Application of METTL14 gene in resistance of sheep to escherichia coli infection

Abstract

The invention discloses an application of an METTL14 gene in resistance of sheep to escherichia coli infection. Research finds that the expression level of the METTL14 gene is closely related to escherichia coli resistance, the important effect of the METTL14 gene in the F17 escherichia coli infection resisting process of sheep is verified from mRNA, protein and cell levels, then the new application of the METTL14 gene is provided, it is determined that the METTL14 gene can be used as an important resistance candidate functional gene for bacterial diarrhea, and the application of the METTL14 gene in resisting F17 escherichia coli infection of sheep is promoted. And meanwhile, a scientific basis is provided for molecular breeding of the lambs for resisting the escherichia coli diarrhea disease in lamb production.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an application of a METTL14 gene in sheep resistance to Escherichia coli infection. Background Art

[0002] It is understood that F17 Escherichia coli can cause severe diarrhea and sepsis in lambs, with high morbidity, high mortality, and rapid infectivity, which seriously affects the survival rate of lambs and has a great impact on the economic effects of farms and the economic development of the sheep industry. The virulence factors produced by F17 Escherichia coli are mainly adhesins and enterotoxins. There are two types of adhesins, mainly the pili of Gram-negative bacteria, and the second is non-fimbriae adhesins. Studies have found that F17 Escherichia coli colonizes in the small intestine through the binding of F17 pili to the specific receptors of mucosal surface cells, reproduces and produces enterotoxins, causing diarrhea in lambs. Due to the emergence of drug resistance, the effect of traditional antibiotic treatment is limited, and there is no good way to control it. With the development of molecular biology technology, screening related disease-resistant breeding molecular markers from the perspective of genetic breeding or using homologous recombination and other counts has become a research direction for disease-resistant breeding in the future. Therefore, how to use molecular means to deal with the infection of F17 Escherichia coli in sheep flocks is particularly important.

[0003] METTL14 is a protein found in eukaryotes. It is part of the m6A methyltransferase complex and is mainly involved in the N6-methyladenosine (m6A) modification of mRNA. m6A modification is a common RNA modification. As an epigenetic modification, m6A methylation has now become a hot topic in molecular biology. It plays an important role in cell metabolism and is related to various activities such as cell migration, proliferation, and differentiation. METTL14 affects the stability and translation efficiency of mRNA through m6A modification, thereby regulating gene expression. According to relevant literature reports, the METTL14 gene may enhance the resistance of cells to pathogens such as bacteria and viruses by regulating the expression of genes related to immune response. For example, m6A modification can affect the expression of interferon-stimulated genes, which play an important role in resisting viral infections. Studies have shown that chickens infected with Salmonella can cause changes in the expression level of the METTL14 gene. In addition, studies have shown that m6A methylase METTL14 can regulate myocardial ischemia / reperfusion injury through the Akt / mTOR signaling pathway, and myocardial injury will cause increased expression of m6A methyltransferase METTL14. Analysis of the regulatory mechanism of METTL3-mediated m6A modification on the resistance of weaned piglets to F18 Escherichia coli. METTL3 mediates m6A methylation modification to increase the expression level of the key target gene IKBKG, thereby activating the occurrence of TLRs immune signaling pathway, and ultimately improving the resistance of weaned piglets to F18 Escherichia coli to a certain extent. However, there are still few reports on the resistance mechanism of METTL14 gene to Escherichia coli, especially on the relationship between sheep METTL14 expression and Escherichia coli F17 infection. Summary of the invention

[0004] The present invention aims at the technical problem to be solved, overcomes the shortcomings of the prior art and provides an application of a METTL14 gene in sheep resistance to Escherichia coli infection.

[0005] Another object of the present invention is to use the METTL14 gene as a functional gene for improving the resistance of sheep F17 Escherichia coli.

[0006] Another object of the present invention is to use the METTL14 gene in molecular breeding of sheep resistant to Escherichia coli diarrhea.

[0007] Another object of the present invention is to use the METTL14 gene as a target in the preparation of an agent for improving sheep's resistance to Escherichia coli diarrhea.

[0008] Based on the above application, the present invention improves the resistance of sheep to E. coli diarrhea by overexpressing the METTL14 gene in sheep, or breeds lamb breeds resistant to E. coli diarrhea.

[0009] In the above application, the METTL14 gene overexpression vector is obtained by connecting the METTL14 gene with the pcDNA3.1 vector.

[0010] The present study found that the expression level of the METTL14 gene is closely related to the resistance to Escherichia coli. The important role of the METTL14 gene in the sheep's resistance to F17 Escherichia coli infection was verified at the mRNA, protein and cell levels. Furthermore, a new use of the METTL14 gene was proposed, and it was determined that it can be used as an important candidate functional gene for resistance to bacterial diarrhea. At the same time, it will also provide a scientific basis for the molecular breeding of lambs for resistance to Escherichia coli diarrhea in sheep production in the future.

[0011] The present invention also provides a method for verifying the function of the METTL14 gene in improving the resistance to bacterial diarrhea in sheep, comprising the following steps: (1) After F17 Escherichia coli infected sheep small intestinal epithelial cells, the expression of the METTL14 gene was verified by qPCR, and it was found that the expression level of the METTL14 gene in F17 Escherichia coli-infected cells was significantly higher than that in uninfected cells; (2) The METTL14 gene was overexpressed and knocked down in sheep intestinal epithelial cells, and then the adhesion ability and cell migration ability of F17 Escherichia coli were identified; (3) After knocking down the METTL14 gene, RNA-seq sequencing and pathway enrichment analysis were performed to verify the resistance of sheep intestinal epithelial cells to F17 Escherichia coli adhesion and cell migration ability after pathway inhibition.

[0012] In the above verification method, in step (2), a METTL14 gene overexpression vector and an interference sequence are designed and constructed, and the expression level of the METTL14 gene in sheep small intestinal epithelial cells is increased or decreased by transfection, which is used to identify the cell adhesion ability to F17 Escherichia coli and the cell migration ability.

[0013] In the above verification method, the interference sequence is as follows: METTL14-sheep-298: GCAUUGGUGCUGUGUUAAATT UUUAACACAGCACCAAUGCTT; METTL14-sheep-838: GCUGGACUUGGGAUGAUAUTT AUAUCAUCCCAAGUCCAGCTT;METTL14-sheep-1485:GGGCGAGAGAGAAAUCGAUTTAUCGAUUUCUCUCUCGCCCTT;METTL14-sheep-3518:GCUGCACCAGCUAAUACUUTT AAGUAUUAGCUGGUGCAGCTT.

[0014] In the above verification method, in step (2), a METTL14 overexpression vector is designed and constructed, the METTL14 overexpression vector and pcDNA3.1(+) are transfected into sheep small intestinal epithelial cells, and the expression thereof is detected by RT-qPCR and Western Blot; Interference sequences were designed and transfected into sheep intestinal epithelial cells, and their expression was detected by RT-qPCR and Western Blot; After overexpression and interference of the METTL14 gene, the cells were infected with F17 Escherichia coli, and bacterial counts, Gram staining, pilus protein quantification, vimentin detection, and cell scratch tests were performed to detect the adhesion ability of sheep intestinal epithelial cells against F17 Escherichia coli and the cell migration ability; After interfering with the METTL14 gene, the signal pathways were enriched and verified through RNA-seq sequencing analysis.

[0015] The present invention verifies the resistance of the METTL14 gene to the adhesion of sheep small intestinal epithelial cells to F17 Escherichia coli and the cell migration ability through bacterial counting, Gram staining, pilus protein quantification and cell scratch experiments.

[0016] The above verification method, after METTL14 gene interference, enriched to P13K-akt signaling pathway through RNA-seq analysis, verified the expression of related genes through qPCR, and verified the role of METTL14 and P13K-akt signaling pathway in sheep intestinal epithelial cells' resistance to F17 E. coli adhesion and cell migration ability through relevant experiments; The cell experiments were divided into four groups: (1) P13K-akt pathway inhibitor group; (2) P13K-akt pathway inhibitor + METTL14 overexpression plasmid co-transfection group; (3) METTL14 overexpression plasmid transfection group; (4) pcDNA3.1 empty vector group; The role of METTL14 gene and P13K-akt signaling pathway in the adhesion ability of sheep intestinal epithelial cells to F17 Escherichia coli and cell migration ability was verified by bacterial counting, Gram staining, fimbriae protein quantification and cell scratch experiments. It was found that after the P13K-akt signaling pathway was blocked, the adhesion ability of sheep intestinal epithelial cells to F17 Escherichia coli and cell migration ability were significantly reduced.

[0017] The beneficial effects of the present invention are as follows: the present invention improves the sheep's resistance to F17 Escherichia coli infection through the important resistance regulation function played by the METTL14 gene in the process of sheep's resistance to F17 Escherichia coli infection.

[0018] The present invention systematically verifies the expression regulation function of the METTL14 gene when the sheep intestinal epithelial cells are infected by F17 Escherichia coli, providing a basis for in-depth research on the mechanism of action of the METTL14 gene, and also providing a basis for the breeding of sheep resistant to F17 Escherichia coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The expression level of METTL14 mRNA was verified by qPCR after F17 Escherichia coli infected sheep intestinal epithelial cells.

[0020] Figure 2 Diagram for constructing METTL14 gene overexpression vector ( * P＜0.05 ). In the figure, A is a double enzyme digestion gel electrophoresis, B is a PCR identification of the recombinant plasmid bacterial solution, C is a detection of the mRNA level of the transfected METTL14 overexpression vector, and DF is a WB detection of the protein of the transfected METTL14 overexpression vector.

[0021] Figure 3 Schematic diagram of interference efficiency ( ** P < 0.01 and *** P＜0.001 ). In the figure, A is a schematic diagram for verification of interference efficiency at the mRNA level, and BD is a schematic diagram for verification of interference efficiency at the protein level by WB.

[0022] Figure 4 Figure 2 shows the results of bacterial adhesion experiments. * P＜0.05 and ** P＜0.01 ). In the figure, A is the bacterial count of F17 Escherichia coli after METTL14 overexpression, and B is the bacterial count of F17 Escherichia coli after METTL14 interference. C is the Gram staining of F17 Escherichia coli after METTL14 overexpression, D is the Gram staining of F17 Escherichia coli after METTL14 interference, E is the relative quantification of F17 pili genes of F17 Escherichia coli after METTL14 interference, and F is the relative quantification of F17 pili genes of Escherichia coli after METTL14 overexpression.

[0023] Figure 5 Schematic diagram of vimentin detection ( ** P＜0.01 ). In the figure, A shows the expression changes of Vimentin mRNA level after METTL14 overexpression, B shows the expression changes of Vimentin mRNA level after METTL14 interference, CE shows WB of Vimentin protein after METTL14 overexpression, and FH shows WB of Vimentin protein after METTL14 interference.

[0024] Figure 6 Schematic diagram of cell migration ( * P < 0.05 and ** P＜ 0.01 ). In the figure, AB is a schematic diagram of the migration of cells overexpressing METTL14, and CD is a schematic diagram of the migration of cells interfered with METTL14.

[0025] Figure 7 Schematic diagram of RNA-seq sequencing results ( * P＜0.05 and ** P＜0.01 and *** P＜0.001 ). In the figure, A is the correlation analysis of samples, B is the use of volcano plot to display DEGs, C is the heat map of the expression pattern of important expressed genes, D is the GO enrichment analysis of DEGs, E is the KEGG enrichment analysis of DEGs obtained after METTL14 knockdown, and F is the detection of mRNA levels of P13K / AKT pathway-related genes after knockdown of METTL14 in sheep IECs.

[0026] Figure 8 Schematic diagram of the interaction between METTL14 and P13K-AKT ( * P＜0.05 and ** P＜0.001 ). In the figure, A is the qPCR detection of the relative expression of pilus genes after P13K / AKT pathway inhibition, B is the bacterial count after P13K / AKT pathway inhibition, CF is Gram staining after P13K / AKT pathway inhibition, the order is pcDNA3.1 group, P13K / AKT pathway inhibitor group, P13K / AKT inhibitor + METTL14 group and Oe-METTL14 group, GH is cell migration after P13K / AKT pathway inhibition. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0028] The materials and reagents mentioned in the present invention can be obtained by the public from commercial or free channels at home and abroad. Example 1 1. qPCR detection of the expression of METTL14 gene in sheep small intestinal epithelial cells after F17 infection

[0029] (1) Cell recovery. Place the frozen sheep intestinal epithelial cells in a 37°C metal bath, centrifuge at 1000 rpm for 5 min, and discard the supernatant; add 1 mL of cell culture medium (DMEM / F12 complete culture medium containing 10% fetal bovine serum and 1% penicillin / streptomycin) to the centrifuge tube containing the cell pellet, gently blow the cells with a pipette to mix them, and then transfer the cell suspension to a cell bottle. First, add 2 mL of cell culture medium to the cell bottle as a base, and then add 2 mL of cell culture medium; slightly loosen the mouth of the cell bottle, and then transfer it to a cell culture incubator at 37°C and 5% CO2.

[0030] (2) Cell passaging. Discard the old culture medium in the bottle and wash with PBS; discard the PBS, add an appropriate amount of trypsin digestion solution to the cell bottle, and place it in a 37°C constant temperature incubator for digestion for 5 min; then add fresh cell culture medium, blow and swirl evenly, and transfer the cell suspension evenly to a 6-well plate with a bottom. Add 100 μL of cell suspension to each well of the 6-well plate and continue to culture in a 37°C incubator.

[0031] (3) F17 E. coli infection experiment. When the cells grow to 80%-90%, the F17 E. coli should be inoculated into LB liquid culture medium (1:1000) in advance, cultured at 220rpm for 12h, centrifuged at 4000rpm for 5min, the bacterial precipitate was collected, resuspended with PBS buffer, mixed and centrifuged, and washed three times; finally, the bacterial precipitate was diluted to 1.0×10 9 CFU / mL, 2 mL of diluent was added to each cell culture well (three replicates per group), and a blank group of cells was set up, i.e., only cell culture medium was added, and the cells were collected after 4 h of stimulation.

[0032] (4) Extraction of total RNA. Aspirate the culture medium in the 6-well plate, add PBS and wash twice, add 1 mL of TRIzol to each well, and use a pipette to blow the cells thoroughly; transfer the completely digested cells to a 1.5 mL enzyme-free centrifuge tube; add 200 μL of chloroform to each tube, shake vigorously for 15 s, and let it stand on ice for 10 min; set the centrifuge at 12,000 rpm, 4°C, 15 min, transfer the upper aqueous phase to a new 1.5 mL enzyme-free centrifuge tube, then add an equal volume of pre-cooled isopropanol, invert to mix, and let it stand for 5-10 min; set the centrifuge at 12,000 rpm, 4°C, 10 min, and try to dry the waste liquid, leaving a white precipitate; then add 1 mL of 75% pre-cooled ethanol to each tube, invert to mix for 20 s; set the centrifuge at 12,000 rpm, 4°C, 5 min, and discard the supernatant; centrifuge again at 12,000 rpm, 4°C, and aspirate the supernatant. Open the lid and place at room temperature to air for 5 min. When the white precipitate becomes translucent, add 30 μL of enzyme-free water and mix thoroughly. Determine the RNA concentration and quality and store in a -80℃ refrigerator.

[0033] (5) Preparation of cDNA. The extracted RNA was reverse transcribed using the FastKing gDNA Dispelling RT SuperMix Kit (Tiangen). The reverse transcription system is as follows:

[0034] Mix by flicking, incubate at 42℃ for 15 min and 95℃ for 3 min.

[0035] (6) RT-qPCR detection. Refer to 2×TSINGKE ® Master q-PCR Mix reagent instructions, RT-qPCR system is as follows:

[0036] PCR reaction conditions: 95°C for 30 sec; 95°C for 5 ses, 60°C for 30 ses, for 32 cycles.

[0037] (7) The expression results of METTL14 gene in sheep intestinal epithelial cells are as follows Figure 1 As shown, compared with the control group, the level of METTL14 gene in cells was significantly increased after infection with F17 E. coli ( * P＜0.01 ). 2. Construction of METTL14 overexpression vector and determination of transfection efficiency

[0038] (1) Vector construction. Primers with homology arms of the pcDNA3.1 vector were designed to amplify the CDS region of METTL14 (the nucleotide sequence of the CDS region of METTL14 is shown in SEQ ID NO.1). The primer sequence is M14-X1-1566-F-BamHI: AAGCTTGGTACCGAGCTCGGATCCATGCGCGTGCGCCGCGTT; M14--X1-1566-R-NotI: ACGGGCCCTCTAGACTCGAGCGGCCGCctatcgaggtggaaagccacc; at the same time, the pcDNA3.1 vector was linearized by double restriction digestion, and the gel electrophoresis identification results after double restriction digestion were as follows Figure 2 As shown in A ( Figure 2 A1 is the target fragment amplified by METTL14, and A2 is the double restriction enzyme digestion of pcDNA3.1 vector). After DNA purification, the amplified product was connected to the pcDNA3.1 vector by homologous recombination method, and then transformed into DH5α competent cells. The colonies were picked for PCR identification the next day. The results of colony identification are as follows: Figure 2 As shown in B. The plasmid was extracted from the positive band bacterial solution and sent to Qingke Biotechnology (Nanjing) Co., Ltd. for sequencing, and then compared with the target gene after sequencing.

[0039] (2) Cell transfection. When the growth density of sheep intestinal epithelial cells is about 70-80%, the METTL14 overexpression vector transfection experiment is carried out. Refer to the instructions of the jetPRIME transfection reagent, the amount of recombinant plasmid added: 2 μg / well, transfection reagent 4 μL / well, Buffer 200 μL / well, cell culture medium 2 mL / well. Transfection groups: overexpression experimental group (METTL14-pcDNA3.1(+)) and overexpression control group (pcDNA3.1(+)), each group is repeated three times. After 36 hours of transfection, the cells were collected for subsequent detection.

[0040] (3) RT-qPCR detection of overexpression efficiency. The RT-qPCR results are as follows Figure 2 As shown in C, after transfection with METTL14 overexpression vector, its mRNA expression level was significantly increased (P ≤ 0.05).

[0041] (4) Extraction and concentration determination of total cell protein. ① Use a cell scraper to scrape off the cells, transfer the cells and culture medium to a centrifuge tube, centrifuge at 1000rpm for 10min, and discard the supernatant. Add 5mL of PBS to wash twice, shaking several times each time to remove as much residual culture medium as possible. ② Add 5μL 100mM PMSF, 10μL phosphatase inhibitor and 1μL protease inhibitor to each 1mL cold Lysis Buffer, mix well, and place on ice for a few minutes. ③ After washing the cells, transfer to a new pre-cooled centrifuge tube and add 1mL of prepared cold Lysis Buffer. ④ Place at 4℃ and shake vigorously for 30s, place on ice for 4min, and repeat 5 times. ⑤ Centrifuge at 4℃ (12000rpm) for 5min to collect the supernatant. The supernatant is the extracted total protein and is stored at -70℃ for later use. ⑥ Use the BCA protein concentration assay kit to detect the extracted total protein to standardize the protein level.

[0042] (5) Western Blot protein detection. ① Preparation of sodium dodecyl sulfate-polyacrylamide gel (SDS-PAG): Prepare 5% concentrated gel and 10% separation gel respectively. ② Electrophoresis detection: Dilute each group of protein samples to the same concentration level with cell lysis buffer, absorb an equal volume of protein solution (about 70μg) and mix with protein loading buffer and add to the centrifuge tube, incubate at 95℃ for 5min, then quickly place on ice for cooling, and then load the sample into the gel. Electrophoresis conditions: Run the concentrated gel at 80V for 20min; run the separation gel at 100V for 90min. ③ Semi-dry electrotransfer: Take out the gel and place it in the electrotransfer buffer. In addition, place the polyvinylidene-fluoride (PVDF) membrane and filter paper in methanol for activation for 2 minutes, and then transfer them to the electrotransfer buffer; place the bottom electrode (anode) horizontally, and place the filter paper, PVDF membrane, protein gel and filter paper on it. After squeezing out the bubbles in each layer, place the upper electrode (cathode) on the upper filter paper and place it in the transfer instrument, 20V for 15min. ④ Blocking: Immerse the transferred PVDF membrane in a blocking solution containing 5% skimmed milk powder for 1h (room temperature), and pour out the blocking solution. ⑤ Specific binding of antibodies to target proteins: Add an appropriate volume of blocking solution and primary antibody METTL14 (1:10000) and internal reference primary antibody β-actin (1:5000) dilutions to the box, incubate overnight on a shaker at 4℃, and rinse the PVDF membrane 4 times (5min each time) with PBST buffer. Incubate the PVDF membrane and horseradish peroxidase (HRP) labeled secondary antibody (1:5000) at room temperature with shaking for 1-2 hours, and finally wash with PBST buffer 4 times (5 minutes each time). ⑥ Development and imaging: Calculate the amount of developer required per cm2 and immerse the PVDF membrane in the developer, and incubate at room temperature for 1 minute. Carefully wrap the PVDF membrane with plastic wrap (be careful to avoid residual bubbles), quickly place the membrane protein on X-ray film in a dark room for exposure, and develop and wash in a film processor. The results are as follows Figure 2 As shown in D to F, the overexpression efficiency is significant ( * P＜0.05 ). 3. Detection of METTL14 interference efficiency

[0043] (1) Design interference sequences METTL14-sheep-298, METTL14-sheep-838, METTL14-sheep-1485 and METTL14-sheep-3518, whose sequences are as follows: METTL14-sheep-298: GCAUUGGUGCUGUGUUAAATT UUUAACACAGCACCAAUGCTT; METTL14-sheep-838: GCUGGACUUGGGAUGAUAUTT AUAUCAUCCCAAGUCCAGCTT; METTL14-sheep-1485: GGGCGAGAGAGAAAUCGAUTTAUCGAUUUCUCUCUCUCGCCCTT; METTL14-sheep-3518: GCUGCACCAGCUAAUACUUTT AAGUAUUAGCUGGUGCAGCTT. The above interference sequences were added with TT overhangs to facilitate melting and be more stable. The interference sequences were synthesized by Suzhou Jima Gene Co., Ltd. After transfection, the interference efficiency was verified by RT-qPCR ( ** P ＜0.01 ),like Figure 3 A.

[0044] (2) Western Blot detection. After detection, its interference efficiency is quite significant ( *** P＜0.001 ),like Figure 3 As shown in B to D. 4. Effect of METTL14 expression level on the adhesion ability of Escherichia coli in vitro

[0045] After infection with F17 Escherichia coli, the cells were tested for bacterial count, Gram staining, and pilin gene fluorescence quantification. The results showed that compared with the control group, the number of adherent F17 Escherichia coli was significantly reduced after METTL14 overexpression (P<0.05). Figure 4 As shown in A, the number of F17 Escherichia coli adhered significantly increased after interference (P<0.05). Figure 4 As shown in B. Gram staining results showed that after METTL14 overexpression, the number of F17 Escherichia coli attached to the cells decreased. Figure 4 As shown in C, after interference, the number of bacteria adhering to the cells increased, as shown in Figure 4 As shown in D. RT-qPCR detected the expression level of pilin gene, which decreased significantly after overexpression (P<0.05). Figure 4 As shown in F, the expression level of pilus protein increased significantly after interference. Figure 4 As shown in E. 5. Effect of METTL14 expression level on vimentin

[0046] (1) After overexpression of METTL14, the expression level of Vimentin was detected by RT-qPCR, and the result showed a significant increase (P＜ 0.05 ), the trend of Western Blot results is the same, such as Figure 5 As shown in A, C to E.

[0047] (2) After interfering with METTL14, the expression level of Vimentin was detected by RT-qPCR, and the result was a significant decrease ( P＜ 0.01 ), the trend of Western Blot results is the same, such as Figure 5 As shown in B, F to H. VI. Effect of METTL14 expression level on the migration ability of sheep intestinal epithelial cells

[0048] Scratch test. Scratch before transfection: When the growth density of sheep intestinal epithelial cells reaches 70-80%, discard the culture medium, draw a horizontal line on the back of the 6-well plate with a marker, and then scratch each well with a ruler vertically. After scratching, transfect and observe the healing speed from 0h to 12h. The results are as follows Figure 6 As shown in Figure 2, after METTL14 was overexpressed, the healing rate of cells in the overexpression group was significantly higher than that in the pcDNA3.1 (+) group (see Figure 6 AB), after METTL14 interference, the healing rate of cells in the interference group was significantly lower than that in the pcDNA3.1 (+) group (see Figure 6 CD). VII. Screening of signaling pathways affected by METTL14 interference

[0049] The cells were transferred to a 6-well plate and subjected to METTL14 interference, with three replicates per well. Cell samples were collected 36 hours after transfection and sent to Shanghai Paisono Biotech Co., Ltd. for sequencing. Figure 7 As shown in A, the volcano plot of differentially expressed genes (DEGs) is shown in Figure 7 As shown in B, the heat map of the expression patterns of the important expressed genes is Figure 7 As shown in C, GO functional annotation analysis is as follows Figure 7 As shown in D, after sequencing analysis, the signal pathways related to immunity, proliferation, and migration were enriched, and the significant signal pathway P13K-akt was screened out. Figure 7 As shown in E, the signal pathway-related genes were detected by RT-qPCR and verified. Figure 7 As shown in F. 8. Effects of METTL14 and P13K-akt signaling pathways on the ability of cells to resist F17 Escherichia coli adhesion

[0050] The results were verified by cell experiments and divided into four groups: ① P13K-akt pathway inhibitor group; ② P13K-akt pathway inhibitor + METTL14 overexpression plasmid co-transfection group; ③ METTL14 overexpression plasmid transfection group; ④ pcDNA3.1 empty group. Bacterial counting, Gram staining, pilus protein quantification and cell scratch experiments were performed. The results showed that: pilus protein quantification (see Figure 8 A), colony count (see Figure 8 B), and Gram stain (see Figure 8 The results of CF showed that after inhibiting the P13K-akt signaling pathway, the number of bacterial adhesion increased significantly (see Figure GH). After co-transfection of the P13K-akt signaling pathway inhibitor and the METTL14 overexpression vector, the number of bacterial adhesion decreased slightly, while after overexpressing the METTL14 gene, the number of bacterial adhesion decreased significantly. The Gram staining results were consistent with the colony counts. The scratch test results proved that after inhibiting the P13K-akt signaling pathway, the cell healing ability decreased significantly. After co-transfection of the P13K-akt signaling pathway inhibitor and the METTL14 overexpression vector, the cell healing ability increased slightly, while after overexpressing the METTL14 gene, the cell adhesion ability increased significantly.

[0051] The invention firstly infects sheep intestinal epithelial cells with F17 Escherichia coli, detects the expression difference of METTL14 gene in infected and uninfected cells by qPCR technology, successfully constructs METTL14 gene overexpression vector and determines interference sequence, identifies the expression of METTL14 gene mRNA and protein levels by qPCR and Western Blot, infects sheep small intestinal epithelial cells with F17 Escherichia coli, and performs a series of tests such as bacteria counting, Gram staining, pilus protein quantification, vimentin detection, cell scratch detection, etc. to detect the adhesion ability of sheep intestinal epithelial cells against F17 Escherichia coli and cell migration ability. After interfering with the METTL14 gene, RNA-seq sequencing was used to analyze and screen the enriched signal pathways, and qPCR was used to verify the genes related to the pathway. After treatment with pathway inhibitors, bacterial counting, Gram staining, fimbriae protein quantification and cell scratch experiments were performed to systematically verify the expression regulatory function and molecular mechanism of METTL14 when sheep small intestinal epithelial cells were infected by F17 Escherichia coli.

[0052] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Application of METTL14 gene in sheep's resistance to Escherichia coli infection.

2. Application of METTL14 gene in molecular breeding of sheep resistant to Escherichia coli diarrhea.

3. Application of METTL14 gene as a target in the preparation of reagents for improving sheep's resistance to Escherichia coli diarrhea.

4. The use according to any one of claims 1 to 3, characterized in that: The METTL14 gene is overexpressed in sheep to improve the resistance of sheep to Escherichia coli diarrhea, or to breed lamb breeds resistant to Escherichia coli diarrhea.

5. The use according to claim 4, characterized in that: The METTL14 gene overexpression vector is obtained by connecting the METTL14 gene with the pcDNA3.1 vector.

6. A method for verifying the function of the METTL14 gene in improving the resistance of sheep to bacterial diarrhea, characterized in that: The following steps are involved: (1) After F17 Escherichia coli infected sheep small intestinal epithelial cells, the expression of the METTL14 gene was verified by qPCR, and it was found that the expression level of the METTL14 gene in F17 Escherichia coli-infected cells was significantly higher than that in uninfected cells; (2) The METTL14 gene was overexpressed and knocked down in sheep intestinal epithelial cells, and then the adhesion ability and cell migration ability of F17 Escherichia coli were identified; (3) After knocking down the METTL14 gene, RNA-seq sequencing and pathway enrichment analysis were performed to verify the resistance of sheep intestinal epithelial cells to F17 Escherichia coli adhesion and cell migration ability after pathway inhibition.

7. The verification method according to claim 6, characterized in that: In the step (2), a METTL14 gene overexpression vector and an interference sequence are designed and constructed, and the expression level of the METTL14 gene in sheep small intestinal epithelial cells is increased or decreased by transfection, so as to identify the cell adhesion ability to F17 Escherichia coli and the cell migration ability.

8. The verification method according to claim 7, characterized in that: The interference sequence is as follows: METTL14-sheep-298: GCAUUGGUGCUGUGUUAAATT UUUAACACAGCACCAAUGCTT; METTL14-sheep-838: GCUGGACUUGGGAUGAUAUTT AUAUCAUCCCAAGUCCAGCTT; METTL14-sheep-1485: GGGCGAGAGAGAAAUCGAUTT AUCGAUUUCUCUCCGCCCTT; METTL14-sheep-3518: GCUGCACCAGCUAAUACUUTT AAGUAUUAGCUGGUGCAGCTT.

9. The verification method according to claim 8, characterized in that: In the step (2), a METTL14 overexpression vector is designed and constructed, and the METTL14 overexpression vector and pcDNA3.1(+) are transfected into sheep small intestinal epithelial cells, and the expression thereof is detected by RT-qPCR and Western Blot; Interference sequences were designed and transfected into sheep intestinal epithelial cells, and their expression was detected by RT-qPCR and Western Blot; After overexpression and interference of the METTL14 gene, the cells were infected with F17 Escherichia coli, and bacterial counts, Gram staining, pilus protein quantification, vimentin detection, and cell scratch tests were performed to detect the adhesion ability of sheep intestinal epithelial cells against F17 Escherichia coli and the cell migration ability; After interfering with the METTL14 gene, the signal pathways were enriched and verified through RNA-seq sequencing analysis.

10. The verification method according to claim 9, characterized in that: After the METTL14 gene was interfered, RNA-seq analysis showed that it was enriched in the P13K-akt signaling pathway, and the expression of related genes was verified by qPCR. Related experiments also verified the role of the METTL14 and P13K-akt signaling pathways in the ability of sheep intestinal epithelial cells to resist the adhesion of F17 E. coli and the ability of cell migration; The cell experiments were divided into four groups: (1) P13K-akt pathway inhibitor group; (2) P13K-akt pathway inhibitor + METTL14 overexpression plasmid co-transfection group; (3) METTL13 overexpression plasmid transfection group; (4) pcDNA3.1 empty vector group; The role of METTL14 gene and P13K-akt signaling pathway in the adhesion ability of sheep intestinal epithelial cells to F17 Escherichia coli and cell migration ability was verified by bacterial counting, Gram staining, fimbriae protein quantification and cell scratch experiments. It was found that after the P13K-akt signaling pathway was blocked, the adhesion ability and cell migration ability of sheep intestinal epithelial cells against F17 Escherichia coli were significantly reduced. After transfection with METTL14 overexpression plasmid for rescue, its resistance to F17 Escherichia coli adhesion and cell healing ability were significantly improved.

Images