inhibitors

[0055]

[0056] 1.6 Western blot

[0057] Total protein was extracted from cells, and protein concentration was determined using the BCA method. Equal amounts of protein were separated on SDS-PAGE gels at 90V for 30 min, then at 120V for 60 min, and transferred to a PVDF membrane (Biosharp, China). The membrane was blocked in TBST with 5% BSA for 2 h, then incubated overnight at 4°C with primary antibodies against CD63 (1:1000) (Wanlei), ALIX (1:1000) (Wanlei), CANX (1:1000) (Wanlei), and βactin (1:1000) (Proteintech, China). The membrane was then incubated with secondary antibody (1:5000) (ZSGB-BIO, China) at 37°C for 1 h on a shaker. Band intensity was analyzed using an ECL chemiluminescence assay kit (Biosharp, China).

[0058] 1.7 RNase R Digestion Experiment

[0059] Total RNA (2 μg / group) from SW480 and Caco2 cells was incubated with 10 U / μg RNase R (Solarbio, China) at 37°C for 0, 10, 20, and 30 min, and then the abundance of linear and circular RNA was analyzed by qRT-PCR.

[0060] 1.8 Actinomycin D Tolerance Test

[0061] SW480 and Caco2 cells were seeded in 6-well plates, and treated with actinomycin D (MCE, USA) at a final concentration of 100 ng / ml for 0, 4, 8, 12, and 24 hours on the second day. Total RNA was extracted. The stability of Circ2977 and CDC42,GAPDH mRNA was analyzed by qRT-PCR.

[0062] 1.9 CCK8, Cloning

[0063] Cell proliferation was assessed using a CCK8 assay kit (MCE, USA) and a colony formation assay. For the colony formation assay, treated cells were added to 6-well plates at a rate of 1000 cells / well. Cells were observed and the medium was changed every 5 days. After 12 days, cells were fixed, stained, photographed, and counted.

[0064] 1.10 Migration and Invasion Experiments

[0065] Transwell and scratch assays were used to assess cell migration ability. 4 x 10⁴ cells were added to the upper chamber, and 500 ml of serum-free medium was added to the lower chamber. For the scratch assay, cells were streaked after each well reached confluence, followed by washing twice with PBS and replacing with serum-free medium. Images were taken at 0 h, 24 h, and 48 h. For the invasion assay, 50 μL of diluted Corning (USA) matrix gel was added to the upper chamber of the incubator 1 h in advance, and 6 x 10⁴ cells were added to the upper chamber, with 500 ml of serum-free medium added to the lower chamber. Transwell assays were performed after 36 h, followed by fixation, staining, and photography.

[0066] 1.11 Bioinformatics Prediction

[0067] To identify circRNAs associated with external vesicles, we intersected the top 20 differentially expressed circRNAs with the highest fold increase in expression obtained from whole-transcriptional sequencing of CRC tissues with highly expressed circRNAs from the CRC serum external vesicle database exoRBase. We then used circBank, StarBase, and Circular RNA Interactome with CRC tissue sequencing data to predict potential target miRNAs for Circ2977. Notably, when predicting potential target molecules, we selected the intersection of 2-3 datasets for subsequent validation.

[0068] 1.12 Statistical Analysis

[0069] All experiments were performed at least three times. All results are expressed as mean ± standard deviation (SD). Statistical analysis and graph generation were performed using GraphPad Prism 9.5. Two-tailed Student's t-tests were used to analyze differences between the two groups, with * / P < 0.05, ** / P < 0.01, *** / P < 0.001, and **** / P < 0.0001 considered statistically significant.

[0070] 2. Experimental Results and Analysis

[0071] 2.1 Screening and identification of Circ2977 as a highly expressed circRNA in CRC and extravesicles

[0072] To understand the expression profile of circRNAs in CRC, six pairs of whole transcriptome sequencing libraries from CRC and adjacent normal tissues were constructed using RNA-seq. Hierarchical clustering revealed differences in the expression profiles of ccircRNAs between the two groups. Figure 1 A). Using fold change > 2.0 and P < 0.05 as cutoff criteria, among the differentially expressed circRNAs, 40 circRNAs were upregulated and 533 circRNAs were downregulated. Figure 1 B). GO functional annotation showed that differentially expressed genes were enriched in relation to the outer vesicle composition of CRC ( Figure 1 C). To identify circRNAs associated with external vesicles, we intersected the top twenty differentially expressed genes by fold fold increase obtained from sequencing with highly expressed circRNAs from the CRC serum external vesicle database exoRBase. Only Circ2977 was highly expressed in external vesicles. Figure 1D). To verify the expression of Circ2977 in CRC extravesicles, we first isolated and identified the extravesicles. Extravesicles derived from the supernatants of SW480 and Caco2 cells were isolated by differential centrifugation and subjected to TEM and Nano cytometry experiments. The results showed that the extravesicles were approximately 40-140 nm in size, spherical, and possessed a typical cup-shaped structure. Figure 1 E, F). Furthermore, Western blotting and nano-flow cytometry were used to detect biomarkers of extravesicular vesicles (CD63, CD9, CD81, Alix, CANX). Figure 1 G, H). Subsequently, we extracted RNA from the outer vesicles to verify the expression of this gene, and found that Circ2977 was indeed highly expressed in the outer vesicles. Therefore, we selected Circ2977 for further research. Figure 1 I). Dil-labeled external vesicles from SW480 cells were added to HUVECs for incubation. Laser confocal imaging revealed dense external vesicle granules (red) in the HUVECs, indicating that external vesicles containing Circ2977 could be endocytosed into HUVECs. Figure 1 J).

[0073] 2.2 Identification of the circular characteristics of Circ2977 and exploration of its clinical application value

[0074] Before delving into whether Circ2977 can serve as a valuable clinical serological biomarker, we first investigated the characteristics of Circ2977. Circ2977 is cleaved from CDC42 located at chr1:22404921-22413359. According to annotations from NCBI (https: / / www.ncbi.nlm.nih.gov / ) and the circBase database (http: / / www.circbase.org / ), a 536-nt circular transcript is ultimately formed. The cleavage process model of Circ2977 is shown in the figure below. Figure 2 As shown in A). To verify the closed-loop structure of Circ2977, we designed convergent and divergent primers for Circ2977 and the corresponding CDC42 linear transcript. Circ2977 was amplified using the divergent primers and confirmed by Sanger sequencing. Figure 2 A, B). This sequence is consistent with RNAseq and circBase database annotations. In SW480 cells, Circ2977 can only be amplified from cDNA and not from gDNA. Figure 2 B). Furthermore, in SW480 and Caco2 cells treated with RNase R and actinomycin D (a transcription inhibitor), Circ2977 was more stable than linear CDC42. Figure 2(C, D). Next, we collected serum samples from clinical CRC patients and healthy individuals, and detected the expression of Circ2977 using qRT-PCR. The results showed that Circ2977 was significantly highly expressed in the serum of CRC patients, and higher than that in the polyp patient group. The AUC of the ROC curve for Circ2977 expression was 0.8067, p < 0.0001. Figure 2 E). This suggests that Circ2977 has good sensitivity and specificity in distinguishing CRC patients from non-CRC patients. Furthermore, high expression of Circ2977 in the serum of CRC patients is associated with tumor differentiation status, depth of intestinal wall invasion, lymph node metastasis, and distant metastasis. Figure 2 FH) was significantly correlated. Simultaneously, Circ2977 showed a strong correlation with the angiogenic factor VEGFA detected in the serum of clinical patients ( Figure 2 I). The diagnostic sensitivity and specificity of ROC curves when used in combination with CEA are superior to those when CEA is used alone. Figure 2 J). Furthermore, in sequencing data of cancerous and adjacent normal tissues from 6 patients with metastatic colorectal cancer, Circ2977 was highly expressed in CRC tissues. Figure 2 K). The high expression of Circ2977 in the CRC cell line was also verified by qRT-PCR experiments. Figure 2 L).

[0075] 2.3 In vitro study of the effects of Circ2977 on cell proliferation, apoptosis, migration, and invasion

[0076] To investigate the function of Circ2977 in CRC cells, we designed two siRNAs targeting the cleavage region. Then, loss-of-function assays were performed in SW480 and Caco2 cells, where Circ2977 expression is relatively high. After transfection with both siRNAs, Circ2977 expression in both cell lines was significantly reduced by siRNA #1. Figure 3 A). CCK-8 assays showed that downregulation of Circ2977 inhibited the proliferation of SW480 and Caco2 cells. Figure 3 B). Clonogenesis experiments showed that downregulation of Circ2977 inhibited the stemness of SW480 and Caco2 cells. Figure 3 C). Flow cytometry results with Annexin and PI double staining showed that downregulation of Circ2977 significantly enhanced apoptosis. Figure 3 D). Subsequently, the migration and invasion abilities of cells transfected with siRNA were examined using Transwell and scratch healing assays. The results showed that knocking down Circ2977 expression significantly inhibited the migration and invasion abilities of SW480 and Caco2 cells. Figure 3E, F). The above results indicate that Circ2977 promotes the in vitro proliferation, migration, and invasion of CRC cells, and inhibits CRC cell apoptosis.

[0077] 2.4 Circ2977 promotes tumor growth and angiogenesis in vivo by inhibiting miR-874-3p.

[0078] To investigate the effects of Circ2977 and miR-874-3p on tumor growth and angiogenesis in vivo, SW480 cells treated with Circ2977 knockdown and an inhibitor of miR-874-3p expression (Antagomir), along with negative control cells, were injected into the axilla of 4-5 week old female nude mice. Figure 4 A). After 25 days of observation, the results showed that treatment with the Circ2977 knockdown group reduced the size and weight of the tumor, and the addition of the miR-874-3p inhibitor could partially reverse this effect. Figure 4 (BD). Additionally, we used paraffin sections prepared from subcutaneous tumors in nude mice for immunohistochemical staining to assess the expression levels of Ki-67, CD31, PAS+ / CD31-, VEGFA, VEGFR1, and SOX2 in tumor tissues. The results showed that in tumor tissues where Circ2977 was knocked down, the cell proliferation marker Ki-67, the angiogenesis-related molecule CD31 (the brown structure indicated by the black arrow), and the commonly used marker of angiogenesis, PAS, were significantly increased. + / CD31 - The expression of the purplish-red tubular structure (indicated by the black arrow) was decreased, while the addition of the miR-874-3p inhibitor promoted tumor growth and angiogenesis in tumor tissue, which could partially salvage the inhibitory effect of knockdown of Circ2977. Figure 4 E). Immunohistochemical results for VEGFA and SOX2 showed that knockdown of Circ2977 inhibited the expression of VEGFA, SOX2, and the VEGFA receptor VEGFR1, while the addition of a miR-874-3p inhibitor partially reversed this effect. Figure 4 F). Therefore, we can conclude that Circ2977 can promote the growth and angiogenesis of CRC in vivo through miR-874-3p.

Claims

1. The application of Circ2977 expression inhibitors in the preparation of drugs for treating colorectal cancer, characterized in that: The Circ2977 expression inhibitor is siRNA. Circ2977 regulates the expression of VEGFA and SOX2 by adsorbing miR-874-3p, thereby promoting the proliferation, migration, invasion, and angiogenesis of CRC colorectal cancer cells. The sequence of the siRNA is as follows: Justice chain sequence: 5'-GUUCUGCACUUACACAGGU-3', Antisense sequence: 5'-ACCUGUGUAAGUGCAGAAC-3'.

2. The application according to claim 1, characterized in that: The transcribed nucleotide sequence of Circ2977 is shown in SEQ ID NO.1.