Preparation methods and applications of monoclonal antibodies against SARS-CoV-2 N protein and their test strips.
By preparing monoclonal antibodies 1A2 and 4C2 of the SARS-CoV-2 N protein, labeling red microspheres, and optimizing the test strip preparation method, the challenges of long detection cycles and variability in existing technologies have been solved, enabling rapid and accurate detection of SARS-CoV-2 infection.
Patent Information
- Application Number
- CN202510583065.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2026-04-24
- Estimated Expiration
- 2045-05-07
AI Technical Summary
Existing SARS-CoV-2 detection technologies face the challenge of high variability. The red microsphere immunochromatographic test strips have low fusion efficiency and long preparation time, making it impossible to provide accurate detection quickly. Furthermore, the need for a pair of monoclonal antibodies to be paired increases the research and development cycle.
Monoclonal antibodies 1A2 and 4C2, which are related to the SARS-CoV-2 N protein, were used to label red microspheres and bind them to goat anti-mouse IgG to prepare red microsphere immunochromatographic test strips. The monoclonal antibodies with strong specific recognition ability were screened by Western blot and ELISA to optimize the test strip preparation method.
It enables rapid, accurate, and low-cost detection of SARS-CoV-2 infection, suitable for on-site testing, and possesses high sensitivity and repeatability. It is applicable to the detection of nasal and pharyngeal swab samples.
Smart Images

Figure CN120365415B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to the preparation method and application of monoclonal antibodies against SARS-CoV-2 N protein and their test strips. Background Technology
[0002] Several SARS-CoV-2 test strips have been approved, but because the virus has become a regular, seasonal epidemic similar to influenza, timely and accurate detection of SARS-CoV-2 infection is a crucial means of self-prevention. At the same time, the high variability of SARS-CoV-2 also presents significant challenges to detection. Identifying sequence-conserved antigens among different SARS-CoV-2 variants is a crucial prerequisite for establishing spectroscopic detection technologies. The SARS-CoV-2 N protein is highly basic and is a multi-functional RNA-binding protein that plays an indispensable role in the infection process. Sequence similarity analysis revealed that the N protein has low homology with other coronaviruses, but its amino acid similarity with other SARS-CoV-2 variants is around 98%, indicating that the N protein has fewer mutations compared to the S protein and other proteins, making it an excellent target for detecting SARS-CoV-2 infection.
[0003] Among SARS-CoV-2 detection methods, red microsphere immunochromatographic test strips are gaining increasing attention due to their unique advantages. Firstly, red microsphere immunochromatographic test strips offer rapid detection, providing results quickly and on-site. Secondly, this method is simple to operate, requiring no complex experimental equipment, and can be applied in the field, greatly facilitating daily testing for users. It can provide accurate test results at an early stage, helping to identify potentially infected individuals as early as possible, thereby enabling effective control and treatment measures. Red microsphere immunochromatography shares the same principle as colloidal gold immunochromatography, but is less expensive and more suitable for large-scale production. Using previously prepared SARS-CoV-2 N protein monoclonal antibody screening antibody pairs, combined with immunochromatographic technology, red microsphere immunochromatographic test strips have been prepared and optimized. These strips specifically recognize the SARS-CoV-2 N protein, exhibiting high sensitivity and good repeatability, providing a reliable immunological technique for rapid and efficient detection of SARS-CoV-2 infection.
[0004] In the process of screening monoclonal antibodies, the fusion efficiency of mouse B lymphocytes and myeloma cells is very low, generally only a few per thousand or even lower. The experimental procedures are cumbersome, requiring the processing of a large number of cells to obtain a sufficient quantity of hybridoma cells. Furthermore, the entire experimental cycle is lengthy, with each batch of monoclonal antibodies requiring 90-120 days to prepare, making it impossible to rapidly produce the required antibodies. Antigen detection test strips require a pair of monoclonal antibodies for pairing; during the antibody screening process, a large number of monoclonal antibodies become unusable, further increasing the development cycle time. Summary of the Invention
[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide two monoclonal antibodies for detecting the SARS-CoV-2 N protein of SARS-CoV-2.
[0006] Another technical problem to be solved by the present invention is to provide the application of the monoclonal antibody of the SARS-CoV-2 N protein in the preparation of reagents, test strips or kits for detecting SARS-CoV-2.
[0007] Another technical problem that this invention aims to solve is to provide an immunochromatographic test strip for detecting SARS-CoV-2 using red microspheres.
[0008] The final technical problem to be solved by this invention is to provide a method for preparing a red microsphere immunochromatographic test strip for detecting SARS-CoV-2.
[0009] Technical Solution: To solve the above-mentioned technical problems, the present invention provides a monoclonal antibody against SARS-CoV-2 N protein, wherein the monoclonal antibody against SARS-CoV-2 N protein comprises antibody 1A2 and / or antibody 4C2, wherein antibody 1A2 comprises a 1A2 light chain variable region and a 1A2 heavy chain variable region, the amino acid sequences of the three complementarity-determining regions in the 1A2 light chain variable region are shown in SEQ ID NO. 1 to 3, and the amino acid sequences of the three complementarity-determining regions in the 1A2 heavy chain variable region are shown in SEQ ID NO. 4 to 6, respectively; antibody 4C2 comprises a 4C2 light chain variable region and a 4C2 heavy chain variable region, the amino acid sequences of the three complementarity-determining regions in the 4C2 light chain variable region are shown in SEQ ID NO. 11 to 13, and the amino acid sequences of the three complementarity-determining regions in the 4C2 heavy chain variable region are shown in SEQ ID NO. 14 to 16, respectively.
[0010] The antibody 1A2 comprises a 1A2 light chain and a 1A2 heavy chain, the amino acid sequence of which is shown in SEQ ID NO.7 and the amino acid sequence of which is shown in SEQ ID NO.9; the antibody 4C2 comprises a 4C2 light chain and a 4C2 heavy chain, the amino acid sequence of which is shown in SEQ ID NO.17 and the amino acid sequence of which is shown in SEQ ID NO.19.
[0011] The nucleotide sequence encoding the light chain of antibody 1A2 is shown in SEQ ID NO.8, the nucleotide sequence encoding the heavy chain of antibody 1A2 is shown in SEQ ID NO.10, the nucleotide sequence encoding the light chain of antibody 4C2 is shown in SEQ ID NO.18, and the nucleotide sequence encoding the heavy chain of antibody 4C2 is shown in SEQ ID NO.20.
[0012] The present invention also includes the application of the monoclonal antibody of the SARS-CoV-2 N protein in the preparation of reagents, test strips or kits for detecting SARS-CoV-2.
[0013] The present invention also includes an immunochromatographic test strip for detecting SARS-CoV-2 red microspheres, wherein the test strip contains a monoclonal antibody against the SARS-CoV-2 N protein.
[0014] The test strip also includes a conjugation pad containing red microspheres labeled with monoclonal antibodies against SARS-CoV-2 N protein, an NC membrane coated with monoclonal antibodies against SARS-CoV-2 N protein and goat anti-mouse IgG, a sample pad, an absorbent pad, and a PCV base plate.
[0015] The present invention also includes a method for preparing the aforementioned SARS-CoV-2 red microsphere immunochromatographic test strip, comprising the following steps:
[0016] (1) The antibody 1A2 was added to the red microsphere solution for labeling; then, under stirring, the red microsphere complex blocking solution was added for blocking; the labeled immunored microsphere solution was centrifuged at low speed, and the precipitate of the microsphere complex was suspended with the red microsphere complex diluent to obtain purified immunored microspheres; the immunored microsphere solution was evenly spread onto the gold-labeled pad and dried for later use.
[0017] (2) Cut the NC detection membrane into strips, and distribute the antibody 4C2 and goat anti-mouse IgG onto the NC membrane as the test line and control line of the test strip, respectively, and dry them for later use;
[0018] (3) Assemble the gold label pad, chromatography membrane, absorbent paper and sample pad to obtain the final product.
[0019] The red microsphere solution in step (1) includes polystyrene microspheres containing red dye, the microspheres having carboxyl groups (COOH) on them, and a particle size of 300 nm.
[0020] In step (1), the labeling concentration of antibody 1A2 is 100±5μg / mL.
[0021] In step (2), the concentration of antibody 4C2 is 0.5–2.5 mg / mL.
[0022] The present invention also includes a method for detecting SARS-CoV-2 N protein, wherein an appropriate amount of negative and positive samples are dropped onto the sample pad of the test strip, and the results are observed after 15 minutes.
[0023] Furthermore, the method for interpreting the test results is as follows: if the sample contains SARS-CoV-2 N protein, both the T and C lines will show color, indicating a positive result; if the T line does not show color but the C line does, it indicates a negative result; if the T line shows color but the C line does not, or neither shows color, the test strip is invalid or the operation is incorrect.
[0024] Furthermore, the procedure involves dropping the sample onto the sample pad of the test strip and observing the results after 15 minutes. If both the T and C lines are visible, the result is positive, indicating that the sample contains SARS-CoV-2 N protein. If the T line is not visible but the C line is visible, the result is negative, indicating that the sample does not contain SARS-CoV-2 N protein. If the T line is visible but the C line is not, or if neither is visible, the test strip is invalid or the procedure is incorrect.
[0025] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention utilizes both E. coli and mammalian systems to express and purify the recombinant N protein of SARS-CoV-2. Monoclonal antibodies specifically recognizing the recombinant N protein are prepared using B-cell hybridoma technology. Furthermore, Western blot, indirect immunofluorescence assay, and ELISA are used to analyze and screen for monoclonal antibodies with strong specific recognition capabilities for prokaryotic and eukaryotic expression of the recombinant N protein of SARS-CoV-2. This provides an important material basis for establishing a monoclonal antibody-based SARS-CoV-2 detection method. The monoclonal antibody of the SARS-CoV-2 N protein of this invention is used to prepare red microsphere immunochromatographic test strips that can rapidly and accurately detect the N protein and intact virus in nasal and pharyngeal swab samples after SARS-CoV-2 infection. It is rapid, convenient, suitable for on-site testing, and low-cost, providing a reliable immunological technique for rapid and efficient detection of SARS-CoV-2 infection. Attached Figure Description
[0026] Figure 1 This is a diagram illustrating the identification process of immunored microspheres.
[0027] Figure 2 To optimize the optimal conditions for the red microsphere immunochromatographic test strip, the concentrations of antibody 4C2 in the T line from left to right were 0.5 μg / ml, 1.0 μg / ml, and 2.0 μg / ml, respectively.
[0028] Figure 3 This diagram illustrates the determination of results using red microsphere immunochromatographic test strips. The left image shows the results for a positive sample, where both the T and C lines are visible. The right image shows the results for a negative sample, where neither the T line nor the C line is visible.
[0029] Figure 4 These are the specific analysis results of the red microsphere immunochromatographic test strip. The test strips detected samples of SARS-CoV-2, MERS, SARS N protein, and a SARS-CoV-2 negative sample.
[0030] Figure 5 The results show the sensitivity analysis of the red microsphere immunochromatographic test strips. The test strips detected SARS-CoV-2 N protein positive samples, diluted from left to right to 100 ng / mL, 10 ng / mL, 1 ng / mL, 500 pg / mL, and 100 pg / mL, respectively.
[0031] Figure 6 The results show the repeatability analysis of the red microsphere immunochromatographic test strips. The top and bottom images show test strips prepared in different batches. From left to right, the tested samples are SARS-CoV-2 N protein positive samples (100 ng / mL, 10 ng / mL, 1 ng / mL, 500 pg / mL) and SARS-CoV-2 N protein negative samples, respectively. Detailed Implementation
[0032] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0033] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. Those skilled in the art can easily understand other advantages and effects of this invention from the content disclosed in this specification. Any modifications or substitutions made to the methods, steps, or conditions of this invention without departing from the spirit and substance of this invention are within the scope of this invention.
[0034] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: ALABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; the series *METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATIN STRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.
[0035] Example 1: Preparation and Identification of Monoclonal Antibodies Against SARS-CoV-2 N Protein
[0036] 1. Preparation of recombinant N protein of SARS-CoV-2
[0037] A DNA fragment synthesized by Nanjing GenScript Biotech Co., Ltd. was used as a PCR template, referencing the SARS-CoV-2 N gene sequence (Gene ID: 43740575) in GenBank. Upstream primer sequences were designed using Primer Premier 5.0 software. AATTTTGTTTAACTTTAAGAAGGAGATATA ATGTCTGATAATGGACCCCAAAATC (underlined sequences are homologous arm sequences, and the restriction site is NcoⅠ) and downstream primer sequences: AGCCGGATCTCAGTGGTGGTGGTGThe DNA template was synthesized and then used to construct the prokaryotic expression vector pET-28a to obtain the recombinant expression plasmid pET-28a-N. The plasmid was then transformed into E. coli BL21(DE3) competent cells for prokaryotic expression. The SARS-CoV-2 N recombinant protein was obtained by purification using the His recombinant protein nickel ion column of Nanjing Genscript Biotech Co., Ltd.
[0038] 2. Animal immunization
[0039] Eight-week-old female BALB / c mice were purchased from the Comparative Medicine Center of Yangzhou University. The specific immunization procedure was as follows: SARS-CoV-2 N protein and Freund's complete adjuvant were mixed at a 1:1 volume ratio and thoroughly emulsified. Three mice were then injected subcutaneously at multiple sites (neck, back, and abdomen). Fourteen days after the first immunization, a second immunization was administered, with each immunization consisting of 200 μL / mouse (containing 80 μg of recombinant SARS-CoV-2 N protein). Seven days after the second immunization, serum antibody titers were measured. Fourteen days after the second immunization, an intraperitoneal injection of 80 μL / mouse (containing 100 μg of recombinant N protein) of unadjuvanted N protein was administered as a booster immunization.
[0040] 3. Cell fusion
[0041] Three days after booster immunization, blood was collected from mice, and serum was stored at -20°C for use as a positive control in subsequent screening. Mice were euthanized according to biosafety procedures, disinfected by alcohol immersion, and spleen cells were fused with logarithmic growth phase SP2 / 0 myeloma cells at a ratio of 1:5 using 50% polyethylene glycol (PEG). Peritoneal macrophages from ICR mice were used as feeder cells. The fused cells and feeder cells were suspended and mixed in HAT medium (Gibco's DMEM medium with HAT supplement) and seeded into 96-well plates, which were then cultured in a 37°C cell culture incubator. After 5 days, HAT medium was added, and after 9 days, HT medium (Gibco's DMEM medium with HT supplement) was used for further culture. When single cell clusters reached approximately 90% confluence in the 96-well plate, the cell supernatant was collected for indirect ELISA detection.
[0042] 4. Establishment of indirect ELISA detection method and screening of positive clones
[0043] Positive cell clones were screened using an indirect ELISA method. The specific method is as follows: ELISA plates were coated with 100 μL / well of SARS-CoV-2 N protein at the optimal coating concentration determined by a checkerboard assay, and incubated overnight at 4°C. After washing three times with PBST, 200 μL of PBS blocking buffer containing 1% BSA was added to each well, and the plates were incubated at 37°C for 2 hours. After blocking, the plates were washed three times with PBST, and hybridoma cell supernatant was added. Negative and positive control groups were set up, with SP2 / 0 cell supernatant as the negative control and SARS-CoV-2 N protein-immunized mouse polyantiserum as the positive control (100 μL / well), and the plates were incubated at 37°C for 2 hours. The plates were washed five times with PBST. 100 μL / well of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (1:5000 dilution) was added, and the plates were incubated at 37°C for 1 hour. After washing seven times, TMB was added for color development for 10 minutes. After color development was terminated, the OD was measured using an ELISA reader. 450 The experimental results are determined according to the following formula: OD value. 450 Cell pores / OD 450 Negative wells with a margin ≥ 2.1 were considered positive wells. The screened positive clones were named 1A2 and 4C2.
[0044] 5. Cloning of positive hybridoma cells
[0045] The selected positive cell clones 1A2 and 4C2 were subcloned three times using the limiting dilution method and then preserved.
[0046] 6. Preparation of monoclonal antibodies against SARS-CoV-2 N protein
[0047] In vivo ascites induction method: 9-12 week old healthy BALB / c mice were intraperitoneally injected with 0.5 mL of liquid paraffin per mouse. Seven days later, they were intraperitoneally inoculated with hybridoma cells 1A2 and 4C2 cultured to the logarithmic growth phase diluted with PBS, 2 × 10⁻⁶ cells per mouse. 5 1 cell / animal; after 7 days, ascites fluid was collected, the supernatant was collected by centrifugation and stored at -70℃.
[0048] The prepared ascites fluid was purified using Protein A+G affinity chromatography and stored at -70°C.
[0049] 7. Identification of monoclonal antibodies against SARS-CoV-2 N protein
[0050] Monoclonal antibody subclass identification was performed using a monoclonal antibody subclass kit (Beijing Bio-Long BF16001). Hybridoma cell culture supernatant (100 μL / well) prepared in Example 1 was added to ELISA plates pre-coated with 1 μg / mL recombinant SARS-CoV-2 N protein. The plates were incubated at 37°C for 2 h. After washing three times with PBST, 100 μL / well of goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, and IgM (diluted 1:1000 with PBS) was added, and the plates were incubated at room temperature for 30 min. The plates were then washed three times with PBST. 100 μL / well of HRP-rabbit anti-goat IgG enzyme-labeled antibody (diluted 1:5000 with PBS) was added, and the plates were incubated at room temperature for 15 min. The plates were washed five times with PBST. 100 μL / well of TMB chromogenic buffer was added, and the plates were incubated at room temperature for 5 min. The reaction was stopped by adding 0.5 M H2SO4 (50 μL / well), and the OD was measured using a microplate reader. 450 According to OD 450 Determine the subclass of monoclonal antibodies.
[0051] The results showed that both the monoclonal antibody 1A2 and the 4C2 subclass were IgG1.
[0052] The results showed that the amino acid sequence of the complementarity-determining region 1 (CDR1) of the light chain variable region of monoclonal antibody 1A2 is as shown in SEQ ID NO.1, specifically: RSSQSLLDTDGKTYLN.
[0053] The amino acid sequence of the complementary determinant region 2 (CDR2) of the light chain variable region is shown in SEQ ID NO.2, specifically: LVSKLDS.
[0054] The amino acid sequence of the complementarity-determining region 3 (CDR3) of the light chain variable region is shown in SEQ ID NO.3, specifically: WQGTHYPLT.
[0055] The amino acid sequence of the heavy chain variable region complementarity-determining region 1 (CDR1) is shown in SEQ ID NO.4, specifically: SFWMH.
[0056] The amino acid sequence of the heavy chain variable region complementarity-determining region 2 (CDR2) is shown in SEQ ID NO.5, specifically: MIDPSDSETHYNQIFKD.
[0057] The amino acid sequence of the complementarity-determining region 3 (CDR3) of the heavy chain variable region is shown in SEQ ID NO.6, specifically: STAPHY.
[0058] The full-length amino acid sequence of the light chain is shown in SEQ ID NO.7:
[0059]
[0060] The nucleotide sequence encoding the light chain is shown in SEQ ID NO.8:
[0061]
[0062]
[0063] The full-length amino acid sequence of the heavy chain is shown in SEQ ID NO.9:
[0064]
[0065] The nucleotide sequence encoding the heavy chain is shown in SEQ ID NO.10:
[0066]
[0067]
[0068] The results showed that the amino acid sequence of the complementarity-determining region 1 (CDR1) of the variable region of the monoclonal antibody 4C2 light chain is as shown in SEQ ID NO.11, specifically: KSSQSLLYSSNQKNYLA.
[0069] The amino acid sequence of the complementary determinant region 2 (CDR2) of the light chain variable region is shown in SEQ ID NO.12, specifically: WASTRES.
[0070] The amino acid sequence of the complementarity-determining region 3 (CDR3) of the light chain variable region is shown in SEQ ID NO.13, specifically: QQYYRYPPT.
[0071] The amino acid sequence of the heavy chain variable region complementarity-determining region 1 (CDR1) is shown in SEQ ID NO.14, specifically: DSMH.
[0072] The amino acid sequence of the heavy chain variable region complementarity-determining region 2 (CDR2) is shown in SEQ ID NO.15, specifically: WINTETGEPAYADDFKG.
[0073] The amino acid sequence of the complementarity-determining region 3 (CDR3) of the heavy chain variable region is shown in SEQ ID NO.16, specifically: AVVADYYAMDY.
[0074] The full-length amino acid sequence of the light chain is shown in SEQ ID NO.17:
[0075]
[0076] The nucleotide sequence encoding the light chain is shown in SEQ ID NO.18:
[0077]
[0078]
[0079] The full-length amino acid sequence of the heavy chain is shown in SEQ ID NO.19:
[0080]
[0081] The nucleotide sequence encoding the heavy chain is shown in SEQ ID NO.20:
[0082]
[0083]
[0084] 8. Eukaryotic expression of monoclonal antibodies against SARS-CoV-2 N protein
[0085] Based on the sequencing results from the previous step, light and heavy chain DNA fragments of the two monoclonal antibodies were synthesized by Taizhou Baiying Biotechnology Co., Ltd. as templates. After PCR amplification (primer sequences are shown in Table 1, with Not I and Xba I restriction sites introduced; PCR system is shown in Table 2), the target gene products of the light and heavy chains of the two monoclonal antibodies were obtained (Pfu DNA Polymerase was purchased from Beyotime Biotechnology Co., Ltd., catalog number: D7216). The pcDNA3.1 plasmid was double-digested with Not I and Xba I (see Table 3). The target gene products of the light and heavy chains of the two monoclonal antibodies were ligated to the plasmid digestion products (see Table 4) and heat-shocked into *E. coli* DH5α competent cells (purchased from Thermo Fisher Scientific, catalog number: EC0112). The cells were plated on ampicillin-resistant plates, cultured, screened, and verified by colony PCR. Positive clones were selected (see Table 5, Taq). DNAPolymerase was purchased from Beyotime Biotechnology Co., Ltd. (Catalog No.: D7209). Recombinant E. coli DH5α was cultured in large quantities, and plasmids were extracted for later use. The extracted plasmids were transfected into CHO-K1 cells (Wuhan Pronosei Biotechnology Co., Ltd., Catalog No.: CL-0062) by electroporation for eukaryotic expression. The plasmids were then purified using a Protein A affinity chromatography column (Purchased from Beyotime Biotechnology Co., Ltd., Catalog No.: P2015-10ml) to obtain recombinant monoclonal antibody 1A2 and recombinant monoclonal antibody 4C2, respectively.
[0086] Table 1. Amplification primers for the light and heavy chains of the two monoclonal antibodies.
[0087]
[0088]
[0089] Table 2. PCR reaction systems for amplification of light and heavy chains of two monoclonal antibodies.
[0090]
[0091] Table 3 Recombinant plasmid pcDNA 3.1 Enzyme digestion system
[0092]
[0093] Table 4. Recombination and linkage systems of two monoclonal antibody light and heavy chains with vectors
[0094]
[0095] Table 5 Colony PCR Validation System
[0096]
[0097]
[0098] Example 2: Preparation and Identification of Immunoreactive Red Microspheres
[0099] Solution preparation:
[0100] Activation buffer: 10 mM MES (morpholine ethanesulfonic acid), pH 6.2 ± 0.05;
[0101] Coupling buffer (BB): 0.01M borax (sodium tetraborate decahydrate) and 0.04M boric acid are mixed at a volume ratio of 1:4, and the pH is adjusted to 7.8±0.05;
[0102] EDC solution: 10 mg / mL EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) solution, prepared with activation buffer, to be used immediately;
[0103] NHS solution: 10 mg / mL NHS (N-hydroxysuccinimide) solution, prepared with activation buffer, to be used immediately;
[0104] Microsphere blocking solution: 0.4M Tris, 1% BSA, 1% Tween-20, pH 8.0±0.05;
[0105] Microsphere washing solution: 50 mM Tris (pH 8.0 ± 0.05), 0.5% BSA, 0.05% Tween-20;
[0106] Microsphere preservation solution: 50mM Tris, 35mM citric acid, 72.5mM NaOH, 5% sucrose, 5% trehalose, 0.2% Tween 20, 0.5% casein, pH 7.8±0.05.
[0107] Activation of microspheres: Take 0.0125 mL of 4% solid content microsphere suspension (purchased from Suzhou Weidu Biotechnology Co., Ltd., catalog number: DR0300CA) into a 2 mL centrifuge tube containing 1 mL of activation buffer, sonicate to mix, centrifuge at 15℃ and 15000 rpm for 10 min, and remove the supernatant; add 1 mL of activation buffer, sonicate to disperse evenly, add 3.5 μL of LEDC solution, vortex to mix, then add 33 μL of NHS solution, vortex to mix; place the centrifuge tube on a turntable, activate at 37℃ and 180 rpm for 15-20 min; centrifuge at 15℃ and 15000 rpm for 10 min to remove the supernatant, add 1.0 mL of coupling buffer, sonicate to disperse evenly, and centrifuge to remove the supernatant to complete the activation of microspheres.
[0108] Conjugation of microspheres to antibodies: Add 0.75 mL of conjugation buffer to the activated microsphere precipitate from the previous step and sonicate to disperse evenly; prepare a new centrifuge tube and dilute 50 μg of antibody to 0.2 mg / mL with conjugation buffer; add the diluted recombinant monoclonal antibody 1A2 to the sonicated microspheres, vortex to mix, place the centrifuge tube on a turntable, and conjugate at room temperature, 40 r / min for 2 h.
[0109] Blocking and preservation of microspheres: Add 0.1 mL of microsphere blocking solution, mix well, place the centrifuge tube on a turntable, and block at 37℃ and 180 rpm for 1 h. After blocking, centrifuge at 15℃ and 15000 rpm for 10 min, remove the supernatant, add 1.5 mL of microsphere washing solution, sonicate to disperse evenly, centrifuge to remove the supernatant, add another 1.5 mL of microsphere washing solution and repeat the washing step once. Finally, add 0.5 mL of microsphere preservation solution, sonicate to disperse evenly, and store at 4℃ for later use. The product is named immunored microspheres. Observe the conjugated immunored microspheres; if there is no insoluble precipitate, they are ready for use.
[0110] Example 3: Preliminary assembly and identification of red microsphere immunochromatographic test strips
[0111] 1. Processing of gold label pads and sample pads
[0112] The sample pad and gold label pad of the test strip are made of glass cellulose membrane with strong hydrophobicity and large pore size. In order to reduce background interference of the test strip and increase the release of the gold label complex, the sample pad was treated with 200mM phosphate buffer (PB) + 3% trehalose, and the gold label pad was treated with 200mM PB + 1.5% trehalose. After drying at 37°C, the samples were sealed and stored at room temperature for later use.
[0113] 2. Detection of NC membrane preparation
[0114] The NC detection membrane was cut into strips measuring 300×25mm. Recombinant monoclonal antibody 4C2 and goat anti-mouse IgG (ABClone, catalog number: AB_2769650) were respectively distributed onto the NC membrane as the test line (T) and control line (C) of the test strip. Recombinant monoclonal antibody 4C2 was diluted to concentrations of 0.5, 1.5, and 2.5 mg / mL using 0.05 mol / L Tris-HCl buffer (pH 8.0), and sprayed onto the NC membrane at a rate of 1 μL / cm as the T line. The membrane was then dried at 42℃ for 4 hours. The test strips were assembled, and the concentration that yielded the best interception effect and required the least amount of SARS-CoV-2 N protein standard was used as the spray concentration for the test strip.
[0115] Goat anti-mouse IgG was diluted to 0.5, 0.75, and 1.0 mg / mL using 200 mM PBS solution at pH 7.2. The diluted C-line was sprayed onto an NC membrane at a rate of 1 μL / cm, 5 mm away from the T-line. The membrane was dried at 42°C for 4 hours, and then assembled into test strips. Positive and negative samples were tested. The concentration at which the C-line showed a color intensity equal to or close to that of the T-line was selected as the spray concentration for the test strip. The sprayed NC membrane was sealed, dried, and stored.
[0116] The results are as follows Figure 2 As shown, the color development of the chromatographic membrane was better when the concentration of the T-line spray was 2.5 mg / mL and the concentration of the C-line spray was 1 mg / mL. Therefore, the concentration of anti-SARS-CoV-2 N protein mAb sprayed on the T-line and the concentration of goat anti-mouse IgG sprayed on the C-line were determined to be 2.5 mg / mL for quality control of the test strips in this experiment.
[0117] The test strips were initially assembled and used to detect SARS-CoV-2 N protein positive and negative standards, and the results were observed. The test strip preparation procedure was as follows: The immunored microsphere solution prepared in the preparation and identification section of Example 2 was evenly spread onto the gold-labeled pad and lyophilized for later use; recombinant monoclonal antibody 4C2 and goat anti-mouse IgG were used to streak lines (approximately 1 mm) on the chromatography membrane as the detection line (T line) and control line (C line), respectively, with a spacing of approximately 5 mm between the T line and C line, and then lyophilized for later use. The gold-labeled pad, chromatography membrane, absorbent filter paper, and sample pad were assembled manually according to the schematic diagram, ensuring that each adhesive position was appropriate and that there were no air bubbles or air pockets at the adhesive points; the joints between the membranes should have a certain overlap and be pressed tightly. The assembled test strips were placed in the slot of the strip cutter and cut into test strips with a width of approximately 4 mm, which were then placed into the test strip holders and sealed and dried at 4°C for later use.
[0118] Apply an appropriate amount of negative and positive samples to the sample pad of the test strip, and observe the results after 15 minutes.
[0119] The results are as follows Figure 3 As shown, if the sample contains SARS-CoV-2 N protein, both the T and C lines will show color, indicating a positive result; if the T line does not show color but the C line does, it indicates a negative result; if the T line shows color but the C line does not, or neither shows color, the test strip is invalid or the operation is incorrect.
[0120] Example 4: Performance Determination of Red Microsphere Immunochromatographic Test Strips
[0121] 1. Specificity evaluation of test strips
[0122] The prepared recombinant SARS-CoV-2 N protein, along with commercially available SARS-CoV N protein (Beijing Yiqiao Shenzhou Technology Co., Ltd., catalog number 40143-V08B) and MERS-CoV N protein (Beijing Yiqiao Shenzhou Technology Co., Ltd., catalog number 40068-V08B), were used as control samples. The specificity of the test strips was evaluated using the developed test strips. During testing, the sample was diluted 1:1000 with BB buffer, and 70 μL was used for testing with the test strips. The test strips were observed visually after approximately 15 minutes, and the results were determined.
[0123] The results are as follows Figure 4 As expected, the test strip with only SARS-CoV-2 N protein added showed color in both the T and C lines, indicating a positive result; the other sample addition groups showed no color in the T line and only the C line, indicating a negative result. This indicates that this test strip does not react with the N protein of coronaviruses with high homology such as MERS and SARS, and has good specificity.
[0124] 2. Sensitivity assessment of the test strips
[0125] The limit of detection (LOD) of the red microsphere test strip was evaluated using the developed test strip to detect SARS-CoV-2 N protein. Physiological saline was used as a diluent to dilute the protein at concentrations of 100 ng / mL, 10 ng / mL, 1 ng / mL, 500 pg / mL, and 100 pg / mL. 70 μL of each concentration was taken and detected using the developed test strip. Results were visually assessed after approximately 15 minutes.
[0126] The results are as follows Figure 5 As shown, when testing positive serum diluted multiple times with test strips, the T line is weak in serum diluted to 500 pg / mL, while only the C line is visible in subsequent dilutions of the test strip, indicating a sensitivity of up to 500 pg / mL.
[0127] 3. Repeatability assessment of test strips
[0128] Test strips made from different batches were used to detect SARS-CoV-2 N protein-positive and negative samples, and the results were observed. The results are as follows: Figure 6As shown, when three SARS-CoV-2 N protein-positive and negative samples were tested with test strips prepared at different times, there was no significant difference in the test results.
Claims
1. A red microsphere immunochromatographic test strip for detecting SARS-CoV-2, characterized in that, The test strip comprises antibody 1A2 and antibody 4C2. Antibody 1A2 includes a 1A2 light chain variable region and a 1A2 heavy chain variable region. The amino acid sequences of the three complementarity-determining regions in the 1A2 light chain variable region are shown in SEQ ID NO. 1-3, and the amino acid sequences of the three complementarity-determining regions in the 1A2 heavy chain variable region are shown in SEQ ID NO. 4-6. Antibody 4C2 includes a 4C2 light chain variable region and a 4C2 heavy chain variable region. The amino acid sequences of the three complementarity-determining regions in the 4C2 light chain variable region are shown in SEQ ID NO. 11-13, and the amino acid sequences of the three complementarity-determining regions in the 4C2 heavy chain variable region are shown in SEQ ID NO. 14-16. The test strip also includes a binding pad of red microspheres labeled with a monoclonal antibody against SARS-CoV-2 N protein, an NC membrane coated with a monoclonal antibody against SARS-CoV-2 N protein and goat anti-mouse IgG, a sample pad, an absorbent pad, and a PCV base plate. The preparation method of the test strip includes the following steps: (1) The antibody 1A2 was added to the red microsphere solution for labeling; then, under stirring, the red microsphere complex blocking solution was added for blocking; the labeled immunored microsphere solution was centrifuged at low speed, and the precipitate of the microsphere complex was suspended with the red microsphere complex diluent to obtain purified immunored microspheres. Spread the immunored microsphere solution evenly onto the gold-labeled pad and dry it for later use; (2) Cut the NC detection membrane into strips, and distribute the antibody 4C2 and goat anti-mouse IgG onto the NC membrane as the test line and control line of the test strip, respectively, and dry them for later use; (3) Assemble the gold label pad, chromatography membrane, absorbent paper and sample pad.
2. The method for preparing the SARS-CoV-2 detection red microsphere immunochromatographic test strip according to claim 1, characterized in that, Includes the following steps: (1) The antibody 1A2 was added to a red microsphere solution for labeling; Then, under stirring, the red microsphere complex blocking solution was added for blocking; the labeled immunored microsphere solution was centrifuged at low speed, and the precipitate of the microsphere complex was suspended with the red microsphere complex diluent to obtain purified immunored microspheres; Spread the immunored microsphere solution evenly onto the gold-labeled pad and dry it for later use; (2) Cut the NC detection membrane into strips, and distribute the antibody 4C2 and goat anti-mouse IgG onto the NC membrane as the test line and control line of the test strip, respectively, and dry them for later use; (3) Assemble the gold label pad, chromatography membrane, absorbent paper and sample pad.
3. The preparation method according to claim 2, characterized in that, The red microsphere solution in step (1) includes polystyrene microspheres containing red dye, the microspheres having carboxyl groups on them and a particle size of 300±5 nm.
4. The preparation method according to claim 2, characterized in that, The labeling concentration of antibody 1A2 in step (1) is 100±5 μg / mL.
5. The preparation method according to claim 2, characterized in that, The concentration of antibody 4C2 in step (2) is 0.5~2.5 mg / mL.
Citation Information
Patent Citations
Colored microsphere-based immunochromatographic test strip for quantitatively detecting procalcitonin and preparation method thereof
CN115980339A
SARS-CoV-2 N protein monoclonal antibody as well as preparation method and application thereof
CN116514964A