Application of turnip crinkling virus P8 in inhibiting RNA silencing

Abstract

The invention provides an application of a turnip crinkling virus P8 in inhibiting RNA silencing, and the nucleotide sequence of the P8 gene is as shown in SEQ ID NO: 1. Researches find that P8 has a silent inhibition function and can inhibit mRNA (messenger ribonucleic acid) of GFP (green fluorescent protein) from being degraded, so that the expression quantity of GFP protein is increased; in addition, it is found that the P8 can also increase the number of particles of an arabidopsis thaliana mRNA degradation pathway Procness body (a compound formed by interaction of Dcp1 protein and Dcp2 protein), and research results lay a foundation for clarification of P8 functions.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of turnip crinkle virus P8 in inhibiting RNA silencing. Background Art

[0002] Viruses are obligate parasites that must evade or tolerate various antiviral defense mechanisms of host cells to successfully infect. How viruses evade or tolerate various host immune defense mechanisms, such as post-transcriptional genesilencing (PTGS), to enhance pathogenicity has been a research hotspot in recent years, with significant progress made. PTGS is a conserved gene expression regulatory mechanism in eukaryotes that plays an important role in developmental regulation, metabolism, maintaining genome stability, and responding to biotic and abiotic stresses. It is also a key antiviral immune mechanism. Plants have evolved multiple antiviral PTGS signaling pathways, involving different proteins and with distinct but overlapping functions. Viruses are obligate parasites that must evade or tolerate degradation by host cells to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the host's PTGS antiviral immunity. VSRs from different viruses have no sequence homology and no structural similarity, so their modes and mechanisms of action are also different.

[0003] Turnip crinkle virus ( Turnip crinkle virus, TCV) is a positive-sense single-stranded RNA virus belonging to the genus Carmovirus of the family Tombusviridae. It has an extremely wide host range and can infect almost all cruciferous plants and nearly 20 different plant families, causing leaf wrinkling, mottled and slightly twisted leaves, and sometimes more serious plant deformities or dwarfing, seriously endangering the production of important economic crops such as turnip and mustard. TCV encodes five proteins, namely P8, P9, P28, P88 and P38 (Carrington, JC, Heaton, LA, Zuidema, D., Hillman, BI, & Morris, TJ (1989). The genome structure of turnipcrinkle virus. Virology, 170(1), 219–226.). Among them, P8 and P9 encode movement proteins, while P28 and P88 proteins are responsible for replication and translation; recent studies have also found that P28 is also a key protein for the virus to repel repeated infection. P38 is not only a structural protein of TCV, encoding the coat protein (CP), but also a viral silencing suppressor. The mechanism by which CP inhibits host posttransfection gene scavenging (PTGS) and increases TCV viral accumulation and pathogenicity has been reported. Whether P8 has other functions has not been reported and remains under investigation. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of Turnip Crinkle Virus P8 in inhibiting RNA silencing.

[0005] The first aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in inhibiting GFP silencing; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1.

[0006] The second aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in inhibiting the degradation of GFP, improving its expression and / or increasing the accumulation level of GFP protein; wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1.

[0007] The third aspect of the present invention is to provide the use of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the P8 gene coding region in increasing the process body, wherein the nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1, the process body is a complex formed by the interaction of the Dcp1 protein and the Dcp2 protein, the nucleotide sequence of the gene encoding the Dcp1 protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the gene encoding the Dcp2 protein is shown in SEQ ID NO: 3.

[0008] The present study found that P8 has a silencing inhibitory function, which can inhibit the degradation of GFP mRNA, thereby increasing the expression of GFP protein. In addition, it was found that P8 can also increase the number of particles in the Arabidopsis mRNA degradation pathway process body (a complex formed by the interaction of Dcp1 protein and Dcp2 protein). The research results will lay the foundation for clarifying the function of P8. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 Figure 3. Fluorescence expression in transgenic Nicotiana benthamiana cells co-infiltrated with the single-chain green fluorescent protein (pG1300) and the P8 expression vector. pG1300: Plant expression vector expressing GFP; CP-HA: Plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: Plant expression vector pPTN-P8-HA expressing P8-HA; SalI: Plant expression vector pPTN-SalI containing only the HA tag; 16C: Transgenic Nicotiana benthamiana cells overexpressing GFP; 5 dpa: 5 days after Agrobacterium injection.

[0010] Figure 2 Western blot analysis of GFP protein accumulation in Nicotiana benthamiana leaves 5 days after infiltration with pG1300, pPTN-CP-HA, the empty vector pPTN-SalI, or pPTN-P8-HA. pG1300: plant expression vector expressing GFP; CP-HA: plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: plant expression vector pPTN-P8-HA expressing P8-HA; SalI: plant expression vector pPTN-SalI containing only the HA tag; 16C: transgenic Nicotiana benthamiana overexpressing GFP; 5 days after Agrobacterium injection; α-GFP: GFP antibody; CBB: Coomassie Brilliant Blue staining.

[0011] Figure 3RT-qPCR was used to detect the effect of P8 on GFP mRNA expression. GFP: GFP mRNA; CP-HA: plant expression vector pPTN-CP-HA expressing CP-HA; P8-HA: plant expression vector pPTN-P8-HA expressing P8-HA; SalI: plant expression vector pPTN-SalI containing only the HA tag.

[0012] Figure 4 P8 enhances the formation of process bodies in the Arabidopsis mRNA degradation pathway. YN-Dcp1: pYN-Dcp1, a fluorescent bimolecular plant expression vector expressing Arabidopsis Dcp1; Dcp2-YC: Dcp2-YC1, a fluorescent bimolecular plant expression vector expressing Arabidopsis Dcp2; P8-HA: pPTN-P8-HA, a plant expression vector expressing P8-HA; SalI: pPTN-SalI, a plant expression vector containing only the HA tag; α-HA: HA antibody; CBB: Coomassie Brilliant Blue staining. DETAILED DESCRIPTION

[0013] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0014] 1 Plant material 16C transgenic Nicotiana benthamiana N. benthamiana (Qu, F., Ren, T., & Morris, TJ(2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.).

[0015] 2 Experimental methods and results

[0016] 2.1 Construction of plant expression vectors (1) pPTN-CP-HA vector To construct a TCV CP containing a known silencing suppressor function (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 The plant expression vector pPTN-CP-HA (Liu, L., Wang,H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts withArabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) was used as a template and the full-length sequence of the target fragment CP was amplified using primers CP-1F SpeI and CP-1053R MluI (specific sequences are shown in Table 1).

[0017] The reaction system is as follows:

[0018] The reaction procedure is as follows:

[0019] The amplified product was double-digested with SpeI and MluI and then compared with pPTN-SalI (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) The large fragment of the vector was connected, and the ligation product was transformed into Escherichia coli. The positive clone was identified by PCR and sequencing and named pPTN-CP-HA.

[0020] (2) pPTN-P8-HA vector The construction of pPTN-P8-HA was based on the reported TCV sequence (GenBank: NC_003821.3). Shanghai Sangon Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment P8-XbaI & SacI (see Table 2 for the specific sequence). The synthesized fragment and the pPTN-SalI vector were double-digested with XbaI and SacI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed by PCR and sequencing and named pPTN-P8-HA.

[0021] (3) YN-Dcp1 vector The construction of YN-Dcp1 was based on the reported Arabidopsis Dcp1 sequence (AT1G08370.1). Primers AtDcp1-1FSpeI and AtDcp1-1104R KpnI (specific sequences are shown in Table 1) were used to amplify AtDcp1 using Arabidopsis cDNA as a template. The reaction system and reaction procedure were the same as those described in 2.1 (1).

[0022] The PCR product was double-digested with SpeI and KpnI and ligated with the large fragment of pGN1 (Liu, L., Wang, H.,Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts withArabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) recovered by the same double enzyme digestion. The positive clone was confirmed by sequencing and named YN-Dcp1.

[0023] (4) Dcp2-YC vector The construction of Dcp2-YC was based on the reported Arabidopsis Dcp2 sequence (AT5G13570.2). Primers AtDcp2-1FSpeI and AtDcp2-1161R KpnI (specific sequences are shown in Table 1) were used to amplify AtDcp2 using Arabidopsis cDNA as a template. The reaction system and reaction procedure were the same as those described in 2.1 (1). The PCR product was double-digested with SpeI and KpnI and ligated with the large fragment of p2GC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K.,& Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencinginteracts with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.) recovered by the same double enzyme digestion. The positive clone was confirmed by sequencing and named Dcp2-YC.

[0024] Table 1 Primers used Primer Name Sequence CP-1F SpeI ATGGAAAATGATCCTAGAGTC CP-1053R MluI CCCGGGAATTCTGAGTGCTTGCCATTTAC qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT AtDcp1-1F SpeI ATGTCTCAAAACGGGAAGATAAT AtDcp1-1104R KpnI TTGTTGAAGTGCATTTTGTAAAGTT AtDcp2-1F SpeI ATGTCGGGCCTCCATCGAT AtDcp2-1158R KpnI TCAAGCTGAATTACCAGATTCCAAC Note: Italic bold letters are enzyme cutting sites.

[0025] Table 2 Target fragment sequences Fragment Name Sequence (5′–3′) P8-XbaI & SacI ATGGATCCTGAACGAATTCCCTACAACTCTCTAAGCGACAGCGACGCAACAGGAAAACGGAAGAAAGGCGGAGAGAAAAGTGCGAAGAAGAGATTGGTAGCTAGCCACGCGGCTAGCTCTGTTTTAAACAAGAAAAGAAATGAAGGTTCTGCTAGTCACGGGGGTACTTGGGTTATTGTTGCTGATAAAGTGGAAGTCTCAATCAACTTCAACTTCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTATTAA Note: Italic bold letters are enzyme cutting sites.

[0026] 2.2 Detection of P8 silencing suppression function

[0027] 2.2.1 Observation of P8 silencing suppression function The single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W.,Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 toenhance virus infection. Molecular plant pathology, 24(2), 154–166) and the empty vector pPTN-SalI (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnipcrinkle virus suppresses posttranscriptional gene silencing at an earlyinitiation step. Journal of virology , 77 (1), 511–522.) are all preserved in our laboratory.

[0028] (1) Transformation of recombinant plasmid into Agrobacterium (GV3101) competent cells Transform Agrobacterium GV3101 competent cells with the plant expression vectors pG1300, pPTN-SalI, pPTN-CP-HA, and pPTN-P8-HA, respectively, according to the GV3101 Chemically Competent Cell product instructions. Resuspend the cells after transformation and spread them evenly on LB plates containing the corresponding antibiotics (pG1300 on LB plates containing Kan and Rif resistances, pPTN-SalI, pPTN-CP-HA, and pPTN-P8-HA on LB plates containing Spec and Rif resistances). Incubate the cells upside down at 28°C in a constant temperature incubator for 72-90 hours. After 2-3 days, grow 2-3 mm Agrobacterium colonies, and select individual colonies for PCR identification.

[0029] (2) Infiltration of transgenic 16C Nicotiana benthamiana The resuspended Agrobacterium containing the recombinant vector was mixed and injected into transgenic 16C Benthamina leaves. The operation steps are as follows: (a) Use a pipette tip to pick a single colony that has been identified as positive by colony PCR and transfer it to 5 ml of LB liquid medium containing the corresponding antibiotics. Place it in a constant temperature shaker at 28°C and 200 rpm for overnight culture.

[0030] (b) The bacterial solution was centrifuged at 7000 rpm for 15 min and the supernatant was discarded.

[0031] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0032] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the pellet to an OD600 of 0.5.

[0033] (e) After the diluted bacterial solution has been allowed to stand at room temperature for 2-3 h, mix it in a 1:1 volume ratio according to the desired mixture (see Table 3 for specific combinations).

[0034] (f) Take transgenic 16C Benthani plants that are growing vigorously and at the 5-7 leaf stage and inject them into the leaves with good growth, about 2 cm deep, using a 1 mL syringe. 2 All the combinations were injected on the same leaf, 10 leaves were injected, and the injected Nicotiana benthamiana were kept in the dark overnight and then cultured under normal conditions.

[0035] (g) Five days after injection, GFP fluorescence expression in each combination was observed using a handheld fluorescent protein observation lamp (LUYOR-3415RG) equipped with LUV-30A yellow glasses under blue excitation light (495 nm) and photographed. After the photographs were taken, the infected area of ​​the tobacco was circled with a marker.

[0036] The results are as follows Figure 1 As shown, the results are Figure 1 As shown in the figure, leaves co-infiltrated with pPTN-P8-HA or pPTN-CP-HA showed strong GFP fluorescence, while leaves co-injected with pPTN-mAC2-HA or the empty vector pPTN-SalI showed only weak fluorescence. This preliminarily indicates that P8, like the known silencing suppressor CP, inhibits GFP silencing and has silencing suppression function. Figure 1 As shown, leaves co-infiltrated with pPTN-P8-HA or pPTN-CP-HA showed strong GFP fluorescence, while tobacco leaves co-injected with pPTN-mAC2-HA or empty vector pPTN-SalI were only weakly fluorescent. It was preliminarily judged that P8, like the known silencing suppressor CP, inhibited GFP silencing and had silencing suppression function.

[0037] Table 3 Combinations of different plasmids injected into 16C Nicotiana benthamiana by Agrobacterium

[0038] 2.2.2 Western blot analysis of the effect of P8 on GFP protein expression On the fifth day, total protein was extracted from tobacco leaves injected with the different combinations described above, and Western blot analysis was performed to detect GFP protein expression to verify the fluorescence observation results. Plant total protein extraction and Western blot analysis were performed as described in the literature (Liu Linyu's master's thesis, "Cassava Mosaic Virus Silencing Suppressor AC4 Hijacks UPF1 to Promote Viral Infection").

[0039] The results are as follows Figure 2 As shown in the figure above, samples co-infiltrated with pG1300 and pPTN-P8-HA or pPTN-CP-HA showed high GFP protein accumulation, while samples co-infiltrated with the empty vector pPTN-SalI showed weak GFP signal bands. Rubiso Coomassie Brilliant Blue staining showed that the loading amount was basically the same ( Figure 2 (Figure below). WB detection results confirmed the fluorescence observation results, indicating that P8 has the function of inhibiting GFP degradation and increasing its expression.

[0040] 2.2.3 Real-time fluorescence quantitative detection of the effect of P8 on GFP mRNA expression Total RNA was extracted from tobacco plants according to the instructions for Tiangen's TRNzol Universal Total RNA Extraction Reagent. The RNA samples were then reverse transcribed using a two-step method, according to the instructions for the reverse transcription kit. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using the resulting cDNA sample as a template, qNbActin-128F and qNbActin-256R as internal reference primers, and qsGFP-306F and qsGFP-519R as GFP detection primers. The results are shown in Figure 2. Figure 3 As shown, consistent with the Western Blot results, the samples co-infiltrated with pPTN-P8-HA or pPTN-CP-HA all had high GFP protein accumulation levels, while the GFP signal band of the sample co-infiltrated with the empty vector pPTN-SalI was weak.

[0041] 2.2.4 P8 enhances the formation of process bodies in the Arabidopsis mRNA degradation pathway The complex formed by the interaction of Dcp1 and Dcp2 is called Process body. We used fluorescent bimolecular complementation experiments to observe the fluorescent particles that form Process body through the interaction between Dcp1 and Dcp2 to study the effect of P8 on Dcp1 and Dcp2Whether it has an inhibitory silencing effect, the specific method is as follows: first, use the method of 2.2.1 (1) to transform the expression vector into Agrobacterium; secondly, refer to the method of 2.2.1 (2) to inject the recombinant plasmids of the two combinations in Table 4 into wild-type Nicotiana benthamiana for expression; then, on the third day after the injection, take about 1-2 cm2 of each sample and use a laser confocal microscope (Olympus FV3000) to observe the fluorescence of tobacco cells. The GFP excitation light is 488 nm, and protein extraction and Western blot detection are performed.

[0042] The results are as follows Figure 4 As shown in a, the number of Process body fluorescent particles co-expressed with pPTN-P8-HA was significantly greater than that of tobacco leaves co-injected with the empty vector pPTN-SalI, and Figure 4 Western blot analysis in b showed that P8 was expressed, indicating that the increase in process bodies was caused by P8. This result further proves that P8 has a silencing inhibitory function.

[0043] Table 4 Combinations of wild-type Nicotiana benthamiana injected with different plasmids by Agrobacterium

[0044]

[0045] While the specific embodiments of the present invention have been described in detail above, these are intended to be exemplary only, and the present invention is not limited thereto. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention are intended to be encompassed within the scope of the present invention.

Claims

1. Application of P8 gene, or protein encoded by P8 gene, or recombinant vector or host bacteria containing the coding region of P8 gene in increasing the expression of GFP and / or inhibiting GFP silencing; wherein, The nucleotide sequence of the P8 gene is shown in SEQ ID NO:

1.

2. Application of the P8 gene, or the protein encoded by the P8 gene, or a recombinant vector or host bacteria containing the coding region of the P8 gene to inhibit the degradation of GFP, improve its expression and / or increase the accumulation of GFP protein levels; wherein, The nucleotide sequence of the P8 gene is shown in SEQ ID NO:

1.

3. Use of P8 gene, or protein encoded by said P8 gene, or recombinant vector or host bacteria containing said P8 gene coding region in increasing process body, wherein: The nucleotide sequence of the P8 gene is shown in SEQ ID NO: 1, the Processbody is a complex formed by the interaction of the Dcp1 protein and the Dcp2 protein, the nucleotide sequence of the gene encoding the Dcp1 protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the gene encoding the Dcp2 protein is shown in SEQ ID NO: 3.

Images