A beta-glucosidase lyophilization protectant and its use in the production of CK

Abstract

The present application relates to the technical field of bioengineering, and particularly relates to a beta-glucosidase freeze-drying protective agent and application thereof in production of CK. The present application utilizes beta-glucosidase Bgp3 to prepare rare ginsenoside CK, adopts a freeze-drying technology to prepare a freeze-dried powder from Bgp3 protein supernatant, and adds a specific freeze-drying protective agent before freeze-drying, so as to protect the enzyme activity, improve the enzyme stability, and facilitate storage and longer preservation time. The present application adds a freeze-drying protective agent with a combination of trehalose, arginine and mannitol as raw materials, and the Bgp3 freeze-dried powder prepared without the protective agent has high catalytic efficiency. The present application provides a method for producing rare ginsenoside CK by utilizing beta-glucosidase Bgp3, which has high bioconversion rate, mild reaction conditions, simple equipment and easy operation, and provides technical support for industrial production of rare ginsenoside CK.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a β-glucosidase freeze-drying protectant and its application in the production of CK. Background Technology

[0002] Rare ginsenoside CK possesses multiple targets, high activity, and low toxicity, exhibiting unique advantages in anti-cancer, anti-aging, and prevention and relief of Alzheimer's disease. However, its abundance in nature is extremely low, and traditional methods of isolation and extraction from plants such as ginseng are insufficient to meet demand.

[0003] Currently reported methods for synthesizing rare ginsenoside CK include biotransformation, chemical synthesis, and synthetic biology. Biotransformation includes microbial fermentation and enzymatic conversion. Microbial fermentation uses Ganoderma lucidum as the fermentation starter, fermenting for 3 days, then adding one of the following natural saponins: total saponins from Gynostemma pentaphyllum, total saponins from Panax notoginseng, or total ginseng saponins, and continuing fermentation to obtain rare ginsenoside CK. Enzymatic conversion utilizes ginsenoside β-glucosidase isolated from ginseng to convert the substrate; however, this enzyme is not a single compound, is difficult to prepare artificially, and direct separation is costly, making it difficult to apply to the industrialization of enzymatic preparation methods for rare ginsenoside CK. The chemical synthesis method employs a weak acid mixed acid hydrolysis method, using Panax notoginseng leaves as raw material. The total saponins from Panax notoginseng leaves are obtained through steps such as pulverization, alcohol extraction, and resin adsorption. These saponins are then dissolved in solvents such as anhydrous ethanol, and precipitated by stirring and refrigeration with ethyl acetate or acetone. The precipitate is dissolved in pure water and then hydrolyzed with glacial acetic acid-HCl solution. After the reaction, the pH is adjusted to neutral, and the filtrate is collected. The filtrate is then subjected to resin desalting, ethanol elution, and silica gel column chromatography to obtain rare ginsenoside CK. The synthetic biology method involves cloning and identifying key enzymes in the protopanaxadiol synthesis pathway, constructing yeast cells capable of producing protopanaxadiol, and further identifying key enzymes such as cytochrome P450 that catalyze the production of protopanaxadiol from protopanaxadiol. This allows for the construction of a yeast cell factory for ginsenoside production, realizing the biosynthesis of ginsenosides and confirming the existence of two metabolic pathways for the synthesis of rare ginsenoside CK in recombinant yeast cells.

[0004] Existing technologies for the conversion of rare ginsenoside CK into ginsenoside K each have their advantages and disadvantages. For example, patent 201510802369.9 (publication number CN 105296587A) utilizes β-glucosidase produced by Bifidobacterium to convert ginsenoside Rb1 into rare ginsenoside CK, with a conversion rate of 62%-68%. The Bifidobacterium used in this patent is a strictly anaerobic bacterium, requiring high water quality, sensitivity to environmental factors such as temperature and pH, and sensitivity to toxic substances during fermentation. The anaerobic reactor has a long start-up time, and the reaction process is relatively complex, requiring strict control of various reaction conditions. Patent 201510658194.9 (publication number CN105255970A) discloses a method for preparing rare ginsenoside compound K from recombinant β-glucosidase derived from lactic acid bacteria. This patent uses IPTG as an inducer, which increases production costs and has certain toxic side effects on microorganisms, inhibiting bacterial growth and thus affecting protein expression. Furthermore, IPTG residues may pose potential health risks to humans. Therefore, there is an urgent need for a low-cost, safe, stable, and highly efficient method for converting rare ginsenosides (CK) into ginsenosides. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a β-glucosidase freeze-drying protectant and its application in the production of CK.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a β-glucosidase lyophilization protectant comprising the following components in parts by weight: 5-10 parts trehalose, 0.5-1 parts arginine, and 5-10 parts mannitol.

[0008] β-glucosidase is essentially a protein. Proteins, as end products or tools in certain processes, may be used in small quantities over extended periods. Preserving as much of the protein's original biological (or functional) activity as possible during its extended shelf life is crucial. This "shelf life" can range from a few days to over a year, depending on the protein's properties and storage conditions. Various other factors can lead to the loss or reduction of protein biological activity during storage. Typical physical phenomena include aggregation and precipitation; adsorption to surfaces can also cause protein inactivation. Freeze-drying technology produces lyophilized protein powders. After freeze-drying, the thermal motion and interactions of protein molecules in the medium are greatly reduced, thus decreasing the probability of degradation and denaturation. This better maintains the protein's structural stability and biological activity, providing a longer shelf life and facilitating storage and transportation. Freeze-drying technology refers to freezing water-containing materials below their freezing point to convert water into ice, and then removing the ice by converting it into vapor under high vacuum. It is currently recognized as the most environmentally friendly and superior drying technology, and is therefore widely used in the pharmaceutical manufacturing industry. Freeze-drying is currently the most convenient method for preserving microorganisms (such as bacterial strains and viruses) or biological systems (such as blood cells and corneas). Because freeze-dried drugs are porous, can be stored for long periods, have good rehydration properties, and can restore activity, freeze-drying technology is widely used in the preparation of solid protein drugs, oral fast-dissolving drugs, and drug encapsulation agents.

[0009] In the freeze-drying process, cryoprotectants are typically used to protect the stability and functionality of biological products under low temperature and dry conditions. There are many ways to classify freeze-drying protectants. Based on function, they can be classified into four categories: pH buffers, fillers, stabilizers, and nonionic surfactants.

[0010] This invention, through investigation, discovered that different combinations of lyophilization protectants have varying effects on the enzyme activity of Bgp3 protein supernatant. This invention selects trehalose, arginine, and mannitol as the raw materials for the lyophilization protectant. Trehalose is a non-reducing disaccharide and will not undergo browning reaction with β-glucosidase. Its glass transition temperature is as high as 120℃, making the solution less prone to ice crystal formation, thus reducing damage to the enzyme during freezing. It has strong hydration capacity, with a large number of unfrozen water molecules surrounding each glucose unit, forming a more rigid trehalose / water structure, enhancing resistance to freeze-drying. Its low hygroscopic properties prevent a decrease in the glass transition temperature due to moisture absorption, maintaining enzyme stability. Arginine acts as an amino acid protectant, interacting with β-glucosidase molecules and stabilizing the enzyme's spatial structure through hydrogen bonds and other forces, preventing structural damage and inactivation due to dehydration during lyophilization. It also regulates the pH of the solution, creating a suitable microenvironment for β-glucosidase and reducing the impact of pH fluctuations on enzyme activity. Mannitol is a polyol protectant with a low crystallinity, making it less prone to crystallization during freeze-drying, thus avoiding mechanical damage to the β-glucosidase structure during crystallization. It also increases solution viscosity, reduces enzyme molecule mobility, and lowers the risk of aggregation and inactivation due to interactions between enzyme molecules. Compared to other freeze-drying protectant formulations, this combination minimizes the decrease in β-glucosidase Bgp3 activity. This invention, by selecting a specific combination of freeze-drying protectants, can provide a certain degree of protection for β-glucosidase Bgp3 during freeze-drying, reducing damage to enzyme active sites or changes in enzyme molecular conformation, thereby maintaining relatively high enzyme activity.

[0011] This invention combines trehalose, arginine, and mannitol within the aforementioned range, which is particularly effective in promoting substrate conversion. It not only protects enzyme activity well during freeze-drying but also allows the enzyme to fully exert its catalytic effect in subsequent practical reaction applications, efficiently converting the substrate into the product and achieving a high conversion rate.

[0012] More preferably, the ratio of the sum of the masses of trehalose and mannitol to the mass of arginine is (10-30):1.

[0013] Within the aforementioned ratio range, arginine effectively maintains the native conformation of proteins, while the glassy structure formed by trehalose and mannitol is more stable. Trehalose and mannitol synergistically enhance each other: both lower the freezing point of water, reduce ice crystal formation, and protect biomolecular structures. From a mechanism of action perspective, their synergistic effect enhances the protection of β-glucosidase. As an amphoteric amino acid, arginine can interact with the surface charge of β-glucosidase molecules, preventing enzyme denaturation during freeze-drying. If the arginine ratio is too high, it may interfere with the formation of a stable protective system by trehalose and mannitol; if the ratio is too low, the conformational protection of the enzyme will be insufficient.

[0014] Secondly, the present invention provides a method for producing rare ginsenoside CK, comprising the following steps:

[0015] (1) Add the above-mentioned β-glucosidase lyophilization protectant to the protein supernatant of β-glucosidase and lyophilize to obtain β-glucosidase lyophilized powder.

[0016] (2) Using ginsenoside Rb1 as a substrate, add β-glucosidase lyophilized powder and water, mix, adjust pH, carry out conversion reaction, and collect precipitate by centrifugation;

[0017] (3) Add anhydrous ethanol, mix well, centrifuge, collect the supernatant, dry, and obtain the product containing rare ginsenoside CK.

[0018] Preferably, the protein supernatant of the β-glucosidase is prepared by the following method:

[0019] (a) The gene encoding β-glucosidase Bgp3 was cloned into the expression vector pET28a(+) to obtain the recombinant plasmid pET28a(+)-Bgp3;

[0020] (b) The recombinant plasmid pET28a(+)-Bgp3 obtained in step (a) was transformed into Escherichia coli for expression to obtain the pET28a(+)-Bgp3 expression strain;

[0021] (c) A single strain of the pET28a(+)-Bgp3 expression strain was inoculated into LB medium and cultured to obtain seed culture;

[0022] (d) Transfer the seed culture to LBR-5 medium containing an inducer to induce fermentation culture;

[0023] (e) Collect the fermentation broth, break it up, and centrifuge to obtain the protein supernatant of β-glucosidase.

[0024] The production of rare ginsenoside CK catalyzed by β-glucosidase has advantages such as high regioselectivity and stereoselectivity, high yield, few byproducts, no pollution, and ease of industrial production. This invention constructs the expression vector pET28a(+)-Bgp3, transforms the plasmid into *Escherichia coli* BL21(DE3) for expression, and uses lactose as an inducer for fermentation. The fermented cells are collected, broken, and centrifuged to obtain the Bgp3 protein supernatant. This invention avoids using expensive and harmful IPTG as an inducer in the induced fermentation process of the β-glucosidase expression strain, instead using inexpensive, safe, and non-toxic lactose, which not only reduces costs but also improves expression efficiency.

[0025] Compared with conventional IPTG induction, the lactose induction method used in this invention has the following advantages:

[0026] 1. Lower cost: Lactose is a common type of sugar with wide availability, mature production technology, and relatively low price; while IPTG needs to be prepared through chemical synthesis and other methods, resulting in higher production costs.

[0027] 2. Greater safety: Lactose is a common sugar in living organisms. It can be broken down and utilized by lactase and other enzymes in the body, and has little impact on the physiological functions of organisms. It has good biocompatibility and high safety. IPTG, on the other hand, is a non-natural chemical substance that may have potential toxicity or adverse effects on certain biological systems.

[0028] 3. Lactose's mechanism of action is consistent with IPTG, but its effect is superior: Both lactose and IPTG can bind to the repressor protein in the lactose operon, relieving the repressor protein's inhibition of gene transcription, thereby inducing the expression of the target protein. In many cases, lactose can achieve a similar induction effect to IPTG. In addition, lactose's induction effect is relatively mild; its intracellular metabolism is relatively slow, allowing it to continuously provide induction signals, making the expression of the target protein more stable and persistent.

[0029] 4. Lactose is easier to remove, and the purification process is simpler: When lactose is used as an inducer, it can be removed by common methods such as dialysis and ion exchange chromatography during subsequent protein purification. Unlike IPTG, lactose will not leave residues that may affect the purity and quality of the protein, thus simplifying the protein purification process.

[0030] 5. Lactose can also support cell growth during fermentation: Lactose can not only act as an inducer, but also as a carbon source to provide energy for cell growth and metabolism. During fermentation, it helps maintain cell growth and metabolic activity, and increases cell density and protein production.

[0031] Preferably, the nucleotide sequence of β-glucosidase Bgp3 in step (a) is shown in SEQ NO.1.

[0032] Preferably, the amino acid sequence of β-glucosidase Bgp3 in step (a) is shown in SEQ NO.2.

[0033] Preferably, the nucleotide sequence of the recombinant plasmid pET28a(+)-Bgp3 obtained in step (a) is shown in SEQ NO.3.

[0034] Preferably, the inducer in step (d) is lactose.

[0035] Preferably, the LBR-5 culture medium in step (d) contains the following components: 5-10 g / L yeast extract, 10-20 g / L peptone, 10-20 g / L NaCl, and 2-5 g / L lactose.

[0036] More preferably, the LBR-5 culture medium in step (d) contains the following components: 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, and 5 g / L lactose.

[0037] Preferably, in step (1), the volume of the freeze-drying protectant accounts for 10.5%-21% of the volume of the protein supernatant.

[0038] Preferably, in step (2), the pH is adjusted to pH = 5-7.

[0039] More preferably, in step (2), the pH is adjusted to pH=5.

[0040] Preferably, the conditions for the conversion reaction in step (2) are: 35-45℃, 200-250rpm for 48-96h.

[0041] The beneficial effects of this invention are as follows:

[0042] This invention employs a freeze-drying process to obtain lyophilized enzyme powder, which not only efficiently preserves enzyme activity but also facilitates stable enzyme activity during production, and is convenient for storage and transportation. The lyophilized enzyme powder of β-glucosidase Bgp3 can convert protopanaxadiol-type ginsenoside Rb1 into rare ginsenoside CK. This invention, by adding a freeze-drying protectant, can protect the enzyme activity of β-glucosidase Bgp3 to a certain extent. By selecting a specific combination of freeze-drying protectant raw materials, this invention not only effectively protects enzyme activity during freeze-drying but also ensures high catalytic efficiency in subsequent enzyme-involved reactions. With the addition of the freeze-drying protectant prepared in this invention, the conversion rate can reach as high as 91.09%.

[0043] This invention does not use expensive and harmful IPTG as an inducer in the induced fermentation process of β-glucosidase expression strains. Instead, it uses inexpensive, safe and non-toxic lactose as an inducer, which not only reduces costs but also improves expression efficiency. Attached Figure Description

[0044] Figure 1 The image shows the pET28a(+)-Bgp3 plasmid.

[0045] Figure 2 The results are for pET28a(+)-Bgp3 agarose gel electrophoresis.

[0046] Figure 3The SDA-PAGE electrophoresis results for pET28a(+)-Bgp3 are shown.

[0047] Figure 4 This is a transformation pathway catalyzed by the β-glucosidase gene Bgp3 to convert protopanaxadiol-type ginsenoside Rb1 into rare ginsenoside CK.

[0048] Figure 5 This is a liquid phase diagram of the lyophilized product of β-glucosidase Bgp3. Detailed Implementation

[0049] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0050] Examples 1-18:

[0051] Examples of the β-glucosidase lyophilization protectant of the present invention, the formulation composition of the β-glucosidase lyophilization protectant of Examples 1-18 are shown in Table 1.

[0052] Table 1 Formulation composition of freeze-drying protectants in Examples 1-18

[0053]

[0054] Comparative Examples 1-8:

[0055] The comparative examples of the β-glucosidase lyophilization protectant of the present invention, namely Comparative Examples 1-8, are shown in Table 2.

[0056] Table 2

[0057]

[0058] Experimental Example 1: Preparation of β-glucosidase lyophilized powder

[0059] 1. Constructing the pET28a(+)-Bgp3(BL21) strain:

[0060] (1.1) Biomaterials:

[0061] Cloning or preservation of plasmid vector strain: *Escherichia coli* DH5α was purchased from Sangon Biotech (Shanghai) Co., Ltd. Expression host strain: *Escherichia coli* BL21(DE3) was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0062] (1.2) Culture medium formulation:

[0063] LB medium (for DH5α and BL21 culture): 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, sterilized at 121℃ for 20 min; if preparing a solid medium, add 15-20 g / L agar powder.

[0064] LBR-5 medium (for large-scale fermentation): 5-10 g / L yeast extract, 10-20 g / L peptone, 10-20 g / L NaCl, 2-5 g / L lactose, sterilized at 121°C for 20 min.

[0065] SOC medium (for DH5α and BL21 conversion): 20 g / L tryptone, 5 g / L yeast extract, 0.5 g / L sodium chloride, 10 mL 250 mM potassium chloride solution, 10 mL 20 mM glucose solution, 10 mL 10 mM magnesium chloride, sterilized at 121°C for 20 min; if preparing as a solid medium, add 15-20 g / L agar powder.

[0066] The high-fidelity PCR mix was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number B639300. The PCR amplification system is shown in Table 3, and the amplification conditions are shown in Table 4.

[0067] Table 3 PCR amplification system

[0068]

[0069] Table 4 PCR Amplification Conditions

[0070] step Temperature (°C) time 1 98 30s 2 98 10 3 (Tm+3) 5s 4 72 5-10s / kb 5 72 30s

[0071] The plasmid extraction kit, DNA purification kit, and gel extraction kit were purchased from Tiangen Biotech Co., Ltd.

[0072] (1.3) The methods for culturing, preserving, and transforming competent cells of DH5α and BL21 are as follows:

[0073] (1.3.1) The selected strains were streaked or spread on solid LB plates with the corresponding resistance, and then incubated upside down in a constant temperature incubator at 37℃ for 12-16h. Colony PCR identification was performed, or the plates were sealed with sealing film and stored upside down in a refrigerator at 4℃.

[0074] Freshly revived Escherichia coli single clones were picked from LB solid medium plates, inoculated into a certain volume of LB liquid medium, and appropriate antibiotics were added as needed. The culture was carried out at 37℃ and 220rpm for 12-16h.

[0075] (1.3.2) Preservation: Take 500 μL of fresh overnight culture seed culture and add it to a cryovial containing 500 μL of 50% sterile glycerol, and store it in an ultra-low temperature freezer at -80℃;

[0076] (1.3.3) Transformation: The transformation system was added to BL21 competent cells that had been thawed on ice. After incubating on ice for 30 min, the cells were heat-shocked at 42℃ for 90 s, and then incubated on ice again for 2 min. Subsequently, 900 μL of SOC medium preheated at 37℃ was added, and the cells were incubated at 37℃ and 220 rpm for 45 min. 100 μL of the bacterial culture was added to LB solid medium containing the corresponding antibiotic and incubated at 37℃ for 12-16 h. A certain number of clones were picked from the plates for colony PCR identification and streaked onto the corresponding plates. The plates were then incubated at 37℃ for 12-16 h for later use.

[0077] The obtained plasmid was transformed into BL21 competent cells, and cloning PCR amplification and agarose gel electrophoresis were performed using the corresponding primers. After identification as a positive transformant, it was stored or activated for later use according to the above method.

[0078] The 2×Rapid Taq Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number P222-01. The PCR amplification system is shown in Table 3, and the amplification conditions are shown in Table 4.

[0079] (1.4) Cloning PCR method:

[0080] Pick a single transformant into the PCR reaction solution and perform the reaction (Tables 5-7); perform agarose gel electrophoresis according to the procedure in "Molecular Biology Experiments".

[0081] Table 5 Homologous recombination linkage system

[0082] reagents Dosage 5×CE II Buffer 2μL Exnase II 1μL Vector DNA 0.03 pmol DNA fragments 0.03 / 0.06 pmol <![CDATA[ddH2O]]> Make up to 10 μL

[0083] Table 6 Cloning PCR Amplification System

[0084] reagents Dosage 2×Rapid Taq Master Mix 25uL 10μM upstream primer 2μL 10μM downstream primer 2μL <![CDATA[ddH2O]]> Make up to a total volume of 50 μL

[0085] Table 7 Cloning PCR Amplification Conditions

[0086] step Temperature (°C) time 1 95 3min 2 95 15s 3 (Tm) 15s 4 72 15s / kb 5 72 5min

[0087] (1.5) Preparation of pET28a(+)-Bgp3 expression strain

[0088] (1.5.1) β-glucosidase Bgp3 (GenBank JN603821.1) was expressed in Escherichia coli (Escherichiacoli). GenScript Biotech Co., Ltd. was commissioned to optimize the Bgp3 codons, resulting in the plasmid pET28a(+)-Bgp3 containing the optimized Bgp3 sequence (plasmid map shown below). Figure 1 (As shown).

[0089] (1.5.2) Take 1 μL of pET28a(+)-Bgp3 plasmid and introduce it into E. coli strain BL21 according to the transformation method. Identify using primer pair T7-F / R (Table 8). Screen for positive transformants by agarose gel electrophoresis. The agarose gel electrophoresis results are as follows: Figure 2 As shown, the pET28a(+)-Bgp3 expression strain was obtained.

[0090] Agar powder and DNA molecular weight standard Marker S (100-5000bp) were purchased from Sangon Biotech (Shanghai) Co., Ltd., with catalog numbers A620014 and B10003, respectively.

[0091] Table 8 Primer sequences used to construct the pET28a(+)-Bgp3 strain

[0092] Primer name Primer sequence (5'-3') T7-F taatacgactcactatagggg T7-R caaaaaacccctcaagaccc

[0093] 2. Fermentation and expression of pET28a(+)-Bgp3(BL21) strain

[0094] Materials and Reagents: TruColor dual-color pre-stained protein markers (standard range: 15–130 kDa) were purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number C610011. 5X protein loading buffer (without reducing buffer) was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number C516031. SDS-PAGE denaturing acrylamide gel rapid preparation kit was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number C631100. 10X Tris-Glycine SDS-PAGE electrophoresis buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number C520001. High-sensitivity rapid Coomassie brilliant blue staining kit was purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number C510041.

[0095] Method (1) The pET28a(+)-Bgp3(BL21) strain was activated on LB solid medium and cultured at 37℃ for 12-16 h;

[0096] (2) Pick a single colony and inoculate it into 10 mL of LB medium as a primary seed culture. Add 10 μL of Kanmycin and incubate at 37°C and 200 rpm for 12-16 h.

[0097] (3) Transfer the primary seed culture to 100 mL of LB medium as the secondary seed culture, add 100 μL of Kanmycin, and incubate at 37 °C and 200 rpm for 12-16 h.

[0098] (4) Transfer the secondary seed culture to 1L of LBR-5 medium (containing lactose inducer) as the fermentation broth, add 1mL of Kanmycin, and incubate at 37℃ and 200rpm for 12-16h until OD. 600 =4.0~5.0, 16℃, 160rpm low temperature incubation for 12-16h:

[0099] (5) Take out 1L of fermentation broth, centrifuge at 7000rpm and 4℃ for 20min to collect the cells;

[0100] (6) Add 500mL ddH2O to wash the bacterial cells, centrifuge at 7000rpm and 4℃ for 10min;

[0101] (7) Add hydrochloric acid aqueous solution with pH=5.0, add 10mL ddH2O to 1g of bacterial cells, pipette to suspend the bacterial cells, and transfer to a clean beaker;

[0102] (8) Cells were disrupted in an ice-water bath using an ultrasonic cell disruptor. The program was 600W, 3s, 3s, for 30-60 minutes until the liquid was clear.

[0103] (9) Transfer the lysate to a centrifuge tube, centrifuge at 8000 rpm and 4°C for 10 min to separate the supernatant and precipitate;

[0104] (10) Transfer the supernatant to a new centrifuge tube, take out 40 μL of supernatant into a PCR tube, add 10 μL of protein loading buffer, and treat in a PCR instrument at 98°C for 15 min to obtain a protein electrophoresis sample.

[0105] (11) Prepare SDA-PAGE protein electrophoresis gel according to the instructions of the SDS-PAGE denaturing acrylamide gel rapid preparation kit and perform electrophoresis. The program is 220V and electrophoresis for 30min.

[0106] (12) The SDA-PAGE protein electrophoresis gel was stained and destained using a highly sensitive and rapid Coomassie brilliant blue staining kit. The electrophoresis results are as follows: Figure 3 As shown.

[0107] Experimental Example 2: Test on the effect of different freeze-drying protectants on the enzyme activity of β-glucosidase Bgp3 after freeze-drying. In order to ensure the biological activity of β-glucosidase Bgp3 before and after freeze-drying, freeze-drying protectants were used to protect the supernatant of β-glucosidase Bgp3 after lyophilization.

[0108] The test samples were the freeze-drying protectants prepared in Examples 1-18 and Comparative Examples 1-8.

[0109] (1) Take 200 mL of β-glucosidase Bgp3 rupture supernatant and add different freeze-drying protectants according to Table 1 and Table 2 in percentage units, with no protectant added as a control.

[0110] (2) Pour all the liquids into the corresponding glass petri dishes, and put these glass petri dishes into a freeze dryer for freeze drying;

[0111] (3) The freeze-drying procedure is as follows: -40℃, 2h (pre-freezing); (entering the vacuum system) -40℃, 2h; -10℃, 6h; 1℃, 6h; 10℃, 3h; 20℃, 3h; 30℃, 3h;

[0112] (4) After freeze-drying, weigh 40 mg of freeze-dried powder from the glass culture dish and add 800 μL of ddH2O for enzyme activity detection. The salicin method, a commonly used spectrophotometric method, was used for detection. The supernatant of β-glucosidase Bgp3 that had not undergone freeze-drying was used as a control.

[0113] The detection principle utilizes β-glucosidase, which catalyzes the decomposition of salicin into glucose and salicylol. Specifically, under alkaline, boiling conditions, the glucose molecules produced by enzymatic hydrolysis undergo a redox reaction with 3,5-dinitrosalicylic acid (DNS) to generate a brownish-red 3-amino-5-nitrosalicylic acid. This product exhibits maximum absorption at 540 nm, and its absorbance is linearly related to the amount of glucose produced by enzymatic hydrolysis.

[0114] Table 9. Effects of different lyophilization protectant formulations on enzyme activity.

[0115] Processing group Freeze-drying protectant compound combination Enzyme activity (U / g) Bgp3 Crushed supernatant that has not undergone freeze-drying 750 Example 1 Trehalose + Arginine + Mannitol 726 Comparative Example 1 Trehalose + Arginine 641 Comparative Example 2 Arginine + Mannitol 625 Comparative Example 3 Trehalose + Mannitol 633 Comparative Example 4 Trehalose + Arginine + Sorbitol 653 Comparative Example 5 Trehalose + Arginine + Tween 80 650 Comparative Example 6 Trehalose + Histidine + Mannitol 645 Comparison Freeze-drying without adding freeze-drying protectant 575

[0116] As shown in Table 9, enzyme activity is usually affected and decreases during the freeze-drying process. Adding freeze-drying protectants can protect the activity of β-glucosidase Bgp3 to some extent, but different combinations of freeze-drying protectants have varying effects on enzyme activity. In this study, compared to Comparative Examples 1-6, Example 1 used a combination of trehalose, arginine, and mannitol as freeze-drying protectants, which resulted in the smallest decrease in β-glucosidase Bgp3 activity compared to other freeze-drying protectant formulations.

[0117] Freeze-drying may damage the structure and function of enzymes. This invention, by selecting a specific combination of freeze-drying protectants, can provide a certain degree of protection for β-glucosidase Bgp3 during the freeze-drying process, reducing the destruction of enzyme active sites or changes in enzyme molecular conformation, thereby maintaining relatively high enzyme activity.

[0118] Table 10. Effects of different lyophilization protectant ratios on enzyme activity.

[0119] Processing group Freeze-drying protectant compound combination Enzyme activity (U / g) Bgp3 Crushed supernatant that has not undergone freeze-drying 750 Example 1 10％：1％：10％ 726 Example 2 10％：1％：8％ 694 Example 3 10％：1％：5％ 688 Example 4 10％：0.5％：10％ 660 Example 5 10％：0.5％：8％ 678 Example 6 10％：0.5％：5％ 718 Example 7 8％：1％：10％ 690 Example 8 8％：1％：8％ 694 Example 9 8％：1％：5％ 700 Example 10 8％：0.5％：10％ 673 Example 11 8％：0.5％：8％ 665 Example 12 8％：0.5％：5％ 685 Example 13 5％：1％：10％ 710 Example 14 5％：1％：8％ 698 Example 15 5％：1％：5％ 715 Example 16 5％：0.5％：10％ 710 Example 17 5％：0.5％：8％ 736 Example 18 5％：0.5％：5％ 720 Comparative Example 7 10％：5％：10％ 650 Comparative Example 8 10％：0.3％：10％ 635

[0120] As shown in Table 10, different ratios of trehalose, arginine, and mannitol as freeze-drying protectants have varying degrees of impact on enzyme activity. Enzyme activity measurements show a range of fluctuations in enzyme activity values ​​corresponding to different raw material ratios in each example, ranging from a minimum of 660 U / g (Example 4) to a relatively high 736 U / g (Example 17), indicating that different freeze-drying protectant ratios have varying effects on maintaining enzyme activity. Changes in the proportions of each component lead to variations in enzyme activity, demonstrating that adjusting the specific proportions of each component affects the protective effect of the freeze-drying protectant on the enzyme during the freeze-drying process, thus influencing the final enzyme activity retention.

[0121] Compared with Comparative Examples 7 and 8, the freeze-drying protectant of the present invention can better protect the enzyme activity of β-glucosidase Bgp3 after freeze-drying within a specific ratio range. However, Comparative Examples 7 and 8 exceed the ratio range of the present invention, interfering with the freeze-drying protection system formed by trehalose, arginine and mannitol, making it impossible for the three to exert the best synergistic effect.

[0122] Compared with other embodiments, the freeze-drying protectant of Example 17, which combines trehalose, arginine, and mannitol in a specific ratio (5%:0.5%:8%), achieved an enzyme activity of 736 U / g, which is relatively outstanding. This may mean that the freeze-drying protectant composed of trehalose, arginine, and mannitol in this specific ratio has a better effect on maintaining the activity of β-glucosidase Bgp3, and can better reduce the loss of enzyme activity caused by freeze-drying compared with other combinations.

[0123] Experiment Example 3: Production of rare ginsenoside CK from β-glucosidase lyophilized powder

[0124] Test method:

[0125] (1) Using ginsenoside Rb1 as a substrate, β-glucosidase lyophilized powder and water were added, mixed, and the pH was adjusted to carry out the conversion reaction of ginsenoside Rb1. The specific reaction system and reaction conditions are shown in Table 11.

[0126] The conversion route of Bgp3 lyophilized powder catalyzing the conversion of protopanaxadiol-type ginsenoside Rb1 to rare ginsenoside CK is as follows: Figure 4 As shown.

[0127] Table 11

[0128]

[0129] (2) After the reaction is complete, take out the sample, centrifuge at 8000 rpm for 10 min, discard the supernatant and keep the precipitate;

[0130] (3) Add 10 mL of anhydrous ethanol to the precipitate, mix by inverting, centrifuge at 8000 rpm for 10 min, and retain the supernatant; (4) Repeat step (3), place the supernatant from the two centrifugations in an oven at 105℃ to dry, and after drying, scrape off the powder sample for detection. Detection method: The liquid chromatography parameters are as follows: The HPLC equipment is an Agilent 1260 Infinity I high performance liquid chromatograph, the C18 column is a ZORBAX SB-C18 (250×4.6 mm), the column temperature is 35℃, the injection volume is 10 μL, the detection wavelength is 203 nm, the flow rate is 1.0 mL / min, the mobile phase is divided into phase A and phase B, where phase A is an aqueous solution of phosphoric acid and phase B is an acetonitrile solution, gradient elution is used, and the specific procedure is shown in Table 12. The liquid chromatogram results of β-glucosidase Bgp3 lyophilized powder are as follows. Figure 5 As shown.

[0131] Table 12 Gradient elution program for liquid chromatography

[0132] Time (minutes) Phase A (phosphoric acid water) Phase B (acetonitrile) 0～4 80％～50％ 20％～50％ 4～12 50％～20％ 50％～80％ 12～16 20％～0％ 80％～100％ 16～16.5 0％～0％ 100％～100％ 16.5～17 60％～80％ 40％～20％ 17～20 80％～80％ 20％～20％

[0133] (5) The CK content was detected by external standard method and the conversion rate was calculated. The results are shown in Table 13.

[0134] The external standard method for detection is implemented according to the group standard "Determination of Ginsenoside CK Content in Ginsenoside Products and Their Products by High Performance Liquid Chromatography".

[0135] Ginsenoside CK standard working solutions were injected into a high-performance liquid chromatograph (HPLC) under chromatographic conditions to obtain the corresponding peak volumes and prepare a standard curve. Then, the sample solution was injected into the HPLC for measurement using the external standard method. Based on the standard curve, the mass concentration of ginsenoside CK in the sample solution, i.e., the actual yield of CK, was calculated, and the conversion rate was then calculated (Equation 1-2).

[0136] Conversion rate = Actual output of CK / Theoretical output of CK × 100% — Equation (1);

[0137] Theoretical yield of CK = molar mass of CK * amount of Rb1 added in reaction / molar mass of Rb1 — Equation (2);

[0138] In equation (2) above, the molar mass of Rb1 is 1109.31 g / mol; the molar mass of CK is 622.88 g / mol.

[0139] Table 13 Results of the effect of different lyophilization protectant formulations on conversion rate

[0140]

[0141] As shown in Table 13, compared to other lyophilization protectant formulations (Comparative Examples 1-6), the lyophilization protectant combination in Example 1, using trehalose, arginine, and mannitol as lyophilization protectants, achieved a higher conversion rate. This means that in the actual enzymatic reaction process, the addition of the lyophilization protectant from Example 1 enabled β-glucosidase Bgp3 to more effectively catalyze the conversion of the substrate into the product. This may be because the lyophilization protectant maintained the appropriate conformation of the enzyme's active site, allowing the substrate to bind better to the enzyme and proceed smoothly, ultimately improving the conversion rate.

[0142] Based on the combined results of enzyme activity and conversion rate assays, the lyophilization protectant combination using trehalose, arginine, and mannitol as raw materials is an ideal choice for lyophilizing β-glucosidase Bgp3. This is because it not only effectively protects enzyme activity during lyophilization but also ensures high catalytic efficiency in subsequent enzyme-involved reactions. This is crucial for situations requiring lyophilization to preserve enzymes while ensuring their efficient use. This lyophilization protectant combination provides an effective strategy for the preservation and efficient utilization of β-glucosidase Bgp3.

[0143] Table 14 Results of the effect of different freeze-drying protectant ratios on conversion rate

[0144]

[0145] As shown in Table 14, when using trehalose, arginine, and mannitol as raw material combinations for lyophilization protection, different ratios of these compounds resulted in varying enzyme catalytic abilities when catalyzing substrates (such as the conversion of 55% Rb1). This reflects that lyophilization protection agents obtained by combining trehalose, arginine, and mannitol in different ratios have different effects on enzyme catalytic function. This may be because different proportions of the protection agent components have different effects on enzyme activity maintenance and conformational stability, thus affecting their catalytic effect in actual reactions.

[0146] Compared with Comparative Examples 7 and 8, the freeze-drying protectant of the present invention can more effectively improve the conversion rate of β-glucosidase Bgp3 within a specific ratio range. However, Comparative Examples 7 and 8 exceed the ratio range of the present invention, which interferes with the freeze-drying protection system formed by trehalose, arginine and mannitol, making it impossible for the three to exert the best synergistic effect and thus not conducive to achieving a high conversion rate.

[0147] Compared with other embodiments, the freeze-drying protectant of Example 17 combines trehalose, arginine, and mannitol in a specific ratio (5%:0.5%:8%), resulting in a freeze-dried powder conversion rate as high as 91.09%. This combination ratio is particularly outstanding in promoting substrate conversion. It not only protects enzyme activity well during freeze-drying, but also allows the enzyme to fully exert its catalytic effect in subsequent actual reaction applications, efficiently converting the substrate into the product. Compared with other ratios, it is more conducive to achieving a higher conversion rate and can maximize the preservation of β-glucosidase activity during freeze-drying.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A β-glucosidase lyophilization protectant, characterized in that, It consists of the following components in parts by weight: trehalose 5-10 parts, arginine 0.5-1 parts, and mannitol 5-10 parts.

2. The β-glucosidase lyophilization protectant as described in claim 1, characterized in that, The ratio of the sum of the masses of trehalose and mannitol to the mass of arginine is (10-30):1.

Images