Specific cell population analysis and screening method based on RCA-FISH and application thereof

Abstract

The invention discloses a specific cell population analysis and screening method based on RCA-FISH and application of the specific cell population analysis and screening method. A target sequence region which is high in hybridization efficiency, high in specificity and free of an RNA advanced structure is screened out from an RNA sequence of a cell or tissue to be detected to design a primary hybridization probe, and the primary hybridization probe is composed of a lock-type probe and an RCA initiation probe; the method comprises the following steps: pre-treating a primary probe, hybridizing, carrying out a probe cyclization connection reaction, amplifying a signal by rolling circle amplification, and labeling cells by a fluorescent probe, so as to be used for flow cytometry analysis / sorting. The invention has the characteristics of simple probe preparation, high detection efficiency, strong specificity, strong signal amplification and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a method for analyzing and screening a specific cell population based on RCA-FISH and an application thereof. Background Art

[0002] Flow-FISH combines flow cytometry with fluorescence in situ hybridization, and simultaneously performs high-throughput, multi-parameter analysis of intracellular RNA and surface antigen expression, and can simultaneously analyze complex cell phenotypes of multiple cells. The antibodies used in flow cytometry analysis are highly specific to specific immune cell surface markers. In the past, due to the complexity of immune cell phenotypes and the limited availability of specific immune cell markers, effective antibodies for non-model animals were scarce. Flow-FISH technology can make up for the lack of antibodies or limited application, and is not limited by species tissues. It can be analyzed based on the RNA level, including non-coding RNA, has high throughput, simple probe design, and can perform multiple detections. The current mainstream Flow-FISH technology uses single-molecule flow FISH with single or multiple probes, but due to probe limitations, strong background, limited signal amplification, it is not friendly to genes with low expression levels, and has low detection sensitivity. The specific cell population analysis / sorting technology based on rolling circle amplification (RCA) hybridization signal amplification has the characteristics of simple probe preparation, high detection efficiency, strong specificity and strong signal amplification, which makes up for the shortcomings of traditional Flow-FISH.

[0003] Flow cytometry is a technology that identifies cell subtypes based on cell surface specific markers. It has high sensitivity, strong specificity, simple operation, and can simultaneously identify cell subtypes in the specimen in real time. Flow cytometry has been widely used in various research fields, with significant advantages such as fast detection speed, high accuracy, high throughput, automated operation process, and intelligent data analysis. The number of cells analyzed for each sample is large, the sample volume is small, and the throughput is high, which can be used to examine cell viability, structure or function. RCA-FISH is suitable for the detection method and application of the spatial location information of the transcriptome sequenced. This method uses hybridization probe design, probe pretreatment, sample hybridization, ligation reaction, and rolling circle amplification. It only takes 4 rounds of ligation sequencing to interpret the in situ spatial transcriptional expression profiles of tens of thousands of genes. It can achieve high-throughput in situ gene interpretation with single-cell, single-molecule, and single-base resolution.

[0004] Compared with antibody-based flow, Flow-FISH allows for the simultaneous detection of mRNA and cell surface markers, which can overcome the limitations of flow antibodies and indicate changes in gene expression through dynamic changes in mRNA. FISH-FLOW technology can automate part of the FISH technology and perform quantitative analysis of cells in suspension. It can label non-coding RNAs that antibodies cannot do, visualize and quantify individual cells. It is also possible to examine nucleotide sequences without changing the morphology of cells. Due to the advantages of Flow-FISH as a high-throughput method, the technology has been successfully applied to clinical, environmental and food microbiology. In addition, Flow-FISH also allows for in-depth phenotypic analysis of cells by combining RNA measurements with (labeled) probes or probe sets and protein measurements using (labeled) antibodies suitable for flow cytometry. At the same time, there are some limitations on fluorescent dyes coupled to antibodies suitable for Flow-FISH. Compared with ordinary microscope-based FISH, multicolor flow cytometry allows a higher degree of multiplexing, allowing for more in-depth characterization.

[0005] One of the most commonly used types of Flow-FISH assays for detecting microbial genetic information is single-probe Flow-FISH. This method is suitable for detecting DNA, miCroRNA, and (m)RNA. Since only one probe is used, single-probe Flow-FISH requires high sequence specificity and probe affinity for the target gene. Typically, locked nucleic acids (LNA) and peptide nucleic acids (PNA) are used for this type of Flow-FISH assay. LNA and PNA probes allow for higher hybridization temperatures, enhancing probe specificity. Single-molecule FLOW-FISH probes are 20-nucleotide-long single-stranded oligo(DNA) nucleotides that utilize multiple probes and are suitable for detecting microRNAs and (m)RNAs. These probe sets custom-designed for target or microorganism of interest can be directly labeled at the 5' or 3' end, or they can be custom-labeled in-house to be incorporated into established flow cytometry groups based on the needs of the researcher. However, this method cannot perform signal amplification, which limits the detection of low-expressed genes. Secondly, there is not enough surface space for short-sequence transcripts to hybridize with the probe. Finally, since single-molecule probes cannot effectively avoid nonspecific binding, the signal-to-noise ratio is low. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for analyzing and screening specific cell populations based on RCA-FISH and its application. The method of the present invention specifically hybridizes the primary hybridization probe to multiple transcripts in suspended cells; amplifies the barCode information carried by each transcript in situ by rolling circle amplification; then uses fluorescent probes labeled with fluorescent molecules corresponding to the barCode to fluorescently label different cells; finally, relies on a flow cytometer system to analyze or sort complex samples. Compared with the existing FLOW-FISH technology, the present invention has the characteristics of low cost, high hybridization efficiency and strong specificity.

[0007] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0008] The present invention provides a method for analyzing and screening a specific cell population based on RCA-FISH, comprising the following steps:

[0009] (1) Design and preparation of primary probes

[0010] Screening out target sequence regions with high hybridization efficiency, strong specificity and no RNA higher-order structure from the RNA sequence to be detected to design hybridization primary probes; the primary probes are composed of padlock probes and RCA initiation probes;

[0011] (2) Probe pretreatment

[0012] The 5' end of the padlock probe in the primary probe is phosphorylated; the 5' end phosphorylated padlock probe is then gradient annealed with the RCA priming probe;

[0013] (3) Primary probe hybridization

[0014] The tissue was fixed with paraformaldehyde, then permeabilized with formaldehyde and pepsin, and a hybridization buffer containing a primary probe was prepared and added to the reaction chamber for overnight hybridization;

[0015] (4) Probe cyclization reaction

[0016] The hybridization buffer in the previous step is removed by centrifugation, and after thorough washing, the ligase reaction system is added to the enriched sample for ligation reaction, so that the padlock probe is complementary to the target sequence on the corresponding RNA to form a semi-closed ring structure;

[0017] (5) Rolling circle amplification signal

[0018] The polymerase uses the RCA priming probe as a primer and the circular structure of the padlock probe as a template to perform rolling circle amplification, further amplifying the signal (the RCA priming probe is complementary to both the target sequence on the RNA and the padlock probe);

[0019] (6) Fluorescent probe labeling of cells

[0020] The secondary probe labeled with the desired fluorescent molecule is synthesized to be the fluorescent probe;

[0021] Incubate the fluorescent probe with the sample after the signal is amplified in step (5) (to label the cells with fluorescence), pass through a cell screen, and dilute, and then use for flow cytometric analysis / sorting;

[0022] (7) How to analyze and sort

[0023] Cells were washed twice with PBS / 0.1% BSA, resuspended in PBS / 0.1% BSA, and acquired on a cytoflex-LXcytoflex-LX at Beckman Co.’s Flow Cytometry Core Facility; data were first manually gated to remove debris and aggregates using FlowJo v10.8.0 and CytExpert; UMAP followed by FlowSOM were performed to visualize and cluster the data.

[0024] Furthermore, in the step (1), the target sequence of the RNA sequence to be detected consists of three consecutive target sequences A, b and C, and the padlock probe comprises an A' sequence, a loop sequence and a b' sequence from the 5' end to the 3' end, wherein the A' sequence and the b' sequence are complementary to the target sequence A and the target sequence b, respectively, so that the padlock probe forms a semi-closed ring structure after complementary pairing with the target sequence; the RCA priming probe consists of two sequences, one of which is a region complementary to the target sequence, and the other is complementary to the middle region on the padlock probe, forming a primer for rolling circle amplification.

[0025] Furthermore, the loop sequence is composed of an anchor sequence and a barcode sequence, respectively. The barcode sequence is a general term for two barcode sequences, namely, a barcode1 sequence and a barcode2 sequence; and the barcode sequence is complementary to the fluorescent probe.

[0026] Furthermore, in the step (2), the enzyme used in the phosphorylation process is T4 polynucleotide kinase.

[0027] Furthermore, in the step (3), the concentrations of the components in the hybridization buffer system containing the primary probe (the reaction volume can be expanded according to actual conditions, but the concentrations of the components should remain unchanged) are as follows: 10% formamide: 20 μL; 2xSSC: 20 μL; 1% Tween-20: 2 μL; 20 mM RVC: 20 μL; 0.1 mg / ml salmon sperm DNA: 2 μL; annealed PLP&RCA probes: 42 μL; DEPC-H2O: 94 μL; total system: 200 μL.

[0028] Furthermore, in step (4), the ligase in the ligase reaction system is SplinTR ligase.

[0029] Furthermore, in step (5), the polymerase is Phi29 DNA polymerase.

[0030] The present invention also provides an application of the above RCA-FISH-based cell population analysis and screening method in flow analysis for detecting 293T cells infected with different adeno-associated viruses.

[0031] The present invention also provides an application of the above RCA-FISH-based cell population analysis and screening method in flow analysis of detecting specific cell populations in the prefrontal lobe and hippocampus tissues of mouse brain.

[0032] Furthermore, the brain is any one of mouse brain, human brain and pig brain.

[0033] The present invention also provides an application of the above RCA-FISH-based cell population analysis and screening method in flow analysis for detecting specific immune cell populations in pig blood PBMC.

[0034] Principle of the present invention:

[0035] (1) Design of primary probe: Figure 1 As shown, the target sequence of the RNA sequence consists of three consecutive target sequences A, b and C, and the padlock probe is A' sequence, loop sequence and b' sequence from 5' end to 3' end, and the A' sequence and b' sequence are complementary to the target sequence A and target sequence b respectively, so the padlock probe forms a semi-closed ring structure after complementary pairing with the target sequence (depending on the ligase to recognize the bases of the 5' end and 3' end of the hybridization probe that are precisely complementary to the target sequence. If there is a point mutation or RNA methylation at either end, it cannot be connected and closed into a ring). The loop sequence is composed of an anchor sequence and a barcode sequence (barcode sequence is a general term for two barcode sequences, namely barcode1 sequence and barcode2 sequence). The barcode sequence is complementary to the secondary probe. The priming chain is used for rolling circle amplification, the C' segment sequence is complementary to the C target sequence, and the rest is complementary to the padlock probe.

[0036] (2) The following five principles should be followed when designing probes: 1. The target sequence needs to be within the exon of the coding region; 2. The predicted value of the RNA higher-order structure in the selected region should be less than 10; 3. The predicted value of the secondary structure between probes should be less than 8; 4. The difference in Tm values ​​between target sequences cannot exceed 10; 5. The target sequence should maintain high specificity with other transcript sequences.

[0037] (3) Principle of fluorescent probe labeling: Figure 2 As shown, the fluorescent probe belongs to the secondary probe, and its sequence is complementary to the barcode region of the primary probe, and the corresponding fluorescent molecule is labeled on the DNA molecule.

[0038] Beneficial effects of the present invention:

[0039] (1) The present invention combines flow cytometry with fluorescence in situ hybridization to simultaneously analyze the RNA and surface antigen expression in cells, allowing high-throughput, multi-parameter analysis and simultaneous analysis of complex cell phenotypes of many cells.

[0040] (2) The present invention only needs to label the target cell population based on the specific RNA sequence of the target cell population. Compared with antibody-based flow cytometry, Flow-FISH allows the simultaneous detection of mRNA and cell surface markers, which can overcome the limitations of flow cytometry antibodies and the analyzed mRNA has a faster and more dynamic gene expression response. Therefore, it also breaks through the limitation of model species. Any species and any gene can be fluorescently labeled.

[0041] (3) Based on the existing massive single-cell transcriptome data, marker genes can be flexibly selected according to the cell groups annotated by bioinformatics, and target cell groups and subgroups can be analyzed / isolated for downstream basic research. The present invention does not require the activity of cells in the sample, and the use of the present invention to study infected samples does not rely on a high-level biosafety laboratory.

[0042] (4) The present invention retains intact cells and solves the problem of flattening of the original three-dimensional (or spherical) interphase nuclei during air drying for FISH on a glass slide, which affects the development of downstream research. Due to the DNA properties of the fluorescent probe, it is also easier to transport and store than fluorescent antibodies.

[0043] (5) The RCA-FISH technology of the present invention uses two rounds of hybridization to label fluorescence, so the primary probe can be ignored in the color matching of fluorescent molecules. Only a set of feasible fluorescent probes need to be designed for the commonly used flow cytometer, which is flexible; the biological preparations used in the present invention are simple, and the operating procedures do not require high hardware equipment, which is extensible; the present invention is based on molecular hybridization technology to fluorescently label cells, and the target sequence can be any single-stranded nucleic acid molecule, which has a wider application field. The detection accuracy of the present invention can reach the single base level, and the sensitivity can reach the single molecule level. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Design schematics for primary probes;

[0045] Figure 2 Schematic diagram of fluorescent probe labeling;

[0046] Figure 3 It is a schematic diagram of the operation process;

[0047] Figure 4 Figure 2 is the flow cytometry analysis result of 293T cells infected with different AAVs;

[0048] Figure 5 Fluorescence microscopic imaging of 293T cells infected with different AAVs;

[0049] Figure 6 This is a flow cytometry analysis result of specific cell populations in the prefrontal cortex and hippocampus of mouse brain;

[0050] In the picture, the left picture shows the prefrontal cortex tissue, and the right picture shows the hippocampus tissue;

[0051] Figure 7 This is a flow cytometry analysis result of T cell population in pig PBMC;

[0052] Figure 8 The figure shows the flow cytometry analysis results of B cell population in pig PBMC. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0054] The method for analyzing and screening specific cell populations based on RCA-FISH, the operation flow diagram is shown in Figure 3 As shown, the following steps are included:

[0055] 1. Preprocessing of active samples (can be adjusted according to sample attributes):

[0056] This method can be applied to any active sample. Before pretreatment, suspended cell samples can be obtained by red blood cell lysis, density gradient centrifugation, tissue enzymatic dissociation and other methods;

[0057] (1) Cell fixation;

[0058] (2) Cell dehydration;

[0059] (3) Cell permeabilization;

[0060] (4) Cellular enzyme permeability;

[0061] (5) Enzyme reaction terminates.

[0062] 2. Design and preparation of primary probes

[0063] A target sequence region with high hybridization efficiency, strong specificity and no RNA high-order structure is screened from the RNA sequence of the cells or tissues to be detected to design a hybridization primary probe, wherein the primary probe is composed of a padlock probe and an RCA priming probe; the padlock probe is composed of three sequences, each of which contains a 13bp sequence complementary to the target sequence at both ends and a 30bp barcode bidirectional sequencing sequence in the middle; the RCA priming probe is composed of two sequences, one of which is a region complementary to the target sequence, and the other is complementary to the middle region on the padlock probe to form a primer for rolling circle amplification.

[0064] 3. Probe Pretreatment

[0065] The 5' end of the padlock probe in the primary probe was phosphorylated by T4 PNK and annealed to the initiating strand.

[0066] 4. Primary Probe Hybridization

[0067] The pre-treated suspended sample was enriched at the bottom of the centrifuge tube by centrifugation, the supernatant was discarded and the sample was thoroughly washed with DEPC-treated buffer, a buffer containing the primary probe was prepared and added to the centrifuge tube, mixed thoroughly and incubated overnight.

[0068] 5. Probe Circularization Ligation Reaction

[0069] Discard the reaction buffer from the previous step by centrifuging and discarding the supernatant. After thorough washing, The LiGAse ligase reaction system is added to the centrifuge tube enriched with the sample for ligation reaction, so that the padlock probe is complementary to the target sequence on the corresponding RNA to form a semi-closed ring structure.

[0070] 6. Rolling circle amplification

[0071] The RCA priming probe is complementary to the target sequence and the padlock probe on the RNA at the same time. The Phi29 DNA polymerase uses the RCA priming probe as a primer and the circular structure of the padlock probe as a template to perform rolling circle amplification to further amplify the signal.

[0072] 7. Fluorescent probe labeling of cells

[0073] According to the configuration of the flow cytometer used (including lasers and detectors), the corresponding fluorescent molecules are selected to synthesize secondary probes labeled with the required fluorescent molecules, which are fluorescent probes.

[0074] Incubate the multicolor fluorescent probe with the cell sample after amplifying the signal in the previous step to label the cells with fluorescence, which can be used for flow cytometry analysis / sorting. The obtained samples can be used for downstream analysis.

[0075] Since RCA amplifies the fluorescence signal, the resulting samples can also be used for fluorescence imaging analysis.

[0076] Based on the above method, the following tests are performed according to the actual situation:

[0077] Example 1

[0078] Flow cytometry analysis of 293T cells infected with different adeno-associated viruses (AAV)

[0079] 1. Pretreatment of active samples

[0080] (1) Sample source: There is a batch of 293T cell line samples, which are infected with two AAVs expressing different mRNA sequences and do not express specific proteins. The two 293T cells infected with AAV can be separated by this method; the enriched cells are fixed with 4% DEPC-PFA for 10-30 min;

[0081] (2) Methanol was precooled at -20°C, cells were fixed with 100% methanol at -20°C for 10 min, centrifuged at 500 × g for 5 min, and washed once with DEPC-PBSTR;

[0082] (3) Fix with 4% PFA for 5 min, centrifuge at 500 × g and discard the supernatant, wash once with 1 mL DEPC-PBSTR, and aspirate as much supernatant as possible after centrifugation;

[0083] (4) Add 500 μL 0.1 M hydrochloric acid to rinse once, then add 500 μL 0.1 M hydrochloric acid to permeabilize for 5 min, and wash twice with PBSTR to obtain a pretreated cell sample.

[0084] 2. Design and preparation of primary probes

[0085] The primary probe consists of a padlock probe and an RCA priming probe; the padlock probe consists of three sequences, with 13bp sequences complementary to the target sequence at both ends and a 30bp barcode bidirectional sequencing sequence in the middle; the RCA priming probe consists of two sequences, one of which is a region complementary to the target sequence and the other is complementary to the middle region on the padlock probe, forming a primer for rolling circle amplification.

[0086] The following probes were designed for the mRNA sequences contained in the sample:

[0087]

[0088]

[0089] 3. Probe Pretreatment

[0090] The 5' end of the padlock probe was phosphorylated using T4 polynucleotide kinase. The reaction system is shown in Table 1. The reaction volume can be expanded, but the concentration of each component should remain unchanged.

[0091] Table 1 Phosphorylation reaction system

[0092] Components content T4 Polynucleotide Kinase(10U / μL) 1μL 10×T4 PNK Buffer 1μL PLP probe (100 μM) 8μL Overall system 10μL

[0093] In addition, RCA Primer was added and probe annealing was performed on a PCR instrument. The reaction system was shown in Table 2. The reaction volume could be expanded, but the concentration of each component should remain unchanged. The reaction procedure was shown in Table 3.

[0094] Table 2 Reaction system

[0095]

[0096]

[0097] Table 3 Reaction procedure

[0098] 95℃ 5min 95℃-25℃ Gradient cooling 0.1℃ / s 25℃ 3min

[0099] 4. Primary Probe Hybridization

[0100] The treated cell samples were washed 3 times with PBSTR (0.1% Tween-20, 0.2U / μL SplintR in PBS), 5min each time. The primary probe was added to the hybridization buffer, and the hybridization reaction system was mixed and added to the reaction chamber. The hybridization reaction system is shown in Table 2. The reaction volume can be expanded, but the concentration of each component should remain unchanged. The reaction system was added to the treated cell samples, mixed thoroughly, and incubated at 37°C overnight.

[0101] Table 2 Hybridization reaction system

[0102] Components content 10% formamide 20μL 2xSSC 20μL 1% Tween-20 2μL 20mM RVC 20μL 0.1mg / ml salmon sperm DNA 2μL annealed PLP&RCA probes(100nM) 0.5×2×42μL <![CDATA[DEPC-H 2 The]]> 94μL Overall system 200μL

[0103] 5. Probe Circularization Ligation Reaction

[0104] After overnight incubation, the samples were washed twice with PBSTR, mixed and washed at room temperature, each time for 5 min; washed with PBSTR-4×SSC at 25°C for 5 min, and washed once with PBSTR to obtain cell samples hybridized with the primary probe; The ligase reaction system is mixed evenly. The ligase reaction system is shown in Table 3. The reaction volume can be expanded, but the concentration of each component should remain unchanged. The reaction system is added to the cell sample hybridized with the primary probe, placed at 25°C, and reacted for 2 hours.

[0105] Table 3 Ligase reaction system

[0106] Components content SplinR (1∶25 dilution) 8μL 1X SplinR buffer 20μL 0.2 μg / μl BSA 2μL 0.2U / μl SUPERase-In 1μL DEPC-H2O 169μL Overall system 200μL

[0107] 6. Rolling circle amplification

[0108] Step 5: Wash the cell samples after the reaction with PBSTR (0.1% Tween-20, 0.1U / μL SUPERase·In in PBS) for 3 times, 5min each time. Mix the phi29 DNA polymerase rolling circle extension reaction system. The rolling circle replication amplification system is shown in Table 4. The reaction volume can be expanded, but the concentration of each component should remain unchanged. Add the reaction system to the treated cell sample, mix thoroughly and incubate at 30°C overnight.

[0109] Table 4 Rolling circle replication amplification system

[0110]

[0111]

[0112] VII. Hybridization fluorescent probe

[0113] The cell samples incubated overnight in step 6 were washed once with PBSTR, fixed with PFA for 10 minutes, and washed twice with PBST; the fluorescent probe was supplemented to 100 μL with PBST, added to the cell samples, incubated at 37°C for 30-50 minutes, and washed twice with PBST to obtain fluorescently labeled cell samples.

[0114] 8. Flow Cytometry Analysis

[0115] The fluorescently labeled cell samples are passed through a cell sieve and diluted to the required density before flow cytometric analysis.

[0116] Figure 4 and Figure 5 The following are flow cytometry results and fluorescence microscopy images of 293T cells infected with different AAVs. This technology can effectively separate the two types of 293T cells infected with AAVs. The fluorescence results after hybridization and the flow cytometry analysis results are shown in the figure. In all flow cytometry experiments, gating analysis is first performed based on the forward scatter and side scatter (FSC-A and SSC-A) characteristics. The positive population in the B525-FITC channel represents AAV expressing the rtTA sequence, while the positive population in the R660-APC channel corresponds to AAV expressing chr2.

[0117] Example 2

[0118] Flow cytometry analysis of specific cell populations in the prefrontal cortex and hippocampus of mouse brain

[0119] 1. Pretreatment of active samples

[0120] (1) Sample source: The prefrontal cortex and hippocampus tissues of mouse brain were separated in artificial cerebrospinal fluid, and the sample digestion solution containing papain was added, and the samples were enzymatically digested in a 34°C water bath for 30 min, and then dispersed and separated using a quenched Pasteur tube; the tissue blocks were dispersed into suspended cells; after impurities were filtered out using a cell sieve, 4% DEPC-PFA was added for fixation;

[0121] (2) The fixed cells were dehydrated with pre-cooled 100% methanol at -20°C for 30 min, centrifuged at 500 × g for 5 min, and washed once with DEPC-PBSTR;

[0122] (3) Fix again with 1 mL of 4% PFA for 10 min, centrifuge at 500 × g and discard the supernatant, wash once with 1 mL of DEPC-PBSTR, and aspirate as much supernatant as possible after centrifugation;

[0123] (4) Rinse once with 500 μL 0.1 M hydrochloric acid, permeabilize for 10 min with 500 μL 0.1 M hydrochloric acid, and wash twice with PBSTR;

[0124] (5) Prepare digestion solution (including 2 μg / mL proteinase K) in advance, add the digestion solution to the cell sample, treat at 37°C for 5 min, immediately place on ice, centrifuge at 4°C and discard the supernatant, wash three times with PBSTR to obtain the pretreated cell sample.

[0125] 2. Design and preparation of primary probes

[0126] The primary probe consists of a padlock probe and an RCA priming probe; the padlock probe consists of three sequences, with 13bp sequences complementary to the target sequence at both ends and a 30bp barcode bidirectional sequencing sequence in the middle; the RCA priming probe consists of two sequences, one of which is a region complementary to the target sequence and the other is complementary to the middle region on the padlock probe, forming a primer for rolling circle amplification.

[0127] The following probes were designed for the target gene sequence we were interested in:

[0128] Probe No. Probe sequence GAD1-PLP-1 GCATCCTTGGAGTACCATGCTGGATCTAGAACCATGCTGGATCTAGCACATCTGGTT GAD1-RCA-1 GAAGAGGTAGCCTACTAGATCCAGCATG GAD1-PLP-2 GTCAACCAGGATCACCATGCTGGATCTAGAACCATGCTGGATCTAGGGGTGTCTCTACA GAD1-RCA-2 AACCCCGTACTTCACTAGATCCAGCATG Tmem119-PLP-1 AGCACCTCTTCCTTACTAGCTCGATTCAAATACTAGCTCGATTCAACTCCTGACCGCTG Tmem119-RCA-1 GCTTCCTGGGCCTGTTGAATCGAGCTAG Tmem119-PLP-2 TTCAGTGACCCCATACTAGCTCGATTCAAATACTAGCTCGATTCAATTGAATCGAGCTAG Tmem119-RCA-2 CGACTCCTCTGGGTTTGAATCGAGCTAG

[0129] 3. Probe Pretreatment

[0130] Phosphorylated probe: Dry powder probe (EP tube) was centrifuged at 12,000 rpm for 2 min, and then precipitated with DEPC-H 2 The probe was diluted with O, and the PLP probe sequence was incubated in T4 PNK, T4 Ligase Buffer at 37°C for 30 min and 72°C for 10 min. RCA Primer was also added and the probe was annealed on a PCR instrument. The reaction system and procedure were the same as in Example 1.

[0131] 4. Primary Probe Hybridization

[0132] Prepare 2 μg / ml proteinase K and continue permeabilization for 5 min. Wash the treated cell samples 3 times with PBSTR (0.1% Tween-20, 0.2 U / μL SplintR in PBS), each time for 5 min.

[0133] The primary probe was added to the hybridization buffer, and the hybridization reaction system was mixed and then added to the reaction chamber. The hybridization reaction system was the same as that in Example 1. The reaction system was added to the treated cell sample, and then fully mixed and incubated at 37° C. overnight.

[0134] 5. Probe Circularization Ligation Reaction

[0135] The cell samples incubated overnight were washed twice with PBSTR, mixed and washed at room temperature, each time for 5 minutes; washed with PBSTR-4×SSC at 25°C for 5 minutes, and washed once with PBSTR to obtain the cell samples hybridized with the primary probe; The LiGAse ligase reaction system was mixed evenly, and the ligase reaction system was the same as that in Example 1. The reaction system was added to the cell sample hybridized with the primary probe, placed at 25° C., and reacted for 2 h.

[0136] 6. Rolling circle amplification

[0137] Step 5: Wash the cell samples after the reaction with PBSTR (0.1% Tween-20, 0.1U / μL SUPERase·In in PBS) for 3 times, 5min each time. Mix the phi29 DNA polymerase rolling circle extension reaction system, and the rolling circle replication amplification reaction system is the same as in Example 1. Add the reaction system to the treated cell samples, mix thoroughly, and incubate at 30°C overnight.

[0138] VII. Hybridization fluorescent probe

[0139] The cell samples incubated overnight in step 6 were washed once with PBSTR, fixed with PFA for 10 minutes, and washed twice with PBST; the fluorescent probe was supplemented to 100 μL with PBST, added to the cell samples, incubated at 37°C for 30-50 minutes, and washed twice with PBST to obtain fluorescently labeled cell samples.

[0140] 8. Flow Cytometry Analysis

[0141] The fluorescently labeled cell samples are passed through a cell sieve and diluted to the required density before flow cytometric analysis.

[0142] Figure 6This is a flow cytometry analysis result for specific cell populations in the prefrontal cortex and hippocampus of the mouse brain. As shown in the figure, the Y585-PE channel positive group is microglia expressing the Tmem119 gene, and the B525-FITC channel positive group is inhibitory neurons expressing GAD1. The results show that the two neuronal cell groups are clearly divided, proving the specificity of this method.

[0143] Example 3

[0144] Flow cytometry analysis of specific immune cell populations in pig blood PBMC

[0145] 1. Pretreatment of active samples

[0146] (1) Sample source: PBMCs were isolated from fresh pig blood and fixed with 4% DEPC-PFA. 2 O-prepared 70% alcohol stored at 4℃;

[0147] (2) The fixed cells were dehydrated with pre-cooled 100% methanol at -20°C for 30 min, centrifuged at 500 × g for 5 min, and washed once with DEPC-PBSTR;

[0148] (3) Fix again with 1 mL of 4% PFA for 10 min, centrifuge at 500 × g and discard the supernatant, wash once with 1 mL of DEPC-PBSTR, and aspirate as much supernatant as possible after centrifugation;

[0149] (4) Rinse once with 500 μL 0.2 M hydrochloric acid, permeabilize for 10 min with 500 μL 0.2 M hydrochloric acid, and wash twice with PBSTR;

[0150] (5) Prepare digestion solution (including 2 μg / mL proteinase K) in advance, add the digestion solution to the cell sample, treat at 37°C for 3 min, immediately place on ice, centrifuge at 4°C and discard the supernatant, wash three times with PBSTR to obtain the pretreated cell sample.

[0151] 2. Design and preparation of primary probes

[0152] The primary probe consists of a padlock probe and an RCA priming probe; the padlock probe consists of three sequences, with 13bp sequences complementary to the target sequence at both ends and a 30bp barcode bidirectional sequencing sequence in the middle; the RCA priming probe consists of two sequences, one of which is a region complementary to the target sequence and the other is complementary to the middle region on the padlock probe, forming a primer for rolling circle amplification.

[0153] The following probes were designed for the target gene sequence we were interested in:

[0154]

[0155]

[0156]

[0157]

[0158] 3. Probe Pretreatment

[0159] Phosphorylated probe: Dry powder probe (EP tube) was centrifuged at 12,000 rpm for 2 min, and then precipitated with DEPC-H 2 The probe was diluted with O, and the PLP probe sequence was incubated in T4 PNK, T4 Ligase Buffer at 37°C for 30 min and 72°C for 10 min. RCA Primer was also added and the probe was annealed on a PCR instrument. The reaction system and procedure were the same as in Example 1.

[0160] 4. Primary Probe Hybridization

[0161] Prepare 2 μg / ml proteinase K and continue permeabilization for 5 min. Wash the treated cell samples 3 times with PBSTR (0.1% Tween-20, 0.2 U / μL SplintR in PBS), each time for 5 min.

[0162] The primary probe was added to the hybridization buffer, and the hybridization reaction system was mixed and then added to the reaction chamber. The hybridization reaction system was the same as that in Example 1. The reaction system was added to the treated cell sample, and then fully mixed and incubated at 37° C. overnight.

[0163] 5. Probe Circularization Ligation Reaction

[0164] The cell samples incubated overnight were washed twice with PBSTR, mixed and washed at room temperature, each time for 5 minutes; washed with PBSTR-4×SSC at 25°C for 5 minutes, and washed once with PBSTR to obtain the cell samples hybridized with the primary probe; The LiGAse ligase reaction system was mixed evenly, and the ligase reaction system was the same as that in Example 1. The reaction system was added to the cell sample hybridized with the primary probe, placed at 25° C., and reacted for 2 h.

[0165] 6. Rolling circle amplification

[0166] Step 5: Wash the cell samples after the reaction with PBSTR (0.1% Tween-20, 0.1U / μL SUPERase·In in PBS) for 3 times, 5min each time. Mix the phi29 DNA polymerase rolling circle extension reaction system, and the rolling circle replication amplification reaction system is the same as in Example 1. Add the reaction system to the treated cell samples, mix thoroughly, and incubate at 30°C overnight.

[0167] VII. Hybridization fluorescent probe

[0168] The cell sample incubated overnight in step 6 was washed once with PBSTR, fixed with PFA for 10 minutes, and washed twice with PBST; the fluorescent probe was supplemented with PBST to 100 μL and added to the cell sample, incubated at 37°C for 30-50 minutes, and washed twice with PBST to obtain a fluorescently labeled cell sample.

[0169] 8. Flow Cytometry Analysis

[0170] The fluorescently labeled cell samples are passed through a cell sieve and diluted to the required density before flow cytometric analysis.

[0171] Figure 7 This is the result of flow cytometry analysis of T cell population in pig PBMC. Figure 8 The flow cytometry analysis results for B cell population in pig PBMC are shown in the figure. Figure 7 The positive group in the B525-FITC channel is the cells expressing the CD3 gene, the positive group in the R660-APC channel is the cells expressing CD4, and the positive group in the Y585-PE channel is the cells expressing CD8; Figure 8 The positive group in the B525-FITC channel is the cells expressing the CD79A gene, the positive group in the R660-APC channel is the cells expressing COX-1, and the Y585-PE is the cells expressing CD19. This result proves the feasibility of this method for pig PBMC immunophenotyping.

[0172] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A method for analyzing and screening cell populations based on RCA-FISH, characterized in that: The following steps are involved: (1) Design and preparation of primary probes Screening out target sequence regions with high hybridization efficiency, strong specificity and no RNA higher-order structure from the RNA sequence to be detected to design hybridization primary probes; the primary probes are composed of padlock probes and RCA initiation probes; (2) Probe pretreatment The 5' end of the padlock probe in the primary probe is phosphorylated; the 5' end phosphorylated padlock probe is then gradient annealed with the RCA priming probe; (3) Primary probe hybridization The tissue was fixed with paraformaldehyde, then permeabilized with formaldehyde and pepsin, and a hybridization buffer containing a primary probe was prepared and added to the reaction chamber for overnight hybridization; (4) Probe cyclization reaction The hybridization buffer in the previous step is removed by centrifugation, and after thorough washing, the ligase reaction system is added to the enriched sample for ligation reaction, so that the padlock probe is complementary to the target sequence on the corresponding RNA to form a semi-closed ring structure; (5) Rolling circle amplification signal The polymerase uses the RCA priming probe as a primer and the circular structure of the padlock probe as a template to perform rolling circle amplification, further amplifying the signal; (6) Fluorescent probe labeling of cells The secondary probe labeled with the desired fluorescent molecule is synthesized to be the fluorescent probe; Incubate the fluorescent probe with the sample after the signal is amplified in step (5), pass through a cell screen, and dilute, and then use for flow cytometric analysis / sorting; (7) How to analyze and sort Cells were washed twice with PBS / 0.1% BSA, resuspended in PBS / 0.1% BSA, and acquired on a cytoflex-LXcytoflex-LX at Beckman Co.’s Flow Cytometry Core Facility; data were first manually gated to remove debris and aggregates using FlowJo v10.8.0 and CytExpert; UMAP followed by FlowSOM were performed to visualize and cluster the data.

2. The method according to claim 1, characterized in that: In the step (1), the target sequence of the RNA sequence to be detected consists of three consecutive target sequences A, b and C, and the padlock probe comprises an A' sequence, a loop sequence and a b' sequence from the 5' end to the 3' end, wherein the A' sequence and the b' sequence are complementary to the target sequence A and the target sequence b, respectively, so that the padlock probe forms a semi-closed ring structure after complementary pairing with the target sequence; the RCA priming probe consists of two sequences, one of which is a region complementary to the target sequence, and the other is complementary to the middle region on the padlock probe, forming a primer for rolling circle amplification.

3. The method according to claim 2, characterized in that: The loop sequence is composed of an anchor sequence and a barcode sequence, respectively. The barcode sequence is a general term for two barcode sequences, namely, a barcode1 sequence and a barcode2 sequence; the barcode sequence is complementary to the fluorescent probe.

4. The method according to claim 1, characterized in that: In the step (2), the enzyme used in the phosphorylation process is T4 polynucleotide kinase.

5. The method according to claim 1, characterized in that: In the step (3), the concentrations of the components in the hybridization buffer system containing the primary probe are as follows: 10% formamide: 20 μL; 2xSSC: 20 μL; 1% Tween-20: 2 μL; 20 mM RVC: 20 μL; 0.1 mg / ml salmon sperm DNA: 2 μL; annealed PLP&RCA probes: 42 μL; DEPC-H2O: 94 μL; total system: 200 μL.

6. The method according to claim 1, characterized in that: In the step (4), the ligase in the ligase reaction system is SplinTR ligase; In the step (5), the polymerase is Phi29 DNA polymerase.

7. Use of the method for analyzing and screening cell populations based on RCA-FISH as claimed in claim 1 in flow cytometry analysis of mRNA of suspended cells.

8. Use of the RCA-FISH-based cell population analysis and screening method as claimed in claim 1 in flow cytometry analysis of 293T cells infected with different adeno-associated viruses.

9. Use of the RCA-FISH-based cell population analysis and screening method as claimed in claim 1 in flow cytometry analysis of specific cell populations in prefrontal lobe and hippocampus tissues of the brain.

10. Use of the RCA-FISH-based cell population analysis and screening method as claimed in claim 1 in flow cytometry analysis of specific immune cell populations in pig blood PBMC.

Images